Abstract
CD58 has been implicated in immune suppression and is associated with stemness in various types of cancer. Nonetheless, efficient biomarkers for assessing cancer patient response to immunotherapy are lacking. The present work focused on assessing the immune predictive significance of CD58 for patients with glioma. The expression of CD58 correlates with the clinicopathologic characteristics of patients with glioma, suggesting CD58high cells to signify glioma with tumorigenic potential. The CD58high cells displayed accelerated tumor formation compared to CD58low cells in vivo. Taken together, CD58 could potentially serve as a marker for glioma. CD58high glioma induces macrophage polarization through CXCL5 secretion, where M2 macrophages regulate PD-L1 expression within CD58high glioma via IL-6 production in vitro. Moreover, it was found that combination treatment with CD58 significantly increased the volume of tumors in the xenograft specimens. Evaluating CD58 expression represents a promising approach for identifying patients who can benefit from immunotherapy.
Subject terms: Cancer microenvironment, Prognostic markers
This study shows that glioma cells expressing CD58 induce macrophage polarization through CXCL5 secretion, which in turn regulates PD-L1 expression via IL-6 production.
Introduction
Immune checkpoint blockades-based immunotherapy represents the candidate treatment for advanced solid and liquid tumor patients1. Immune structure, with the feature of typical infiltrating immune cell components, density and functional status in tumor microenvironment (TME), significantly influences clinical outcomes2,3. TME-targeting immunotherapy has emerged as a cancer treatment. However, because of the considerable TME heterogeneity, monoclonal anti-programmed cell death protein 1 (PD-1) antibody is associated with a poor response rate4. Therefore, identifying new immunoregulatory factors for enhancing anti-tumor response is crucial. Macrophages account for innate immune cells with the highest abundance within TME, which demonstrate potent tumor-promoting and immunosuppressive activities in numerous cancers and are important for establishing efficient anticancer immunity5. In line with environmental cues, tumor-associated macrophages demonstrate various activation statuses to exert typical effects, which are simply categorized into classically activated6–8. Nonetheless, cancer cells are recently suggested to increase anti-phagocytic marker expression, evading macrophage phagocytosis9. Therefore, a comprehensive exploration of the significance of macrophages in cancer is essential.
CD58, called LFA-3 as well, is an immune adhesion molecule and a surface glycoprotein with a high glycosylation level (40–70 kDa), besides, its expression can be widely detected in nonhematopoietic and hematopoietic cells10,11. CD58 expressed on the cell surface enhances the effector–target adhesion in the case of antigen-specific recognition12. It also provides an efficient second signal to activate T cells, as a result, it can optimize and replenish the TCR/CD3 pathway-regulated proliferative response13,14. CD58 expression is regulated by cytokines in a cell-dependent manner15–17. CD58 expression remained unchanged after bronchial epithelial cells were stimulated by TNF-α and IFN-γ18. CD58 is the risk factor, and there is no definite report regarding its relation with tumor-associated macrophages. Such observations provide more information regarding the effect of CD58 on cancer and offer the potential predictive system for evaluating the prognosis of cancer patients.
Results
CD58 expression in pan-cancer
For analyzing CD58 levels in healthy and tumor tissues, the UCSC xenaShiny online approach was used. CD58 expression in pan-cancer was analyzed, which suggested that CD58 expression was significantly different in tumors compared with matched non-carcinoma tissues (Fig. 1a). Subsequently, patients from the cohort of 33 cancers were classified as low- or high-expression group according to the median CD58 gene expression. To be specific, patients showing high CD58 expression displayed decreased overall survival (OS) and disease-specific survival (DSS) compared with those exhibiting low CD58 expression in low-grade glioma (LGG), GBM, HCC (hepatocellular carcinoma), and PAAD cohorts (Fig. 1b). Subsequently, we utilized the TCGA database to analyze the overall survival (OS) and disease-specific survival (DSS) of glioma patients. The analysis results revealed that patients with high CD58 expression had poorer prognoses in terms of both OS and DSS compared to those with low CD58 expression (Fig. 1c, d). Additionally, CD58 expression was elevated in glioma tissues in comparison with that in the adjacent tissues (n = 42) (Fig. 1e). We also used western blot analysis to examine the expression levels of CD58 in gliomas. The results indicated that the expression levels of CD58 in gliomas were significantly higher than those in adjacent non-cancerous patients (n = 4) (Fig. 1f). Subsequently, we divided the glioma tissues into two groups based on the expression levels of CD58, and combined this with patient prognosis data to analyze the overall survival (OS). The results indicated that patients with high CD58 expression levels had worse prognoses compared to those with low CD58 expression levels (Fig. 1g). These findings revealed CD58 to be an oncogenic gene in glioma. As verified by the aforementioned results, CD58 expression is markedly associated with clinicopathologic features of patients with glioma.
Fig. 1. CD58 expression in pan-cancer.
a UCSCXenaShiny was utilized for visualizing CD58 mRNA levels based on the cancer genome atlas (TCGA) pan-cancer datasets. *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001, ns = not significant (Wilcoxon test). b Risk plot illustrating the relation of CD58 with overall survival (OS) and disease-specific survival (DSS) (red stands for HR > 1 (risky) and P < 0.05; blue stands for HR < 1 (protective) and P < 0.05; gray stands for no significance and P > 0.05). c, d Analyzing the correlation between CD58 expression levels in glioma patients and overall survival (OS) and disease-specific survival (DSS) using the TCGA database. e Using immunohistochemistry to determine the expression levels of CD58 in glioma tissues compared to adjacent non-cancerous tissues. f Using western blot to determine the expression levels of CD58 in glioma tissues compared to adjacent non-cancerous tissues. g OS of patients with glioma according to the patients informed.
CD58high glioma cells harbor stemness properties
The exact role of CD58 in glioma is poorly explored. For analyzing the effect of CD58 on glioma, GSEA was initially carried out on the glioma database by classifying patients with glioma into two groups based on median CD58 level (CD58high vs.CD58low). Relative to CD58low, CD58high glioma showed significantly enriched genes associated with stem cells (Fig. 2a). Additionally, CD58, and additional several stemness-related genes (NANOG, SOX2, POU5F1), in particular SOX2, remarkably increased in spheres in comparison with adjacent monolayer cells (Fig. 2b), thereby suggesting an association between CD58 and cancer stemness in glioma. Aldehyde dehydrogenase A1 (ALDHA1) serves as the extensively identified and operative stemness marker. CD58high cells showed enhanced ALDH activity relative to CD58low cells within several glioma cell lines (Fig. 2c). To gain further insights into these distinct populations of glioma, flow cytometry was carried out for purifying glioma cells according to CD58 level. Based on quantitative RT-PCR assay, key stemness gene (NANOG, SOX2, and POU5F1) levels increased within CD58high cells relative to CD58low cells (Fig. 2d). For elucidating the signaling pathway potentially related to regulating CD58 expression, U251 and U313 cells were exposed to Wnt, Notch, Hedgehog and Hippo (YAP1) pathways-specific inhibitors. According to our findings, just YAP1 inhibitors were able to partly down-regulate CD58high (Fig. 2e), suggesting the potential involvement of Hippo-YAP pathways in regulating CD58 level within glioma. When equal numbers of cells (1 × 106) were inoculated into BLAB/C mice, the CD58high cells displayed accelerated tumor formation compared to CD58low cells (Fig. 2f, g). We also performed survival analysis to estimate the frequency of tumor-initiating cells in the CD58high and CD58low cell populations (Fig. 2h). Thus, CD58high cells represent glioma with tumorigenic potential. Collectively, CD58 may be the marker for glioma.
Fig. 2. CD58high glioma cells harbor stemness properties.
a Gene set enrichment analysis (GSEA) revealed that CD58high cells showed positive enrichment of stem cells compared with CD58low cells from the TCGA (PAAD) database. b U251 and U373 cells were cultured to be monolayers and spheres. Flow cytometry analysis on CD58 level within spheres relative to adjacent cells. c Flow cytometry analyses of CD58high and CD58low cells in glioma cells. DEAB, the specific ALDH1 inhibitor, was adopted to be a control. d, e Relative levels of CD58 and stemness-associated genes were analyzed through qPCR and western blot. Results are represented by mean ± SEM, n = 3, **P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001; n.s. = not significant. f, g CD58high and CD58low cell subpopulations based on U251 and U373 cells were sorted for tumor formation. Results are represented by mean ± SEM, n = 3, **P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001; n.s. = not significant. h Correlation of CD58 with prognosis of overall survival (OS) of GBM cases. Results are represented by mean ± SEM, n = 3, **P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001; n.s. = not significant.
CD58high induced PD-L1 in glioma
To investigate the effect of CD58 on modulating TME, we examined PD-L1 level in glioma using flow cytometry (Fig. 3a). Additionally, microscopy imaging was performed to elucidate the crosstalk mechanism between CD58 and PD-L1 (Fig. 3b). Our findings indicate that the treatment of glioma cells with OE-CD58 and sh-CD58 regulated PD-L1 level; the induction of PD-L1 expression showed a CD58-dependent manner (Fig. 3c, d). We then studied the potential interaction between CD58 and PD-L1. Our Co-IP analysis results showed no interaction between CD58 and PD-L1 in glioma cells (Supplementary Fig. 1a–d). Nevertheless, these results still suggest that CD58 could be a promising approach for cancer immunotherapy.
Fig. 3. CD58high induced PD-L1 in glioma.
a Flow cytometry analyses of CD58 and PD-L1 from glioma cells, n = 3. b Immunofluorescence localization of CD58 (red) and PD-L1 (green) within glioma tissues; co-localization of CD58 and PD-L1 is denoted as yellow. Scale bars: 200 µm. c, d Glioma cell lines (U251 and U373) were fractionated based on their CD58 expression levels into high and low groups using flow cytometry. Subsequently, modulation of CD58 expression was achieved through knockdown or overexpression in these glioma cell lines, followed by assessment of alterations in PD-L1 protein expression levels using western blot analysis.
CD58high is associated with immunosuppressives in glioma
For validating the immune distribution of CD58, a CIBERSORT analysis on glioma was carried out. The results revealed that CD58 significantly reduced CD8+ T cell infiltration into glioma tumors (Fig. 4a). Furthermore, CD3+ T cells were cultured within a conditioned medium of human GBM cells before collection after 4 days to conduct flow cytometry. To assess the immunosuppressive nature of glioma, CD8+ T cells were cultured with sh-CD58 or OE-CD58 glioma cells. In the present functional test, CD8+ T cell proliferation was significantly impaired when co-cultured with OE-CD58 glioma cells (Fig. 4b–e). Thus, CD58 reprogrammed glioma cells into immunosuppressive states.
Fig. 4. CD58 is largely associated with immunosuppressive in glioma.
a CIBERSORT revealed the immune cell inflation involved in CD58high glioma. b–e CD8+ T cells were co-cultured with glioma-conditioned medium into the 96-well round bottom plates for a 2-day period. Typical flow cytometry plot reveals that CD8+ T cells co-culture with conditioned medium from glioma cells. Results are represented by mean ± SEM, n = 5, **P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001; n.s. = not significant.
CD58high is related to anti-tumor immunity of glioma
The enrichment of CD58high as the favorable factor for the prognosis of pan-cancer has been established; we focused on elucidating the associated mechanism. GSEA analysis revealed that when compared with CD58low glioma, cytokine–cytokine receptor interaction evidently increased in CD58high glioma (Fig. 5a). Besides, according to CIBERSORT algorithm analysis, immune cell infiltration was significantly different in CD58high relative to CD58low glioma. M2 macrophage infiltration degrees of CD58high glioma remarkably elevated in comparison with CD58low glioma (P = 0.002 and P < 0.001, separately; Fig. 5b). This study later examined and categorized 62810 single-cell transcriptomes through GSE140819. CD58 exhibited an apparently enriched signature gene associated with macrophage polarization (Fig. 5c). To further validate the distribution of CD58, we performed IF double staining on glioma. The results of IF double staining in glioma revealed that macrophage cells were more abundant in glioma tissues than normal tissues (Fig. 5d). These findings suggest that CD58high contributes to the regulation of macrophage.
Fig. 5. CD58high is associated with anti-tumor immunity in glioma.
a Gene set enrichment analysis (GSEA) suggested that antigen processing and presentation and cytokine–cytokine receptor interaction were enriched in CD58high glioma. b CIBERSORT algorithm analysis on CD58high and CD58low glioma tissues. c t-distributed stochastic neighbor embedding (t-SNE) analyses on 62,810 single-cell transcriptomes. d Representative confocal images showing the location of CD206 in relationship to CD68-positive tumor islands. Scale bar: 200 mm.
CD58high secrete CXCL5 recruitment macrophage migration
To ascertain the role of CD58 in regulating macrophages, the cancer cells from the glioma cell culture and glioma co-culture with THP-1 were examined. Cytokines with significant up-regulation included CXCL5 (Fig. 6a). For identifying the CXCL5 source, we conducted RT-PCR for detecting the CXCL5 expression in glioma and macrophage based on the co-cultured system respectively and in non-co-cultured glioma and macrophage. CXCL5 expression within glioma cells acquired based on the co-cultured system increased compared to other groups (Fig. 6b). Consistently, CXCL5 was mainly derived from CD58high in TME, according to immunofluorescence localization results (Fig. 6c). Expression of CD58high inpatients with glioma displayed positive relation to CXCL5 within glioma samples, indicating that CD58high can enhance macrophage expansion through releasing CXCL5 within glioma tissue. To address if CXCL5 is related to CD58high mediated macrophage polarization, the CXCL5 inhibitor and recombinant proteins were added to the glioma (OE-CD58 and sh-CD58) and macrophage co-culture assays. The polarization of macrophage was induced by the glioma (OE-CD58) and CXCL5 inhibitor (Fig. 6d). To further explore the role of CXCL5 in glioma-mediated macrophage migration, a CXCL5 inhibitor and recombinant proteins were individually added to the glioma (OE-CD58 and sh-CD58) and macrophage co-culture assays, the migration of macrophage was induced by the glioma (OE-CD58) and CXCL5 inhibitor (Fig. 6e). Collectively, these findings suggest that CD58high contributes to the polarization and migration of macrophage through CXCL5 secretion.
Fig. 6. CD58high secrete CXCL5, which anchors macrophage.
a The cytokine kit was applied in detecting cytokines within cancer cells obtained in CD58high/THP-1 co-culture and CD58high cultures alone. Results are represented by mean ± SEM, n = 3, **P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001; n.s. = not significant. b CXCL5 levels in cells obtained in the co-cultured system and CD58high/THP-1 and THP-1 cultures alone, according to reverse-transcription PCR (RT-PCR). Results are represented by mean ± SEM, n = 3, **P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001; n.s. = not significant. c Immunofluorescence localization of CD58 (red) and CXCL5 (green) within glioma tissues; co-localization of CD58 and CXCL5 is denoted as yellow. Scale bars: 200 µm. d The polarization of macrophage co-cultured CD58high with CXCL5 neutralizing antibody and recombinant proteins. Results are represented by mean ± SEM, n = 3, **P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001; n.s.=no significant. e Cell numbers in macrophage co-cultured with CD58high cells. Results are represented by mean ± SEM, n = 3, **P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001; n.s. = not significant.
The STAT3 signaling pathway induced PD-L1 expression of CD58high glioma
For exploring the interplay of CD58high glioma cells with attached macrophages, this study constructed the co-culture system based on CD58high glioma cells as well as THP-1 cells. Following 36-h co-culture, primed THP-1 cells were isolated to conduct RT-PCR assay. To our surprise, IL-6, IL8, and IL-10 levels within THP-1 cells increased upon co-culture with CD58high glioma cells (Fig. 7a). IL-6 is known to activate PD-L1 expression in glioma cells by STAT3 and NF-κB pathways19. The present work then investigated whether IL-6 signaling could affect PD-L1 levels within CD58high glioma. PD-L1 expression of CD58high glioma increased after treatment with IL-6 recombinant protein (Fig. 7b). Additionally, flow cytometry analysis revealed that interleukin-6 (IL-6) is capable of inducing PD-L1 expression in CD58high cells (Fig. 7c), which supports the in vitro results. Therefore, IL-6 signaling stimulates PD-L1 levels. According to our results, inhibition of STAT3, but not of NF-κB, abrogated IL-6-induced expression of PD-L1 (Fig. 7d), suggesting that IL-6 increases PD-L1 expression by activating STAT3 signaling. We later analyzed whether CD58 can be applied in treatment by using the mouse xenograft model. Injecting glioma cells in nude mouse caudal veins harboring the subcutaneous xenograft resulted in significant tumor growth induced by CD58. For better evaluating if CD58 treatment could abrogate TME, tumor samples were collected and it was found that combination treatment with CD58 significantly induced the volume of tumors in the xenograft specimens (Fig. 7e). CD58, CXCL5, and PD-L1 levels in human specimens were analyzed using immunofluorescence staining (Fig. 7f). Collectively, these findings suggest that CD58 holds promise as the efficient treatment for suppressing tumor development.
Fig. 7. STAT3 pathway regulated by IL-6-induced PD-L1 expression of CD58high glioma.
a THP-1 monocytes were subjected to culture with/without CD58high glioma cells for a 36-h period, followed by harvesting for qPCR assay. Bar graphs display that IL-6, IL-8, and IL-10 expression elevated within THP-1 cells following co-culture with glioma cells. Results are represented by mean ± SEM, n = 3, **P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001; n.s. = not significant. b CD58high glioma cells were harvested to determine PD-L1 expression. After 24 h of IL-6 treatment (10 ng/mL), CD58high glioma was used for western blot. c Using flow cytometry to analyze the regulation of PD-L1 expression levels in CD58high glioma by interleukin-6 (IL-6). After 24 h of IL-6 treatment (10 ng/mL), CD58high glioma was used for flow cytometry analysis. d The expression level of PD-L1 was analyzed by western blot. CD58high glioma was subjected to 30-min of Stattic (10 µmol/L) and 30-min of NF-κB-IN-1 (10 µmol/L) pretreatment, and later 24-h IL-6 treatment (10 ng/mL). e Typical bioluminescent images showing mouse growth, with the in vivo imaging system. Simultaneously using the IVIS imaging system to analyze tumor volume and evaluate the regulatory role of CD58 on tumors (n = 3). Results are represented by mean ± SEM, n = 3, **P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001; n.s. = nor significant. f Using immunofluorescence to analyze the expression of PD-L1 (red), CD58 (green), and CXCL5 (white) in human glioma samples. Scale bars: 200 µm.
Discussion
Although anti-PD-L1 therapy is successfully applied in various solid tumors, it is only beneficial for a small proportion of patients with glioma. The present work reveals a close correlation between elevated CD58 levels and dismal prognosis, as well as stemness properties of patients with glioma. We also found that CD58 activates CXCL5 secretion, inducing the recruitment and polarization of M2-like macrophages and subsequent immune escape. The M2 polarized macrophages and IL-6 production was induced by CXCL5. Moreover, PD-L1 expression was upregulated in glioma and associated with the IL-6-STAT3 pathway activity. Although several studies have suggested that CD58 can facilitate tumor development, its precise activity is still unknown20,21. According to our results, CD58 enhanced tumor development and is associated with dismal prognostic outcomes in patients with glioma. CD58 was identified as a stemness marker that targets colorectal cancer22. For solid tumors, like gastric carcinoma, CD58 up-regulation shows a positive relation to poor survival rates, vascular invasion, and metastasis23. CD58 has been proposed as a possible marker for immature cancer cells. The present work also identifies CD58 as the new marker for glioma stemness.
Remarkably, we present evidence that CD58 up-regulation leads to the immunosuppressive microenvironment. CXCL5 can be a pivotal cytokine regulating the proliferation, survival, and differentiation of monocyte/macrophage, and promoting their polarization and recruitment19,24–27. Our research substantiates that CD58-regulated CXCL5 expression and the secreted CXCL5 substantially promoted M2 polarization in the recruited macrophages, thus leading to the inhibitory TME that promotes cancer development. Patients showing high M2 infiltration degrees cannot respond to anti-PD-L1 therapy27. Moreover, CXCL5 can enhance cancer development through the activation of several signals28,29. In tandem, the CD58/CXCL5 axis has a strong role in driving tumor development and anti-PD-1 resistance of glioma. Macrophages are a critical component in tumor-infiltrating cells within TME, which have the immunosuppressive effect, and enable tumor escape from immune surveillance and immune-effector cell attack30–32. Nonetheless, underlying macrophage infiltration mechanisms within tumor tissues affecting cancer cell activity, remain incompletely understood. This work sheds more light that CD58high cancer cells enhance macrophage expansion in glioma. According to our cytokine profile screening, CD58high glioma released CXCL5, promoting macrophage polarization in glioma.
Macrophages are recognized as a primary source of IL-633,34. Our study also highlights that IL-6 predominantly originates from macrophages within the TME in cancer. IL-6 is generally carcinogenic within advanced tumors34,35, particularly the IL-6 signaling pathway acting as the oncogenic factor. Patients showing IL-6 up-regulation demonstrate a dismal prognostic outcome36, conforming to our results. IL-6, a key inflammatory factor, is often associated with tumorigenesis and angiogenesis and is predictive of dismal prognostic outcomes of different cancer patients, including colorectal cancer37. Additionally, IL-6 enhances breast cancer and hepatocellular carcinoma32,38. Notably, targeting the IL-6 pathway can induce cancer stem cell survival and facilitate glioma development39,40. Conforming to prior results, our study reveals that IL-6 autocrine signaling enhances the immune characteristics of CD58high glioma.
Most immune cells within TME are TAMs, and they are tightly associated with tumor development, migration, invasion, and angiogenesis. TAMs exert the dual role of tumor eradication and tumor promotion41,42. Activated macrophages are divided into two types, including M1 and M2 types, both of which are related to tumorigenesis43. Macrophage infiltration shows a positive relation to PD-L1 levels within cancer cells44. Macrophage infiltration within GC tissue samples is closely related to PD-L1 level within cancer cells45.
In numerous studies, NF-kB and STAT3 pathways are related to regulating PD-L1 levels via diverse inflammatory cytokines46–48. Infiltrating macrophages can increase PD-L1 levels via NF-kB and STAT3 pathways in HCC cells49, corroborating our findings. In this study, IL-6, generated via macrophages, induces PD-L1 expression of glioma via STAT3 pathway. Previously, macrophage-derived inflammatory cytokines have been found to enhance cancer cell growth50. These results suggest that macrophage-derived inflammatory cytokines enhance glioma growth. Additionally, our investigation confirms that IL-6 generated via macrophages induces PD-L1 expression of glioma via IL-6/STAT3 signaling pathways. Our results further indicate that CD58high glioma induces macrophage polarization through CXCL5 secretion, which in turn regulates PD-L1 expression within CD58high glioma via IL-6 production (Supplementary Fig. 2).
Methods
Patients and tissues
We harvested 60 human glioma tumor samples from surgical patients from China Medical University between November 2019 and January 2021. Glioma was confirmed through histology in each patient. In this study, patients who had active infection, inflammatory diseases, or those receiving neoadjuvant treatment were eliminated. Patients were staged in line with the American Joint Committee on Cancer version 8 (AJCC 8). Samples were collected after obtaining informed consent. Our study protocols gained approval from the Committee for the Ethical Review of Research at The Fourth Affiliated Hospital, China Medical University, and all ethical regulations relevant to human research participants were followed. Immunohistochemical analysis was performed on formalin-fixed paraffin-embedded samples.
Cell lines
Human glioma cell lines, U251 and U373, THP-1 cells were obtained from the American Type Culture Collection (ATCC) and identified through short tandem repeat (STR) analysis. After collection, cells were cultured within DMEM (Corning) that contained 10% FBS (BI), 1% penicillin, and streptomycin (Gibco) and incubated under 5% CO2 and 37 °C conditions. Primary glioma cells and glioma cells were later inoculated into the poly-HEMA-coated 24-well plates (200 cells/well, Corning) filled with serum-free cloning medium that contained 20 µg/L basic fibroblast growth factor (bFGF), 20 µg/L epidermal growth factor (EGF), 4 mg/L insulin, together with 0.4% bovine serum albumin (BSA). The cells were then cultivated under 37 °C and 5% CO2 conditions for a 7-14-day period.
Bioinformatics analysis
A total of 518 primary LGG samples with complete gene expression profiles were selected in The Cancer Genome Atlas (TCGA) database based on specific parameters51. Moreover, the TCGA consortium was adopted to characterize more details of the demographics of the above patients. According to hypergeometric distribution, differentially expressed genes (DEGs) were later subjected to Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment with R software. In addition, the Molecular Signature Database (MSigDB) was used in gene set enrichment analysis (GSEA) to annotate gene functions. To assess tumor immunity modulation via CD58 in LGG, we utilized TIMER2.0, the platform providing a strong estimation of immune infiltration degrees, to analyze the relation of CD58 with immune cell signatures52. The CIBERSORT tool was used to calculate potential immune cell proportions based on gene expression levels (https://cibersort.stanford.edu/). For exploring the association of CD58 with immune cells, analysis was conducted on NCBI’s Gene Expression Omnibus GEO database (GSE140819), which classified 62810 single-cell transcriptomes53.
Western blot
Total cellular protein was extracted with sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS–PAGE), followed by transfer onto the polyvinylidene fluoride (PVDF) membrane (Millipore, Billerica, MA, USA). Thereafter, BSA was added for membrane blocking, followed by overnight antibody incubation under 4 °C. Antibodies (1:1000) used included CD58 (Thermo; PA5–78992), PD-L1 (Proteintech; 66248–1-Ig), β-actin (cell signaling technology; #4967).
Co-immunoprecipitation
Protein-protein interactions were investigated using the Co-immunoprecipitation (Co-IP) method. Glioma cells were lysed in a RIPA buffer supplemented with a combination of protease and phosphatase inhibitors. Subsequently, the lysates were incubated overnight at 4 °C following the addition of primary antibodies to the flasks. The resulting mixture of cleavage products and antibodies was then bound to magnetic beads and agitated at 25 °C for 50 min. The plates underwent three washes with 200 µL of PBS at room temperature, each lasting for 10 min. For the western blot experiments, the sample mix was prepared by heating 35 µL of SDS sample buffer at 95 °C for 10 min, followed by a brief centrifugation at 4500 r.p.m. for 30 s. Primary antibodies: CD58 Monoclonal Antibody (TS2/9) (Thermo; MA5800), PD-L1 (E1L3N®) (CST, XP® Rabbit mAb, #13684). Secondary antibodies: Mouse Anti-rabbit IgG (Conformation Specific) (L27A9) mAb (HRP Conjugate) #5127.
In vivo tumorigenicity assay
The 4–5-week-old male athymic nude (BALB/c-nu) mice were provided by Beijing Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China). Anesthesia is administered during the procedure via intraperitoneal injection of 1.5% pentobarbital sodium at a dosage of 0.04–0.05 mL/g. To investigate the role of CD58 in tumor progression, BALB/c-nu mice were given intracranial injections of U251 and U373 cells (2 × 106 cells) contained within 100 µL PBS. Mouse sacrifice for brain removal was conducted 2 weeks later. Euthanasia of the animals is carried out by exsanguination following the administration of anesthesia with 1.5% pentobarbital sodium via intraperitoneal injection at a dosage of 100–200 mg/kg. At a tumor volume of 100 mm3, we randomized tumor-bearing mice into four groups. Every animal experiment gained approval from the Ethics Committee for Animal Research of China Medical University.
Immunohistochemistry (IHC)
Paraffin-embedded tissues were subjected to IHC staining with antibodies against CD58 (1:500; Thermo, PA5-78992), CXCL5 (1:400; ab248173; Abcam), IL-6 (1:500; Proteintech; 21865-1-AP), and PD-L1 (1:500; Proteintech; 66248-1-Ig). Protein expression patterns were evaluated in line with the previous standard procedures. The quick (Q) score was used to score staining results, and it was determined by multiplying positive cell proportion by intensity. patients with glioma were classified into low or high-expression groups according to the median Q scores (Q = 150). All protocols using human specimens gained approval from the Institutional Review Board of the China Medical University. All subjects provided informed consent.
Immunofluorescence
Glioma tissues were incubated overnight with primary antibodies, CD58 (1:100; Thermo, PA5-78992) and CXCL5 (1:100; ab248173; Abcam) under 4 °C. Cells were rinsed thrice by PBS, followed by 2-h incubation using secondary antibody at room temperature. The images were obtained using a ZEISS microscope with a ×20 objective lens.
Flow cytometry
A FACS Calibur (BD Biosciences, USA) was employed for flow cytometry. After dissociation into single-cell suspensions, tumor cells were rinsed prior to incubation within the staining solution that contained 2 mE EDTA and 1% BSA using appropriate fluorescent monoclonal antibodies or corresponding isotype controls for a 30-min period under 4 °C. Antibodies were directly conjugated with FITC, PE, APC, or if unavailable, fluorophore-conjugated secondary antibodies were utilized: CD58 Recombinant Rabbit Monoclonal Antibody (083), FITC (1:100; Thermo, MA5-46751); PD-L1 Monoclonal Antibody (MIH5), PE (1:100; Thermo, A14764); CD206 Polyclonal Antibody, APC (1:100; Thermo, PA5-46879); 7-AAD/CFSE Cell-Mediated Cytotoxicity Assay Kit (CST, #72782); Rapid-Act T Cell Activation Kit (Mouse, Anti-CD3/CD28) (CST, #86772); CD8α (RPA-T8) Mouse mAb (FITC Conjugate) #55397; Granzyme B (D2H2F) Rabbit mAb (PE Conjugate) (CST, #65563). Subsequently, after cell analysis, Cell Quest software (BD Biosciences, USA) was employed to calculate the results.
Real-time PCR
mRNA levels were quantified by real-time PCR. By adopting TRIzol Reagent (Invitrogen), RNA was extracted and prepared into cDNA with the StepOne Real-Time PCR System (BioRad, 1708840). The data were analyzed with StepOne Software v2.2.1 (Bio-Rad). Samples were analyzed for cytokines in triplicate, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was employed for normalization.
CD90 F:GCATGGGCTAAGGATTTGGA; R:TCCCAAATTTAGCCTGTTGG;
NANOG F:ATTGCCTGCATTTTTCATCC; R:GAGGCAGGTCTTCAGAGGAA;
SOX2 F:GGGAA ATGGGAGGGGTGCAAAAGA; R:TTGCGTGAGTGTGGATGGGATTGG;
POU5 F1 F:GACTGAGAGGCAACCTGGAGAAT; R:ACCGAGGAGTACAGTGCAGTGAA;
CXCL5 F:TGGACGGTGGAAACAAGG; R:CTTCCCTGGGTTCAGAGAC;
IL-6 F:AACTGAACCTTCCAAAGATGG; R:TCTGGCTTGTTCCTCACTACT;
IL-8 F:CATACTCAAACCTTTCCACCCC; R:TCAGCCCTCTTCAAAAACTTCTCCA;
IL-10 F:GTGATGCCCCAAGCTGAGA; R:CCCCCAGGGAGTTCACATG;
β-Actin F:GGCTACAGCTTCACCACCAC; R:GCACTGTGTTGGCGTACAGG;
ELISA
Tumor cells (2 × 105) were suspended within 200 µL D0 medium, pretreated under 37 °C, and inoculated into 96-well plates for a 3-h period. Subsequently, we harvested culture supernatants and preserved them under –80 °C. After cell and tumor tissue lysis, the Bio-Rad protein assay kit was employed for quantification. Culture supernatants, cell lysates, tumor lysates, and plasma were assayed by using Finally, the human cytokines immunoassay kit (BioLegend, 440904) was employed for measuring culture supernatants, tumor lysate, cell lysates, and plasma.
Chemokine analysis
In chemokine assay, 1 × 106 tumor cells were co-cultured within D0 medium (1 mL) under 37 °C for a 16-h period. Later, cell lysates and supernatants were harvested for chemokine detection with the Proteome Profiler Human ChemokineArray Kit (R&D Systems, ARY017).
Mice and tumor formation
BALB/C and C57BL/6 (8–12 weeks, female) were obtained and kept in the animal facility of China Medical University. Glioma cells were originally obtained from ATCC and used in vitro after several passages. Anesthesia is administered during the procedure via intraperitoneal injection of 1.5% pentobarbital sodium at a dosage of 0.04–0.05 mL/g. Tumor cells were cultured within a medium (Gibco) that contained 10% FBS. To generate tumors in mice, the indicated number of cancer cells was injected into 100 µL of PBS. Euthanasia of the animals is carried out by exsanguination following the administration of anesthesia with 1.5% pentobarbital sodium via intraperitoneal injection at a dosage of 100–200 mg/kg. After this experiment, mouse euthanasia was completed and tumor volumes were measured. IVIS Lumina II (Perkin-Elmer) was used to verify tumors through ex vivo bioluminescence imaging, while paraffin-embedded sections were stained with hematoxylin/eosin (H&E) for detection. The study was conducted in accordance with the Committee for the Ethical Review of Research, China Medical University. We have complied with all relevant ethical regulations for animal use.
Statistics and reproducibility
SPSS 22.0 and GraphPad Prism 9.3 software were used for statistical analysis and drawing. All experiments were performed independently three times. Mann–Whitney U test or t-test was adopted for comparing measurement data of the two groups based on whether the data conformed to the normal distribution. Analysis of variance, or the Kruskal–Wallis test, was adopted to compare and analyze measurement data among multiple groups, depending on whether the variance of the data was homogeneous. In cases where a statistically significant difference existed across different groups, pairwise comparison was carried out by least-significant difference (LSD). Chi-square test or Fisher’s exact probability test was employed for comparing count data. *P < 0.05 stood for statistical significance.
Supplementary information
Description of Additional Supplementary Materials
Acknowledgements
This work was supported by the National Natural Science Foundation of China (No. 82073286) and China Postal Science Foundation (Nos. 2018M641743, 2019M661168).
Author contributions
B.W. and X.N.-Z. offered direction and guidance on the manuscript. B.W. and X.N.-Z. drafted the initial manuscript. B.W. and X.N.-Z. revised the manuscript. B.W. and M.X.-J. illustrated the figures for the manuscript. This manuscript has been read and approved by all authors.
Peer review
Peer review information
Communications Biology thanks the anonymous reviewers for their contribution to the peer review of this work. Primary Handling Editors: Yuting Ma, Zhijuan Qiu, and Dario Ummarino. A peer review file is available.
Data availability
The authors affirm that the data supporting the findings of this study are accessible in the paper and its supplementary information files. Source data for the graphs presented in the paper can be located in Supplementary Data 1–3, while the flow cytometry plots are available in Supplementary Data 4. The uncropped blots are shown in Supplementary Data 5.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
These authors contributed equally: Bo Wu, Xiaoni Zhan.
Supplementary information
The online version contains supplementary material available at 10.1038/s42003-024-06712-6.
References
- 1.Nomi, T. et al. Clinical significance and therapeutic potential of the programmed death-1 ligand/programmed death-1 pathway in human pancreatic cancer. Clin. Cancer Res.13, 2151–2157 (2007). [DOI] [PubMed] [Google Scholar]
- 2.Fridman, W. H., Pagès, F., Sautès-Fridman, C. & Galon, J. The immune contexture in human tumours: impact on clinical outcome. Nat. Rev. Cancer12, 298–306 (2012). [DOI] [PubMed] [Google Scholar]
- 3.Angell, H. & Galon, J. From the immune contexture to the Immunoscore: the role of prognostic and predictive.immune markers in cancer. Curr. Opin. Immunol.25, 261–267 (2013). [DOI] [PubMed] [Google Scholar]
- 4.Rizvi, S., Wang, J. & El-Khoueiry, A.B. Liver cancer immunity. Hepatology10.1002/hep.31416 (2020). [DOI] [PMC free article] [PubMed]
- 5.Shapouri-Moghaddam, A. et al. Macrophage plasticity, polarization, and function in health and disease. J. Cell Physiol.233, 6425–6440 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Mantovani, A., Marchesi, F., Malesci, A., Laghi, L. & Allavena, P. Tumour-associated macrophages as treatment targets in oncology. Nat. Rev. Clin. Oncol.14, 399–416 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Demaria, O. et al. Harnessing innate immunity in cancer therapy. Nature574, 45–56 (2019). [DOI] [PubMed] [Google Scholar]
- 8.Zhang, H. et al. Infiltration of diametrically polarized macrophages predicts overall survival of patients with gastric cancer after surgical resection. Gastric Cancer18, 740–750 (2015). [DOI] [PubMed] [Google Scholar]
- 9.Chen, J. et al. Macrophages induce CD47 upregulation via IL-6 and correlate with poor survival in hepatocellular carcinoma patients. Oncoimmunology8, e1652540 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Moller, P., Koretz, K., Schlag, P. & Momburg, F. Frequency of abnormal expression of HLA-A,B,C and HLA-DR molecules, invariant chain, and LFA-3 (CD58) in colorectal carcinoma and its impact on tumor recurrence. Int. J. Cancer Suppl.6, 155–162 (1991). [DOI] [PubMed] [Google Scholar]
- 11.Krensky, A. M. et al. The functional significance, distribution, and structure of LFA-1, LFA-2, and LFA-3: cell surface antigens associated with CTL-target interactions. J. Immunol.131, 611–616 (1983). [PubMed] [Google Scholar]
- 12.Krensky, A. M., Robbins, E., Springer, T. A. & Burakoff, S. J. LFA-1, LFA-2, and LFA-3 antigens are involved in CTL-target conjugation. J. Immunol.132, 2180–2182 (1984). [PubMed] [Google Scholar]
- 13.Moingeon, P. et al. CD2-mediated adhesion facilitates T lymphocyte antigen recognition function. Nature339, 312–314 (1989). [DOI] [PubMed] [Google Scholar]
- 14.Koyasu, S. et al. Role of interaction of CD2 molecules with lymphocyte function-associated antigen 3 in T-cell recognition of nominal antigen. Proc. Natl Acad. Sci. USA87, 2603–2607 (1990). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Hutchins, D. & Steel, C. M. Regulation of ICAM-1 (Cd54) expression in human breast cancer cell lines by interleukin 6 and fibroblast-derived factors. Int. J. Cancer58, 80–84 (1994). [DOI] [PubMed] [Google Scholar]
- 16.Kvale, D., Krajci, P. & Brandtzaeg, P. Expression and regulation of adhesion molecules ICAM-1 (CD54) and LFA-3 (CD58) in human intestinal epithelial cell lines. Scand. J. Immunol.35, 669–676 (1992). [DOI] [PubMed] [Google Scholar]
- 17.Kvale, D. & Brandtzaeg, P. Immune modulation of adhesion molecules ICAM-1 (CD54) and LFA-3 (CD58) in human hepatocytic cell lines. J. Hepatol.17, 347–352 (1993). [DOI] [PubMed] [Google Scholar]
- 18.Xu, S. et al. CD58, a novel surface marker, promotes self-renewal of tumor-initiating cells in colorectal cancer. Oncogene34, 1520–1531 (2015). [DOI] [PubMed] [Google Scholar]
- 19.Zhu, Y. et al. Disruption of tumour-associated macrophage trafficking by the osteopontininduced colony-stimulating factor-1 signalling sensitises hepatocellular carcinoma to anti-PD-L1 blockade. Gut68, 1653–1666 (2019). [DOI] [PubMed] [Google Scholar]
- 20.Park, J. I. et al. Transforming growth factor-beta1 activates interleukin-6 expression in prostate cancer cells through the synergistic collaboration of the Smad2, p38-NF-kappaB, JNK, and Ras signaling pathways. Oncogene22, 4314–4332 (2003). [DOI] [PubMed] [Google Scholar]
- 21.Lin, L. et al. STAT3 is necessary for proliferation and survival in colon cancer-initiating cells. Cancer Res.71, 7226–7237 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Frangieh, C. J. et al. Multimodal pooled Perturb-CITE-seq screens in patient models define mechanisms of cancer immune evasion. Nat. Genet.53, 332–341 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Shen, Y. et al. Cancer cell-intrinsic resistance to BiTE therapy is mediated by loss of CD58 costimulation and modulation of the extrinsic apoptotic pathway. J. Immunother. Cancer10, e004348 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Zhao, Y., Wu, J., Dong, Q., Mao, J. & Zhu, Y. CD58, a novel surface marker, promotes self-renewal of tumor-initiating cells in colorectal cancer. Oncogene34, 1520–1531 (2015). [DOI] [PubMed] [Google Scholar]
- 25.Kong, Y. et al. CD34(+)CD38(−)CD58(−) cells are leukemia-propagating cells in Philadelphia chromosome-positive acute lymphoblastic leukemia. Leukemia28, 2398–2401 (2014). [DOI] [PubMed] [Google Scholar]
- 26.Begley, L. A. et al. CXCL5 promotes prostate cancer progression. Neoplasia10, 244–254 (2008). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Zhao, J. et al. Tumor-derived CXCL5 promotes human colorectal cancer metastasis through activation of the ERK/Elk-1/Snail and AKT/GSK3β/β-catenin pathways. Mol. Cancer16, 70 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Lemmon, M. A. & Schlessinger, J. Cell signaling by receptor tyrosine kinases. Cell141, 1117–1134 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Nakamura, K. & Smyth, M. J. Myeloid immunosuppression and immune checkpoints in the tumor microenvironment. Cell. Mol. Immunol.17, 1–12 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Petty, A. J. et al. Hedgehog signaling promotes tumor-associated macrophage polarization to suppress intratumoral CD8+ T cell recruitment. J. Clin. Investig.129, 5151–5162 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Mia, S., Warnecke, A., Zhang, X. M., Malmström, V. & Harris, R. A. An optimized protocol for human M2 macrophages using M-CSF and IL-4/IL-10/TGF-β yields a dominant immunosuppressive phenotype. Scand. J. Immunol.79, 305–314 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Zhang, W. et al. IL-6 promotes PD-L1 expression in monocytes and macrophages by decreasing protein tyrosine phosphatase receptor type O expression in human hepatocellular carcinoma. J. Immunother. Cancer8, e000285 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Zhao, J., O’Neil, M., Vittal, A., Weinman, S. A. & Tikhanovich, I. PRMT1-dependent macrophage IL-6 production is required for alcohol-induced HCC progression. Gene Expr.19, 137–150 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Hailemichael, Y. et al. Interleukin-6 blockade abrogates immunotherapy toxicity and promotes tumor immunity. Cancer Cell40, 509–523 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Choy, E. H. et al. Translating IL-6 biology into effective treatments. Nat. Rev. Rheumatol.16, 335–345 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Li, H. et al. IL-6-induced cGGNBP2 encodes a protein to promote cell growth and metastasis in intrahepatic cholangiocarcinoma. Hepatology75, 1402–1419 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Hu, F. et al. IL-6 regulates autophagy and chemotherapy resistance by promoting BECN1 phosphorylation. Nat. Commun.12, 3651 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Ortiz-Montero, P., Londoño-Vallejo, A. & Vernot, J. P. Senescence-associated IL-6 and IL-8 cytokines induce a self-and cross-reinforced senescence/inflammatory milieu strengthening tumorigenic capabilities in the MCF-7 breast cancer cell line. Cell Commun. Signal.15, 17 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Wan, S. et al. Tumor-associated macrophages produce interleukin 6 and signal via STAT3 to promote expansion of human hepatocellular carcinoma stem cells. Gastroenterology147, 1393–1404 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Hsu, H. S. & Hung, S. C. IL-6 enriched lung cancer stem-like cell population by inhibition of cell cycle regulators via DNMT1 upregulation. Int. J. Cancer136, 547–559 (2015). [DOI] [PubMed] [Google Scholar]
- 41.Pan, Y., Yu, Y., Wang, X. & Zhang, T. Tumor-associated macrophages in tumor immunity. Front. Immunol.11, 583084 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Pathria, P., Louis, T. L. & Varner, J. A. Targeting tumor-associated macrophages in cancer. Trends Immunol.40, 310–327 (2019). [DOI] [PubMed] [Google Scholar]
- 43.Petty, A. J. & Yang, Y. Tumor-associated macrophages: implications in cancer immunotherapy. Immunotherapy9, 289–302 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Gordon, S. R. et al. PD-1 expression by tumour-associated macrophages inhibits phagocytosis and tumour immunity. Nature545, 495–499 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Huang, Y. K. et al. Macrophage spatial heterogeneity in gastric cancer defined by multiplex immunohistochemistry. Nat. Commun.10, 3928 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Jin, X. et al. Phosphorylated RB promotes cancer immunity by inhibiting NF-kappaB activation and PD-L1 expression. Mol. Cell73, 22–35.e26 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Lim, S. O. et al. Deubiquitination and stabilization of PD-L1 by CSN5. Cancer Cell30, 925–939 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Atsaves, V. et al. PD-L1 is commonly expressed and transcriptionally regulated by STAT3 and MYC in ALKnegative anaplastic large-cell lymphoma. Leukemia31, 1633–1637 (2017). [DOI] [PubMed] [Google Scholar]
- 49.Chen, J. et al. Upregulation of B7-H1 expression is associated with macrophage infiltration in hepatocellular carcinomas. Cancer Immunol. Immunother.61, 101–108 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Zhou, Y. et al. Induction of pro-inflammatory response via activated macrophage-mediated NF-kappaB and STAT3 pathways in gastric cancer cells. Cell Physiol. Biochem.47, 1399–1410 (2018). [DOI] [PubMed] [Google Scholar]
- 51.Tomczak, K., Czerwińska, P. & Wiznerowicz, M. The Cancer Genome Atlas (TCGA): an immeasurable source of knowledge. Contemp. Oncol. (Pozn.).19, A68–77 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Li, T. et al. TIMER: a web server for comprehensive analysis of tumor-infiltrating immune cells. Cancer Res.77, e108–e110 (2017). [DOI] [PMC free article] [PubMed]
- 53.Slyper, M. et al. A single-cell and single-nucleus RNA-Seq toolbox for fresh and frozen human tumors. Nat. Med.26, 792–802 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Description of Additional Supplementary Materials
Data Availability Statement
The authors affirm that the data supporting the findings of this study are accessible in the paper and its supplementary information files. Source data for the graphs presented in the paper can be located in Supplementary Data 1–3, while the flow cytometry plots are available in Supplementary Data 4. The uncropped blots are shown in Supplementary Data 5.







