Skip to main content
Cellular and Molecular Neurobiology logoLink to Cellular and Molecular Neurobiology
. 2015 Mar 14;35(6):785–795. doi: 10.1007/s10571-015-0172-z

The Internalization of Neurotensin by the Low-Affinity Neurotensin Receptors (NTSR2 and vNTSR2) Activates ERK 1/2 in Glioma Cells and Allows Neurotensin-Polyplex Transfection of tGAS1

Alberto E Ayala-Sarmiento 1, Daniel Martinez-Fong 1,2, José Segovia 1,
PMCID: PMC11486267  PMID: 25772140

Abstract

Glioblastoma is the most malignant primary brain tumor and is very resistant to treatment; hence, it has a poor prognosis. Neurotensin receptor type 1 (NTSR1) plays a key role in cancer malignancy and has potential therapeutic applications. However, the presence and function of neurotensin (NTS) receptors in glioblastoma is not clearly established. RT-PCR assays showed that healthy (non-tumor) astroglial cells and C6 glioma cells express NTSR2 and its isoform (vNTSR2) rather than NTSR1. In glioma cells, NTS promotes the phosphorylation of extracellular signal-regulated kinases 1/2 (ERK 1/2), an effect that was completely abolished by blocking the internalization of the NTS/NTSR complex. We demonstrated pharmacologically that the internalization is dependent on the activation of NTSR2 receptors and it was prevented by levocabastine, a NTSR2 receptor antagonist. The internalization of NTSR2 and vNTSR2 was further demonstrated by its ability to mediate gene transfer (transfection) via the NTS-polyplex system. Expression of reporter transgenes and of the pro-apoptotic soluble form of growth arrest specific 1 (tGAS1) was observed in glioma cells. A significant reduction on the viability of C6 cells was determined when tGAS1 was transfected into glioma cells. Conversely, astroglial cells could neither internalize NTS nor activate ERK 1/2 and could not be transfected by the NTS-polyplex. These results demonstrate that the internalization process of NTSR2 receptors is a key regulator necessary to trigger the activation of the ERK 1/2. Our data support a new internalization pathway in glioma C6 cells that involve NTSR2/vNTSR2, which can be used to selectively transfer therapeutic genes using the NTS-polyplex system.

Electronic supplementary material

The online version of this article (doi:10.1007/s10571-015-0172-z) contains supplementary material, which is available to authorized users.

Keywords: Neurotensin receptor-2, Glioma, Glia, ERK 1/2, GAS1, Polyplex

Introduction

Gliomas are the most common primary tumors of the central nervous system (CNS), and among them, glioblastoma stands out as the most malignant type; this tumor is resistant to current treatments, hence its poor prognosis (Kesari 2011). The identification of biomarkers and new pharmacological targets for glioblastoma remain important goals in order to develop novel diagnostic and therapeutic approaches. Some reports implicate neurotensin (NTS) in both the proliferation and migration of glioma cells (Camby et al. 1996; Reubi et al. 1999; Servotte et al. 2006), suggesting its participation in glioma malignancy as occurs in breast cancer and small-cell lung cancer (Alifano et al. 2010; Dupouy et al. 2009). In contrast with the latter diseases, the type of NTS receptor (NTSR1, NTSR2, and NTSR3) that mediates the action of NTS in glioblastoma has not been identified yet.

Of the NTS receptors, NTSR1 is the most studied in cancer because its abnormal expression and function further increase cancer malignancy (Dupouy et al. 2011; Wu et al. 2012). Transcriptional deregulation of the Wnt/β-catenin pathway enhances or triggers NTSR1 expression in a variety of cancer cells (Schade et al. 2013; Shy et al. 2013; Souaze et al. 2006a, b). Current studies indicate that NTS and NTSR1 play a major role in cancer progression, malignancy, and metastasis caused by the development of an autocrine loop (Dupouy et al. 2009; Somai et al. 2002; Wu et al. 2012). Because of this, NTSR1 has become a target of pharmacological treatments and gene therapy approaches (Wu et al. 2012). NTSR1 displays unique structural and functional features that allow it to be employed to treat different cancers (Wu et al. 2012). For example, the internalization of NTSR1, which is overactive in cancer cells, has become an efficient pathway to introduce therapeutic genes delivered by the NTS-polyplex nanoparticles, as previously demonstrated in murine neuroblastoma and human breast cancer models (Castillo-Rodriguez et al. 2014; Rubio-Zapata et al. 2009).

In contrast, the expression of NTSR2 in cancer has been scarcely reported, and there is an antecedent in prostatic cancer (Swift et al. 2010) and another in B cells from chronic lymphocytic leukemia (CLL) (Saada et al. 2012). Nonetheless, there is little information about the function and impact of NTSR2 on cancer biology. NTSR1 and NTSR2 are seven transmembrane (TM) domains-G protein-coupled receptors (GPCR), whereas the NTSR3, also called sortilin, is a multiligand and a single TM domain-type receptor that is not coupled to G proteins (Mazella et al. 1998; Vincent et al. 1999).

Several studies have shown that the stimulation of NTSRs with NTS activates the extracellular signal-regulated kinases 1/2 (ERK 1/2) (Martin et al. 2003; Navarro et al. 2006; Sarret et al. 2002), and there is a growing body of evidence indicating that the process of GPCR’s internalization plays critical roles in this signaling pathway (Ahn et al. 2004; Gendron et al. 2004; Roskoski 2012). Of the NTS receptors, NTSR1 is internalized when expressed endogenously in both normal and cancerous cells (Alvarez-Maya et al. 2001; Navarro-Quiroga et al. 2002; Navarro et al. 2006). In contrast, the internalization of NTSR2 has been described mostly in heterologous transfection systems (Gendron et al. 2004; Perron et al. 2005). There are reports indicating that NTSR2 is not internalized when it is endogenously expressed in glial cells (Nouel et al. 1997, 1999), although one report described that when NTSR2 is endogenously co-expressed with a variant form (vNTSR2) in cerebellar granular cells, they are internalized (Sarret et al. 2002). The present study aimed at characterizing the NTS GPCRs expressed in the murine glioblastoma C6 cell line and to determine the involvement of the internalization process in the signaling properties of these receptors. In addition, the internalization of the receptors was functionally demonstrated by their capacity to transfer reporter and therapeutic genes to these cells using the NTS-polyplex system. In the present work, we demonstrate the expression of NTSR2 and vNTSR2 in gliomas rather that of NTSR1, as well as in healthy astroglial cells. Moreover, the internalization of NTS, as well as the activation of ERK 1/2, takes place exclusively in glioma cells, but not in astroglia, although both cell types express the two isoforms of NTSR2. Consistent with this finding, only glioma cells permit the NTS-polyplex mediated transfection of a vector expressing tGAS1, inducing a reduction in the number of viable tumor cells.

Materials and Methods

Plasmids

The following plasmids were employed: pEGFP-N1 (4.7 kbp) that codes for an enhanced green fluorescent protein (EGFP; Clontech; Mountain View, CA, USA). pLenti6.3/V5-GW/lacZ which codes for β-galactosidase under the control of the CMV promoter (10.8 kbp) (Invitrogen, Carlsbad, CA, USA) and the pLenti6.3/TO/V5-tGAS1 (8.7 kbp) that codes for tGAS1 under the control of the CMV promoter, previously obtained (Jimenez et al. 2014).

Cell Lines and Primary Cultures

The C6 cell line from rat glioma and CHO/K1 cells from hamster ovary were cultured with Dulbecco’s Modified Eagle’s Medium (DMEM) F-12 K; mouse neuroblastoma N1E-115 cells were cultured in DMEM high glucose without sodium pyruvate. Cell culture media were supplemented with 10 % fetal bovine serum and 1 % antibiotic/antimycotic. All the media and supplements were obtained from Gibco (Grand Island, NY, USA). Cell cultures were maintained at 37 °C, in an atmosphere of 95 % air and 5 % CO2, with 100 % relative humidity.

Animal Experiments

All animal procedures were performed according to current Mexican legislation NOM-062-ZOO-1999 (SAGARPA) and in agreement with the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health (NIH) and internal (CINVESTAV) guidelines. Briefly, rats were euthanized by CO2 inhalation before decapitation, and the brains were rapidly removed on a cold glass plate under microscopic guidance. Cerebella were dissected on a cold glass plate to obtain tissue for RT-PCR. Primary enriched-astroglial cell cultures from the cerebral cortex of 2-day old rats were prepared as previously described (Diaz-Coranguez et al. 2013). After removing the meninges, cerebral cortices were dissected out and placed into 4 mL of DMEM high glucose, cut into small pieces, and digested with 1.25 mg/mL trypsin (Invitrogen; Carlsbad, CA, USA) for 10 min. Then, the medium was replaced by fresh one, and cells were gently disaggregated with a 5 mL micropipette tip. The cell suspension was gently forced through a 40 µm nylon cell strainer (BD Biosciences; Franklyn Lakes, NJ, USA), and then seeded into Petri dishes coated with 10 mg/mL poly-l-lysine hydrobromide (Sigma-Aldrich; St Louis, MO, USA). Cells were cultured in supplemented DMEM under the same conditions of the cell lines.

Reverse Transcription-Polymerase Chain Reaction Analysis

Total RNA was isolated using the Trizol reagent (Invitrogen). Briefly, 5 μg of total RNA was treated with DNAseI (Biolabs; Ipswich, MA, USA) and then reverse transcribed with SuperScriptII reverse transcriptase (Invitrogen; Carlsbad, CA, USA) using a specific NTSR1 primer (5′GCTGACGTAGAAGAG3′) (Souaze et al. 2006a) or 50 pmol of oligo(dT), and 2 µL of cDNA amplified by PCR. Five pairs of sense and antisense primers were used. The first pair (5′CTGCTGGCCATGCCCGTG3′ and 5′GGCAGCCAGCAGACCACAAA3′) allowed the amplification of a fragment of NTSR1 cDNA with a predicted size of 620 bp. The second pair (5´GAGCTGTGCGCCTACGCCAC3′ and 5´GGCATGGTACGGCAGCCA3′) allowed the amplification of two fragments of NTSR2 cDNA with predicted sizes of 600 bp for NTSR2 and 418 bp for the splice variant form of this receptor. The third pair (5′CAGCTCCTGGAGTCTGTGCT3′ and 5′GAGTATGTAGGGTCTTCTGGGTT3′) allowed amplification of NTS cDNA with a predicted size of 438 bp (Younes et al. 2014). The fourth pair (5´ACGCAGGCCTCGAGCAGCTTG3′ and 5′CTGTGCCTGCTGCTGGCGATGC3′) allowed amplification of a fragment of growth arrest specific 1 (GAS1) cDNA with a predicted size of 604 bp (Jimenez et al. 2014). The fifth pair to amplify actin fragment (377 pb) was previously described (Lopez-Ornelas et al. 2011).

Formation of the NTS-Polyplex Nanoparticles

The detailed procedures for the synthesis of the NTS-carrier and the formation of the NTS-polyplex nanoparticles have been described elsewhere (Arango-Rodriguez et al. 2006; Martinez-Fong and Navarro-Quiroga 2000). Briefly, the NTS-polyplex nanoparticles resulted from the compaction of plasmid DNA (pDNA) via the electrostatic binding of the Vp1 SV40 karyophilic peptide (KP; SynPep Corp., Dublin, CA, USA) and the NTS-carrier, which is a conjugate of poly-l-lysine, NTS (Sigma Co., Saint Louis, MO, USA) and the hemagglutinin-derived HA2 fusogenic peptide (FP; SynPep Corp., Dublin, CA) (Arango-Rodriguez et al. 2006; Navarro-Quiroga et al. 2002). We used the criterion of retardation and retention microassays (Navarro-Quiroga et al. 2002) to determine the optimal molar ratio between plasmid and the NTS-carrier that were 6 nM pEGFP-N1: 6 µM KP: 162 nM NTS-carrier, 6 nM pLenti6.3/TO/V5-tGAS1: 6 µM KP: 234 nM NTS-carrier, and 6 nM pLenti6.3/V5-GW/lacZ: 6 µM KP: 234 nM NTS-carrier.

Gene Delivery Using NTS-Polyplex Nanoparticles

Internalization and transfection experiments were performed in cells at 70–80 % of confluence that were seeded on 12 mm polylysine-treated glass coverslips in 24-well plates. Propidium iodide (PI)-labeled NTS-polyplex nanoparticles harboring the plasmid pEGFP-N1 were used for the internalizations and pharmacological blocking assays following the procedure that was previously described (Alvarez-Maya et al. 2001; Navarro-Quiroga et al. 2002). For internalization assays, glioma C6 cells and primary enriched-astroglial cell cultures were incubated for 15 min with the labeled NTS-polyplex nanoparticles. To determine whether the labeled NTS-polyplex internalization proceeds via NTSR2 receptors, a pharmacological blocking assay was carried out using 10 µM of levocabastine (Sigma-Aldrich; St Louis, MO, USA), a NTSR2 non-peptide antagonist, 30 min before and during the 15 min incubation with the PI-labeled NTS-polyplex nanoparticles. At the end of the incubation, cells were washed thrice with phosphate-buffered saline (PBS) and processed for immunofluorescence labeling.

The expression of GFP in C6 glioma cells and primary enriched-astroglial cell cultures was evaluated 36 h following the exposure to the NTS-polyplex nanoparticles harboring the pEGFP-N1 plasmid. Cells exposed only to pDNA-KP complex (lacking NTS-carrier) were considered as the negative control. Then, cells were processed for immunofluorescence labeling as described below.

GAS1 and β-Galactosidase Expression

GAS1 concentrations were measured in cell culture supernatants using the human GAS1 DuoSet ELISA following the protocol of the manufacturer (R&D Systems). To assess the expression of β-galactosidase, X-gal staining was carried out as previously described (Cortez et al. 2000) in C6 glioma cells transfected with the NTS-polyplex. Positive transfected cells (blue) were counted using light microscopy.

Cell Viability

To determine the effect of the NTS-polyplex-mediated tGAS1 expression on cell viability of C6 cells, a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay was used (Benitez et al. 2007). C6 cells were seeded in 48-well plates at a density of 20,000 cells/wells. Cells were transfected with pLenti6.3/TO/V5-tGAS1 or pLenti6.3/V5-GW/lacZ. Thirty-six hours later, viable cells were assessed by measuring the conversion of the tetrazolium salt MTT into formazan. Absorbance was read at 595 nm using an automated microplate reader (Bio-Rad).

Effect of tGAS1 Conditioned Medium

C6 cells were plated in p60 culture dishes and transfected with pLenti6.3/TO/V5-tGAS1 or pLenti6.3/V5-GW/lacZ using the NTS-polyplex nanoparticles for 36 h. At that time, media from each experimental condition were collected, centrifuged, filtered with 0.22 µm filters (Millipore; Bedford, MA, USA), and added to independent C6 cells and after 36 h in culture, as previously described (Jimenez et al. 2014; Lopez-Ornelas et al. 2011, 2014), viable cells were assessed using the MTT technique.

Immunofluorescence Labeling

C6 glioma cells and primary enriched-astroglial cell cultures were fixed with 4 % paraformaldehyde and washed twice with PBS. C6 glioma cells were not permeabilized; they were stained with Alexa fluor 488 phalloidin (Invitrogen; Carlsbad, CA, USA). Primary enriched-astroglial cell cultures were permeabilized once with 0.05 % Triton X-100 for 5 min, washed twice with PBS, preincubated with PBS containing 10 % normal horse serum (NHS) for 30 min, rinsed again with PBS, and incubated overnight at 4 °C with a rabbit anti-glial fibrillary acidic protein antibody (GFAP; 1:1000; Dako; Carpinteria, CA, USA) in PBS containing 1.5 % NHS. After rinsing three times with PBS, bound primary antibodies were revealed with a donkey anti-rabbit antibody conjugated to Alexa 488 (diluted 1:2000; Invitrogen) for 60 min at room temperature. After rinsing with PBS, both types of cells were counterstained with Hoechst 33258 (Sigma-Aldrich; St Louis, MO, USA). After washing, coverslips were mounted on glass slides using Vectashield and examined with a laser scanning spectral confocal microscope Leica TCS SP8 (Leica Microsystems; Wetzlar, Germany).

Western Blot Analyses of ERK1/2 Activity

Glioma C6 cells and primary enriched-astroglial cell cultures at about 70 % confluence were incubated in serum-free DMEM overnight. Then, cells were stimulated for various time intervals (1–60 min) with NTS (0.1 µM) at 37 °C in serum-free medium. In similar experiments, C6 glioma cells were also incubated with levocabastine (0.1 µM) for different intervals (2–60 min) at 37 °C in serum-free medium. For other experiments, C6 glioma cells were preincubated in the absence or presence of sucrose 0.45 M (Heuser and Anderson 1989), to inhibit endocytosis, for 30 min before stimulation with NTS (10 min) co-incubated with sucrose. The reaction was stopped by aspiration of the medium. Cells were lysed at 4 °C with a lysis buffer containing the complete protease inhibitor (Roche Diagnostic; Indianapolis, IN, USA). Cell extracts were centrifuged at 8000g for 15 min at 4 °C, and supernatants stored at −20 °C until used. Twenty micrograms of total protein were separated on 12 % SDS-PAGE gels and transferred onto nitrocellulose membranes, which were blocked for 1 h at room temperature in 5 % non-fat milk/0.1 % Tween-20 TBS and then incubated for 2 h at room temperature with a mouse anti-phosphorylated ERK1/2 (1:2000; Cell Signaling) or a rabbit anti-ERK1/2 (1:2000; Cell Signaling; Danver, MA, USA) antibodies. Detection was accomplished using horseradish peroxidase-conjugated anti-mouse or anti-rabbit antibodies (1:5000; Jackson ImmunoResearch; West Grove, PA, USA), and the ECL detection system was employed (Roche Diagnostics; Indianapolis, IN, USA). To quantitate the effects of NTS and levocabastine on p42/p44 MAPK (ERK1/2) activation, the ratios of the densitometry values of phosphorylated pp42/pp44 MAPK over total p42/p44 MAPK levels were determined using the LabWorks software (UVP).

Statistical Analysis

We used the GraphPad Prism software (version 5.0). All values are mean ± SEM. The difference between the kinetics of ERK 1/2 activation was analyzed using a two-way repeated measures ANOVA test. For the other experiments, the differences between groups were analyzed with a one-way ANOVA test. When the ANOVA showed a significant difference, a comparison between means was analyzed using a post hoc Bonferroni’s test. P < 0.05 was considered significant.

Results

Expression of NTSR2 and vNTSR2 in Enriched-Astroglia Cultures and C6 Cells

In order to assess the expression of NTS and their putative GPCRs, RT-PCR assays were performed in primary enriched-astroglial cell cultures and in the rat glioma C6 cell line (Fig. 1). NTSR2 primers yielded two bands of 600 and 418 bp in both glioma cells and astroglia. Both bands were the same size as the unspliced (NTSR2) and spliced (vNTSR2) variants of the low-affinity NTS receptor amplified from rat cerebellum (positive control) (Perron et al. 2005; Sarret et al. 2002). No signal was detected in C6 cells or in healthy astroglia using NTSR1 primers; however, a NTSR1 fragment of 620 bp was amplified in N1E-115 cells (positive control) (Castillo-Rodriguez et al. 2014). CHO cells were used as a negative control for both types of NTSR’s (Gendron et al. 2004). Finally, no signal corresponding to NTS (438 bp) was observed neither in C6 cells nor in astroglia, whereas it was detected in HT29 cells (positive control) (Evers et al. 1992). An actin signal band was detected in all cell extracts.

Fig. 1.

Fig. 1

Expression of NTSR2 and vNTSR2 mRNAs in both murine enriched-astroglia cultures and murine glioma C6 cells. Representative gels showing the RT-PCR products for NTSR1 (620 bp), unspliced NTSR2 (600 bp), vNTSR2 (418 bp), or NTS (438 bp). Actin (377 bp) was detected in all cell extracts. N1E-115 cells, cerebellum, and HT29 cells were used as positive controls shown by the headings. CHO cells were used as negative control. MWM molecular weight markers

Internalization of the PI-Labeled NTS-Polyplex in C6 Cells

To visualize NTS internalization via NTSR2 receptors, C6 and astroglial cells were incubated with the PI-labeled NTS-polyplex in the presence or absence of levocabastine. Confocal microscopy analysis showed PI spots within the C6 cells, after 15 min incubation with the PI-labeled NTS-polyplex (Fig. 2a–d). PI-fluorescence was absent in C6 cells that were pre- and co-incubated with levocabastine (10 µM), a NTSR2 non-peptide antagonist (Kitabgi et al. 1987; Schotte et al. 1986) (Fig. 2e–h), confirming that the expression of NTSR2 receptors is mediating the internalization of NTS, as previously shown (Sarret et al. 2002). Similar experiments were carried out in primary cultures of astroglial cells. An enriched-astroglial cell culture was obtained with approximately 96 % GFAP-positive cells (Supplementary Fig. 1). GFAP-positive cells incubated with the PI-labeled NTS-polyplex showed red spot marks only on the periphery of the cell, thus suggesting no internalization into glial cells occurred (Fig. 2i–l). Furthermore, no PI-fluorescence was detected when astroglia cells were pre- and co-incubated with levocabastine (Fig. 2m–p). This confirms the failure of astrocytes to internalize NTS via NTSR2 receptors (Alvarez-Maya et al. 2001; Nouel et al. 1997). In the absence of the NTS-nanocarrier, no PI label was detected in neither C6 nor astroglia (Supplementary Fig. 2a–h), confirming that NTS coupled to the polyplex is necessary to be internalized by the cells. These results indicate that glioma C6 cells are able to internalize NTS via NTSR2 receptors.

Fig. 2.

Fig. 2

Internalization of the NTS-polyplex in glioma C6 cells. Representative micrographs of horizontal confocal sections of C6 cells incubated with the propidium iodide (PI)-labeled NTS-polyplex in the absence (ad) or in the presence of levocabastine (eh); enriched-astroglial primary cell cultures incubated with the propidium iodide (PI)-labeled NTS-polyplex in the absence (il) or in the presence of levocabastine (mp). Cytoskeleton, C6 cells were counterstained with phalloidin, whereas the astroglial cells were immunolabeled against GFAP (glial fibrillary acidic protein). Levo levocabastine. Nuclei were stained with Hoechst 33258. Arrowheads indicate PI fluorescent spots. Scale bar 25 µm

NTSR2- and vNTSR2-Induced Activation of ERK 1/2 in C6 Cells

To determine if endogenously expressed NTSR2 and vNTSR2 were functionally coupled to the ERK 1/2 pathway, C6 and astroglial cells were stimulated with NTS (0.1 µM) for periods ranging from 1 to 60 min. Western blot analysis of phosphorylated ERK 1/2 shows that NTS increased the level of phosphorylation of ERK 1/2 in C6 cells and that ERK 1/2 activity is already robust at 5 min after stimulation, peaks at 10 min, and remains high at 15 min, whereas there was no effect in astroglial cells at the same periods of stimulation (Fig. 3a–c). Moreover, we also observed significant activation of ERK 1/2 from 5 to 15 min after stimulation with levocabastine (0.1 μM), and this is interesting because it shows a similar pattern to that of the NTS-mediated activation in C6 cells (Supplementary Fig. 3a, d). This result demonstrates that the activation of ERK 1/2 in C6 glioma cells is mediated by NTSR2 receptors since levocabastine also activates ERK 1/2 (Gendron et al. 2004; Perron et al. 2005; Sarret et al. 2002). The intriguing result is that NTSR2 receptors in healthy astrocytes are not coupled to this signaling, even though these cells also express both NTSR2 and vNTSR2.

Fig. 3.

Fig. 3

Role of NTSR2 and vNTSR2 receptors in the internalization-dependent activation of ERK 1/2 induced by NTS in glioma C6 cells. Representative western blot of glioma C6 cells (a) and astroglia (b) showing the phosphorylation levels of ERK 1/2 (upper panels) and total ERK 1/2 (lower panels) after stimulation with NTS (0.1 µM) from 1 to 60 min (headings). c Densitometric analysis of ERK 1/2 activation in glioma C6 (dots) and astroglial cells (squares). AU arbitrary units of the ratio between phosphorylated ERK 1/2 and total ERK 1/2. d Representative western blot of glioma C6 cells preincubated for 30 min without or with 0.45 M sucrose (suc) followed by a 10 min incubation with NTS (0.1 µM). Upper panel ERK 1/2 phosphorylation; lower panel total ERK 1/2. e Densitometric analysis of ERK 1/2 activation. Values represent the mean ± SEM of three independent experiments. * P < 0.05; ** P < 0.01; *** P < 0.001 compared with control, astroglial cells (c), or untreated cells (e). Densitometric analyses were analyzed by two-way repeated measures ANOVA (c) or One-way ANOVA (e) and then by post hoc Bonferroni test

Activation of ERK 1/2 Requires Internalization of the NTSR2 and vNTSR2 Receptors

To determine whether ligand-induced internalization of NTSR2/vNTSR2 receptors was necessary to activate ERK 1/2, cells were pretreated in the presence or absence of sucrose (0.45 M) and stimulated for 10 min with NTS (0.1 µM). In the absence of sucrose, NTS triggered the activation of ERK 1/2, but in the presence of hyperosmolar sucrose, the effect of NTS on ERK 1/2 activation was completely inhibited, as measured by western blot analysis (Fig. 3d, e), confirming that the internalization of NTSR2/vNTSR2 is required to activate ERK 1/2.

NTS-Polyplex-Mediated Gene Expression

We then used the NTS-polyplex to determine if this non-viral vector was able to transfect C6 glioma cells. C6 cells were able to express GFP 36 h after incubation with the NTS-polyplex carrying the plasmid pEGFP-N1 (Fig. 4a–c). As expected, no GFP expression was present in astroglial cells (Fig. 4d–f) as they were not able to internalize the PI-labeled NTS-polyplex. This result not only demonstrates the mediation of NTSR2 and vNTSR2 in the transfection of C6 glioma cells, but also indicates the selectivity of the NTS-polyplex to transfer genes to C6 glioma cells and not to astrocytes.

Fig. 4.

Fig. 4

Transfection of glioma C6 cells by the NTS-polyplex. Representative confocal micrographs of C6 cells (ac) and astroglial cells (df) 36 h after exposure to the NTS-polyplex carrying the pEGFP-N1 plasmid. Cytoskeleton C6 cells were counterstained with phalloidin, whereas the astroglial cells were immunolabeled against GFAP (glial fibrillary acidic protein). Scale bar 25 µm

Expression and Effect of tGAS1 Using the NTS-polyplex as a Vector

Taking advantage of the NTS-polyplex glioma-specific transfection, we then decided to transfect a pro-apoptotic agent. A plasmid coding for a soluble form of GAS1, named tGAS1, was transferred to C6 cells via the NTS-polyplex. RT-PCR analysis showed tGAS1 expression (604 bp) in C6 cells transfected with the pLenti6.3/TO/V5-tGAS1 plasmid, but no expression was observed in untransfected C6 cells (Fig. 5a). Using a GAS1-specific enzyme-linked immunosorbent assay (ELISA), secreted tGAS1 protein was detected in the conditioned medium of C6 transfected cells (218 ± 14 pg/mL); no detection of tGAS1 was observed in control-conditioned media (Fig. 5b). In order to assess cell viability, untransfected C6 cells and C6 cells encoding β-galactosidase (transfected with the NTS-polyplex harboring the pLenti6.3/V5-GW/lacZ plasmid) were used as controls. After transfection of tGAS1, MTT assays showed that C6 cells viability decreased 44 ± 3 % when compared with controls (Fig. 5c). When pLenti6.3/V5-GW/lacZ plasmid was transfected a minimal but significant reduction on cell viability was observed, it is possible that the transfection process by itself may induce an insult to the cells as has already described for non-viral vectors (Breunig et al. 2007; Lv et al. 2006) (Fig. 5c). Cell viability also decreased 28 ± 0.6 % (Fig. 5d) in independent cultures of untransfected C6 cells receiving conditioned medium from tGAS1 transfected C6 cells. X-gal staining demonstrated the effective expression of β-galactosidase (~13 %) in C6 cells (Supplementary Fig. 4). These data indicate that it is possible to selectively transfer therapeutic transgenes to glioma cells using the NTS-polyplex.

Fig. 5.

Fig. 5

Effect of tGAS1 expression on the viability of glioma C6 cells. a Representative gels showing the RT-PCR products for tGAS1 (604 bp) and actin (377 bp) 36 h after exposure to the NTS-polyplex carrying the pLenti6.3/TO/V5-tGAS1 plasmid. MWM molecular weight markers, C6 (+) transfected cells, C6 () untransfected cells, pDNA pLenti6.3/TO/V5-tGAS1 plasmid. b Protein levels of tGAS1 assessed by ELISA in conditioned medium. Medium DMEM F-12 K, control conditioned medium from untransfected cells, Lac-Z conditioned medium from Lac-Z transfected cells, tGAS1 conditioned medium from tGAS1 transfected cells. c Cell viability using the MTT colorimetric assay in C6 cells after transfection (36 h) with the plasmid pLenti6.3/TO/V5-tGAS1 or d exposure to conditioned media (36 h) from previously transfected C6 cells. Values represent the mean ± SEM of three independent experiments. * P < 0.05 and *** P < 0.001 compared with control, untreated cells. One-way ANOVA and then by post hoc Bonferroni test

Discussion

This study demonstrates that NTSR2 receptors are associated with the internalization-dependent activation of ERK 1/2 in the C6 rat glioblastoma cell line, a process that does not occur in healthy astrocytes although they express these receptors. Moreover, the internalization of NTSR2 receptors in glioma cells provides us with a novel method to selectively transfer the pro-apoptotic gene tGAS1 using the NTS-polyplex system to tumor cells.

Functional studies with the NTS ligand have suggested that glioma cell lines express NTSRs (Camby et al. 1996; Reubi et al. 1999; Servotte et al. 2006). Our RT-PCR results demonstrated that the rat glioma C6 cell line expresses both NTSR2 and its alternative spliced isoform vNTSR2 (Perron et al. 2005), but not NTSR1. This is a relevant result, because most reports associate the abnormal expression of NTSR1 exclusively to cancer cells. (Dupouy et al. 2011; Wu et al. 2012). Furthermore, only two reports indicate the expression of NTSR2 (Swift et al. 2010) or the upregulation of this receptor (Saada et al. 2012) in cancer cells. On the other hand in the CNS of normal individuals, NTSR2 expression is associated with glial cells (Schotte et al. 1988) and preferentially expressed in astrocytes both in vitro and in vivo (Lepee-Lorgeoux et al. 1999; Nouel et al. 1997; Walker et al. 1998). There is a report indicating that cultured astroglial express only the full-length NTSR2 but not the spliced isoform vNTSR2 (Nouel et al. 1999) instead of the two isoforms as we detected in the astroglial cell culture (Fig. 1). These results suggest that C6 glioma cells are likely to maintain the expression of NTR2 receptors instead of expressing NTSR1 as most cancer cells (Dupouy et al. 2011; Wu et al. 2012).

Additionally, RT-PCR assays showed that glioma C6 cells do not express NTS. Contrary to other types of cancer that develop an autocrine loop because of the overexpression of NTS-NTSR1 (Wu et al. 2012), it is then possible to propose that in brain tumors, the stimulation of NTSR2 and vNTSR2 could be induced by the endogenous high levels of NTS in the CNS (Carraway and Leeman 1973; St-Gelais et al. 2006). Additionally, we could not detect the expression of NTS in astroglial cell cultures, a result consistent with the literature describing that in the CNS, NTS is preferentially expressed in neurons rather than in glia, see review (St-Gelais et al. 2006).

Our studies of internalization and pharmacological blockade (Fig. 2) demonstrate that only C6 glioma cells are able to internalize NTS (PI-labeled NTS-polyplex) and confirm that normal non-tumor astrocytes are not able to internalize NTS (Alvarez-Maya et al. 2001; Nouel et al. 1997, 1999). Independently of whether C6 internalize NTS, whereas astrocytes cannot, the interaction of the neuropeptide with both types of cells is mediated by NTSR2 receptors as neither cell type expresses NTSR1, but express NTSR2 and vNTSR2. Moreover, the interaction of NTS inside C6 cells or at the periphery of the astrocytes are abolished by levocabastine, a specific non-peptide ligand that blocks the binding between NTS and NTSR2 receptors (Kitabgi et al. 1987; Perron et al. 2005; Schotte et al. 1986).

Similar results were obtained from ERK 1/2 activation studies. We demonstrated that the NTS stimulation of C6 cells induced a robust activation of ERK 1/2 with kinetics consistent with that of the internalization of GPCRs (Gendron et al. 2004; Miller and Lefkowitz 2001; Perron et al. 2005; Sarret et al. 2002) (Ahn et al. 2004). Furthermore, levocabastine was also able to activate ERK 1/2 in C6 cells confirming that NTSR2 receptors are the mediators in this signaling pathway. Furthermore, the effect of hyperosmolar sucrose, which blocks receptor endocytosis by disrupting clathrin-coated vesicles (Heuser and Anderson 1989; Navarro-Quiroga et al. 2002; Navarro et al. 2006; Vandenbulcke et al. 2000), demonstrated that the activation of ERK 1/2 in C6 cells depends on the internalization of NTS via NTSR2 and vNTSR2 and not through activation of their G-coupled proteins (DeWire et al. 2007). In contrast, no activation of ERK 1/2 was observed when the same stimulation protocol was performed in enriched-astroglial cell cultures, which were unable of internalizing NTS. All these data together demonstrate that in glioma C6 cells, NTSR2 and vNTSR2 are coupled to the internalization-dependent activation of ERK 1/2, which might favor cancer progression (Roskoski 2012; Sobolesky and Moussa 2013). The mechanism responsible of the lack of internalization and ERK 1/2 activation in healthy astrocytes that express both receptors remains to be elucidated. It is possible that scaffold proteins such as β-arrestins participate in the internalization/activation process, since overexpression, phosphorylation, or ubiquitination of β-arrestins can affect the internalization of GPCRs and further ERK 1/2 signaling (DeWire et al. 2007; Roskoski 2012) and are sometimes associated with cancer cell phenotypes (Sobolesky and Moussa 2013). Another potential mechanism could be related to the expression levels of the receptors isoforms, as is the case of bladder cancer cells that express high levels of the thromboxane (TP)-β receptor isoform but basal levels of (TP)-α receptor isoform unlike normal bladder epithelium that express basal levels of both isoforms, thus correlating the upregulation of TP-β with increased activation of ERK 1/2 and poorer prognosis (Moussa et al. 2008). TP-β and TP-α are also GPCRs that arise from alternative splicing (Miggin and Kinsella 1998; Raychowdhury et al. 1994) and TP-β, but not TP-α, engage β-arrestin2 to undergo agonist-dependent internalization (Parent et al. 1999). It would be interesting to compare whether there are differences in the expression levels of NTSR2 and vNTSR2 or modification in β-arrestins between C6 cells and astrocytes, and also in granule cerebellar cells since these cells also express both NTSR2 and vNTSR2 which are capable to internalize and activate ERK 1/2 (Sarret et al. 2002), to understand the different effects of the internalization of the NTSR2 isoforms, and the intracellular consequences of this process.

The functional internalization of NTSR2 and vNTSR2 in C6 cells was further demonstrated by the NTS-polyplex-mediated expression of transgenes. Interestingly, this non-viral vector transfects NTSR1-expressing cells (Arango-Rodriguez et al. 2006; Gonzalez-Barrios et al. 2006; Martinez-Fong and Navarro-Quiroga 2000; Navarro-Quiroga et al. 2002), but not cells that express NTSR2 as astrocytes (Alvarez-Maya et al. 2001). The expressions of GFP, lacZ, and tGAS1 in C6 cells show that cells that express and internalize the two variants of NTSR2 are a new target for nanotherapy using the NTS-polyplex.

GAS1 is a molecule that induces cell arrest and apoptosis in different tumor cells (Evdokiou and Cowled 1998; Gobeil et al. 2008) including glioma cell lines (Benitez et al. 2007; Zamorano et al. 2004) and human primary gliomas (Dominguez-Monzon et al. 2009). GAS1 induces apoptosis by inhibiting the RET pathway and inducing the activation of caspases 9 and 3 (Zarco et al. 2012). We previously developed a new gene therapy strategy based on a truncated and secretable form of GAS1 (tGAS1) that causes cell death in gene therapy models of breast cancer and glioma (Jimenez et al. 2014; Lopez-Ornelas et al. 2011, 2014). The ELISA quantification and conditioned medium experiments in C6 cells that were previously transfected with the tGAS1 construct by the NTS-polyplex confirm the extracellular presence of tGAS1 and its deleterious effect on glioma cells. The use of soluble pro-apoptotic molecules is a strategy to obtain a widespread distribution of the therapeutic agent after its secretion from producing cells (Jeong et al. 2009). The advantage of the NTS-polyplex to deliver tGAS1 for a potential glioma treatment is that normal astroglial cells will not be transfected, thus selectively targeting tumor cells. Moreover, the use of the promoter for glial fibrillary acidic protein (Zamorano et al. 2003, 2004) will increase safety and target specificity by impeding the expression of tGAS1 in neurons that possess and internalize NTSR1 or NTSR2 and vNTSR2, after the NTS-polyplex transfection.

Conclusion

To conclude, these results show the presence of functional NTSR2 and vNTSR2 in glioma C6 cells that can be useful to develop a tGAS1-based gene therapy with the NTS-polyplex without affecting resident glia cells.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Acknowledgments

This work was supported by Instituto de Ciencia y Tecnología del Gobierno del Distrito Federal (ICyTDF) Grant #ICYTDF/228/2010, ARN-CONACYT Grant #142947 (DMF), and Conacyt Grant #127357 (JS). AEAS was a recipient of CONACYT fellowship #244983.

Conflict of interest

The authors declare that they have no conflict of interest.

References

  1. Ahn S, Shenoy SK, Wei H, Lefkowitz RJ (2004) Differential kinetic and spatial patterns of beta-arrestin and G protein-mediated ERK activation by the angiotensin II receptor. J Biol Chem 279:35518–35525 [DOI] [PubMed] [Google Scholar]
  2. Alifano M et al (2010) Neurotensin receptor 1 determines the outcome of non-small cell lung cancer. Clin Cancer Res 16:4401–4410 [DOI] [PubMed] [Google Scholar]
  3. Alvarez-Maya I, Navarro-Quiroga I, Meraz-Rios MA, Aceves J, Martinez-Fong D (2001) In vivo gene transfer to dopamine neurons of rat substantia nigra via the high-affinity neurotensin receptor. Mol Med 7:186–192 [PMC free article] [PubMed] [Google Scholar]
  4. Arango-Rodriguez ML et al (2006) Biophysical characteristics of neurotensin polyplex for in vitro and in vivo gene transfection. Biochim Biophys Acta 1760:1009–1020 [DOI] [PubMed] [Google Scholar]
  5. Benitez JA, Arregui L, Vergara P, Segovia J (2007) Targeted-simultaneous expression of Gas1 and p53 using a bicistronic adenoviral vector in gliomas. Cancer Gene Ther 14:836–846 [DOI] [PubMed] [Google Scholar]
  6. Breunig M, Lungwitz U, Liebl R, Goepferich A (2007) Breaking up the correlation between efficacy and toxicity for nonviral gene delivery. Proc Natl Acad Sci USA 104:14454–14459 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Camby I et al (1996) Neurotensin-mediated effects on astrocytic tumor cell proliferation. Neuropeptides 30:133–139 [DOI] [PubMed] [Google Scholar]
  8. Carraway R, Leeman SE (1973) The isolation of a new hypotensive peptide, neurotensin, from bovine hypothalami. J Biol Chem 248:6854–6861 [PubMed] [Google Scholar]
  9. Castillo-Rodriguez RA, Arango-Rodriguez ML, Escobedo L, Hernandez-Baltazar D, Gompel A, Forgez P, Martinez-Fong D (2014) Suicide HSVtk gene delivery by neurotensin-polyplex nanoparticles via the bloodstream and GCV treatment specifically inhibit the growth of human MDA-MB-231 triple negative breast cancer tumors xenografted in athymic mice. PLoS One 9:e97151 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Cortez N, Trejo F, Vergara P, Segovia J (2000) Primary astrocytes retrovirally transduced with a tyrosine hydroxylase transgene driven by a glial-specific promoter elicit behavioral recovery in experimental parkinsonism. J Neurosci Res 59:39–46 [PubMed] [Google Scholar]
  11. DeWire SM, Ahn S, Lefkowitz RJ, Shenoy SK (2007) Beta-arrestins and cell signaling. Annu Rev Physiol 69:483–510 [DOI] [PubMed] [Google Scholar]
  12. Diaz-Coranguez M et al (2013) Transmigration of neural stem cells across the blood brain barrier induced by glioma cells. PLoS One 8:e60655 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Dominguez-Monzon G, Benitez JA, Vergara P, Lorenzana R, Segovia J (2009) Gas1 inhibits cell proliferation and induces apoptosis of human primary gliomas in the absence of Shh. Int J Dev Neurosci 27:305–313 The official journal of the International Society for Developmental Neuroscience [DOI] [PubMed] [Google Scholar]
  14. Dupouy S et al (2009) The neurotensin receptor-1 pathway contributes to human ductal breast cancer progression. PLoS One 4:e4223 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Dupouy S, Mourra N, Doan VK, Gompel A, Alifano M, Forgez P (2011) The potential use of the neurotensin high affinity receptor 1 as a biomarker for cancer progression and as a component of personalized medicine in selective cancers. Biochimie 93:1369–1378 [DOI] [PubMed] [Google Scholar]
  16. Evdokiou A, Cowled PA (1998) Tumor-suppressive activity of the growth arrest-specific gene GAS1 in human tumor cell lines. Int J Cancer 75:568–577 [DOI] [PubMed] [Google Scholar]
  17. Evers BM, Ishizuka J, Chung DH, Townsend CM Jr, Thompson JC (1992) Neurotensin expression and release in human colon cancers. Ann Surg 216:423–430 Discussion 430–421 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Gendron L, Perron A, Payet MD, Gallo-Payet N, Sarret P, Beaudet A (2004) Low-affinity neurotensin receptor (NTS2) signaling: internalization-dependent activation of extracellular signal-regulated kinases 1/2. Mol Pharmacol 66:1421–1430 [DOI] [PubMed] [Google Scholar]
  19. Gobeil S, Zhu X, Doillon CJ, Green MR (2008) A genome-wide shRNA screen identifies GAS1 as a novel melanoma metastasis suppressor gene. Genes Dev 22:2932–2940 [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Gonzalez-Barrios JA et al (2006) Neurotensin polyplex as an efficient carrier for delivering the human GDNF gene into nigral dopamine neurons of hemiparkinsonian rats. Mol Ther 14:857–865 [DOI] [PubMed] [Google Scholar]
  21. Heuser JE, Anderson RG (1989) Hypertonic media inhibit receptor-mediated endocytosis by blocking clathrin-coated pit formation. J Cell Biol 108:389–400 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Jeong M et al (2009) Possible novel therapy for malignant gliomas with secretable trimeric TRAIL. PLoS One 4:e4545 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Jimenez A, Lopez-Ornelas A, Estudillo E, Gonzalez-Mariscal L, Gonzalez RO, Segovia J (2014) A soluble form of GAS1 inhibits tumor growth and angiogenesis in a triple negative breast cancer model. Exp Cell Res 327:307–317 [DOI] [PubMed] [Google Scholar]
  24. Kesari S (2011) Understanding glioblastoma tumor biology: the potential to improve current diagnosis and treatments. Semin Oncol 38(Suppl 4):S2–S10 [DOI] [PubMed] [Google Scholar]
  25. Kitabgi P, Rostene W, Dussaillant M, Schotte A, Laduron PM, Vincent JP (1987) Two populations of neurotensin binding sites in murine brain: discrimination by the antihistamine levocabastine reveals markedly different radioautographic distribution. Eur J Pharmacol 140:285–293 [DOI] [PubMed] [Google Scholar]
  26. Lepee-Lorgeoux I, Betancur C, Rostene W, Pelaprat D (1999) Differential ontogenetic patterns of levocabastine-sensitive neurotensin NT2 receptors and of NT1 receptors in the rat brain revealed by in situ hybridization. Brain Res Dev Brain Res 113:115–131 [DOI] [PubMed] [Google Scholar]
  27. Lopez-Ornelas A, Mejia-Castillo T, Vergara P, Segovia J (2011) Lentiviral transfer of an inducible transgene expressing a soluble form of Gas1 causes glioma cell arrest, apoptosis and inhibits tumor growth. Cancer Gene Ther 18:87–99 [DOI] [PubMed] [Google Scholar]
  28. Lopez-Ornelas A, Vergara P, Segovia J (2014) Neural stem cells producing an inducible and soluble form of Gas1 target and inhibit intracranial glioma growth. Cytotherapy 16:1011–1023 [DOI] [PubMed] [Google Scholar]
  29. Lv H, Zhang S, Wang B, Cui S, Yan J (2006) Toxicity of cationic lipids and cationic polymers in gene delivery. J Control Release 114:100–109 [DOI] [PubMed] [Google Scholar]
  30. Martin S, Vincent JP, Mazella J (2003) Involvement of the neurotensin receptor-3 in the neurotensin-induced migration of human microglia. J Neurosci 23:1198–1205 [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Martinez-Fong D, Navarro-Quiroga I (2000) Synthesis of a non-viral vector for gene transfer via the high-affinity neurotensin receptor. Brain Res Brain Res Protoc 6:13–24 [DOI] [PubMed] [Google Scholar]
  32. Mazella J et al (1998) The 100-kDa neurotensin receptor is gp95/sortilin, a non-G-protein-coupled receptor. J Biol Chem 273:26273–26276 [DOI] [PubMed] [Google Scholar]
  33. Miggin SM, Kinsella BT (1998) Expression and tissue distribution of the mRNAs encoding the human thromboxane A2 receptor (TP) alpha and beta isoforms. Biochim Biophys Acta 1425:543–559 [DOI] [PubMed] [Google Scholar]
  34. Miller WE, Lefkowitz RJ (2001) Expanding roles for beta-arrestins as scaffolds and adapters in GPCR signaling and trafficking. Curr Opin Cell Biol 13:139–145 [DOI] [PubMed] [Google Scholar]
  35. Moussa O, Ashton AW, Fraig M, Garrett-Mayer E, Ghoneim MA, Halushka PV, Watson DK (2008) Novel role of thromboxane receptors beta isoform in bladder cancer pathogenesis. Cancer Res 68:4097–4104 [DOI] [PubMed] [Google Scholar]
  36. Navarro V, Martin S, Mazella J (2006) Internalization-dependent regulation of HT29 cell proliferation by neurotensin. Peptides 27:2502–2507 [DOI] [PubMed] [Google Scholar]
  37. Navarro-Quiroga I, Antonio Gonzalez-Barrios J, Barron-Moreno F, Gonzalez-Bernal V, Martinez-Arguelles DB, Martinez-Fong D (2002) Improved neurotensin-vector-mediated gene transfer by the coupling of hemagglutinin HA2 fusogenic peptide and Vp1 SV40 nuclear localization signal. Brain Res Mol Brain Res 105:86–97 [DOI] [PubMed] [Google Scholar]
  38. Nouel D, Faure MP, St Pierre JA, Alonso R, Quirion R, Beaudet A (1997) Differential binding profile and internalization process of neurotensin via neuronal and glial receptors. J Neuroscience 17:1795–1803 [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Nouel D, Sarret P, Vincent JP, Mazella J, Beaudet A (1999) Pharmacological, molecular and functional characterization of glial neurotensin receptors. Neuroscience 94:1189–1197 [DOI] [PubMed] [Google Scholar]
  40. Parent JL, Labrecque P, Orsini MJ, Benovic JL (1999) Internalization of the TXA2 receptor alpha and beta isoforms. Role of the differentially spliced cooh terminus in agonist-promoted receptor internalization. J Biol Chem 274:8941–8948 [DOI] [PubMed] [Google Scholar]
  41. Perron A, Sarret P, Gendron L, Stroh T, Beaudet A (2005) Identification and functional characterization of a 5-transmembrane domain variant isoform of the NTS2 neurotensin receptor in rat central nervous system. J Biol Chem 280:10219–10227 [DOI] [PubMed] [Google Scholar]
  42. Raychowdhury MK, Yukawa M, Collins LJ, McGrail SH, Kent KC, Ware JA (1994) Alternative splicing produces a divergent cytoplasmic tail in the human endothelial thromboxane A2 receptor. J Biol Chem 269:19256–19261 [PubMed] [Google Scholar]
  43. Reubi JC, Waser B, Schaer JC, Laissue JA (1999) Neurotensin receptors in human neoplasms: high incidence in Ewing’s sarcomas. Int J Cancer 82:213–218 [DOI] [PubMed] [Google Scholar]
  44. Roskoski R Jr (2012) ERK1/2 MAP kinases: structure, function, and regulation. Pharmacol Res 66:105–143 [DOI] [PubMed] [Google Scholar]
  45. Rubio-Zapata HA, Rembao-Bojorquez JD, Arango-Rodriguez ML, Dupouy S, Forgez P, Martinez-Fong D (2009) NT-polyplex: a new tool for therapeutic gene delivery to neuroblastoma tumors. Cancer Gene Ther 16:573–584 [DOI] [PubMed] [Google Scholar]
  46. Saada S et al (2012) Differential expression of neurotensin and specific receptors, NTSR1 and NTSR2, in normal and malignant human B lymphocytes. J Immunol 189:5293–5303 [DOI] [PubMed] [Google Scholar]
  47. Sarret P, Gendron L, Kilian P, Nguyen HM, Gallo-Payet N, Payet MD, Beaudet A (2002) Pharmacology and functional properties of NTS2 neurotensin receptors in cerebellar granule cells. J Biol Chem 277:36233–36243 [DOI] [PubMed] [Google Scholar]
  48. Schade B et al (2013) β-Catenin signaling is a critical event in ErbB2-mediated mammary tumor progression. Cancer Res 73:4474–4487 [DOI] [PubMed] [Google Scholar]
  49. Schotte A, Leysen JE, Laduron PM (1986) Evidence for a displaceable non-specific [3H]neurotensin binding site in rat brain. Naunyn Schmiedebergs Arch Pharmacol 333:400–405 [DOI] [PubMed] [Google Scholar]
  50. Schotte A, Rostene W, Laduron PM (1988) Different subcellular localization of neurotensin-receptor and neurotensin-acceptor sites in the rat brain dopaminergic system. J Neurochem 50:1026–1031 [DOI] [PubMed] [Google Scholar]
  51. Servotte S et al (2006) The in vitro influences of neurotensin on the motility characteristics of human U373 glioblastoma cells. Neuropathol Appl Neurobiol 32:575–584 [DOI] [PubMed] [Google Scholar]
  52. Shy BR, Wu CI, Khramtsova GF, Zhang JY, Olopade OI, Goss KH, Merrill BJ (2013) Regulation of Tcf7l1 DNA binding and protein stability as principal mechanisms of Wnt/beta-catenin signaling. Cell Rep 4:1–9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Sobolesky PM, Moussa O (2013) The role of beta-arrestins in cancer. Prog Mol Biol Transl Sci 118:395–411 [DOI] [PubMed] [Google Scholar]
  54. Somai S, Gompel A, Rostene W, Forgez P (2002) Neurotensin counteracts apoptosis in breast cancer cells. Biochem Biophys Res Commun 295:482–488 [DOI] [PubMed] [Google Scholar]
  55. Souaze F et al (2006a) Expression of neurotensin and NT1 receptor in human breast cancer: a potential role in tumor progression. Cancer Res 66:6243–6249 [DOI] [PubMed] [Google Scholar]
  56. Souaze F et al (2006b) Neurotensin receptor 1 gene activation by the Tcf/beta-catenin pathway is an early event in human colonic adenomas. Carcinogenesis 27:708–716 [DOI] [PubMed] [Google Scholar]
  57. St-Gelais F, Jomphe C, LE Trudeau (2006) The role of neurotensin in central nervous system pathophysiology: what is the evidence? J Psychiatry Neurosci 31:229–245 [PMC free article] [PubMed] [Google Scholar]
  58. Swift SL, Burns JE, Maitland NJ (2010) Altered expression of neurotensin receptors is associated with the differentiation state of prostate cancer. Cancer Res 70:347–356 [DOI] [PubMed] [Google Scholar]
  59. Vandenbulcke F, Nouel D, Vincent JP, Mazella J, Beaudet A (2000) Ligand-induced internalization of neurotensin in transfected COS-7 cells: differential intracellular trafficking of ligand and receptor. J Cell Sci 113(Pt 17):2963–2975 [DOI] [PubMed] [Google Scholar]
  60. Vincent JP, Mazella J, Kitabgi P (1999) Neurotensin and neurotensin receptors. Trends Pharmacol Sci 20:302–309 [DOI] [PubMed] [Google Scholar]
  61. Walker N, Lepee-Lorgeoux I, Fournier J, Betancur C, Rostene W, Ferrara P, Caput D (1998) Tissue distribution and cellular localization of the levocabastine-sensitive neurotensin receptor mRNA in adult rat brain. Brain Res Mol Brain Res 57:193–200 [DOI] [PubMed] [Google Scholar]
  62. Wu Z, Martinez-Fong D, Tredaniel J, Forgez P (2012) Neurotensin and its high affinity receptor 1 as a potential pharmacological target in cancer therapy. Front Endocrinol 3:184 [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Younes M et al (2014) Neurotensin (NTS) and its receptor (NTSR1) causes EGFR, HER2 and HER3 over-expression and their autocrine/paracrine activation in lung tumors, confirming responsiveness to erlotinib. Oncotarget 5:8252–8269 [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Zamorano A, Lamas M, Vergara P, Naranjo JR, Segovia J (2003) Transcriptionally mediated gene targeting of gas1 to glioma cells elicits growth arrest and apoptosis. J Neurosci Res 71:256–263 [DOI] [PubMed] [Google Scholar]
  65. Zamorano A, Mellstrom B, Vergara P, Naranjo JR, Segovia J (2004) Glial-specific retrovirally mediated gas1 gene expression induces glioma cell apoptosis and inhibits tumor growth in vivo. Neurobiol Dis 15:483–491 [DOI] [PubMed] [Google Scholar]
  66. Zarco N, Gonzalez-Ramirez R, Gonzalez RO, Segovia J (2012) GAS1 induces cell death through an intrinsic apoptotic pathway. Apoptosis 17:627–635 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials


Articles from Cellular and Molecular Neurobiology are provided here courtesy of Springer

RESOURCES