Abstract
C. elegans uses chemosensation to recognize a variety of odors, many of which are released by bacteria, the major food source of C. elegans . Specific amphid sensory neurons are known to detect different odorants. Here we show that the AWC OFF neuron detects the attractive odorant 1-butanol. Because few odorants that are specifically recognized by the AWC OFF neuron have been identified, we hope that the identification of this additional odorant will facilitate studies of the role of the AWC OFF neuron in odor detection and discrimination.
Figure 1. AWC OFF neuron important for attraction of C. elegans to 1-butanol .
( A ) Wildtype N2 chemotaxis to dilutions of 1-butanol, n ≥ 8 assays. ( B ) 1-butanol (1:100) chemotaxis behavior of genetic mutants affecting olfactory neuron cell fates or function. Compared to N2 by ANOVA with Dunnett, n ≥ 6 assays. ( C ) N2, nsy-1(ky542) (two AWC ON neurons), and nsy-7(tm3080) (two AWC OFF neurons) to different dilutions of 1-butanol compared to N2 by ANOVA with Dunnett for each dilution, n ≥ 6 assays. ( D ) Partial rescue of 1-butanol (1:100) chemotaxis in tax-4(p678) mutants expressing tax-4 cDNA in AWC (ceh-36* promoter). All genotypes compared with ANOVA with Tukey n ≥ 10 assays. For all panels, error bars are standard error of means (SEM). ****P < 0.0001, ***P < 0.001, **P < 0.01, and *P < 0.05.
Description
C. elegans uses chemosensation to detect odors in its environment. Bacteria which are the major food source of C. elegans release many of these odors. Several chemosensory neurons located in the head or amphid of the worm detect different volatile organic chemicals and each chemosensory neuron expresses many different olfactory receptors. The primary chemosensory neurons for detecting attractive odorants are AWA and AWC and for repulsive odorants are AWB, ASH and ADL (reviewed in Ferkey et al., 2021). However, the neurons involved in detecting many odorants are still unknown. Here, we examine the neurons detecting 1-butanol. The odorant 1-butanol is found in in the headspace (volume of air above bacteria) of the following bacterial species: E. coli HB101 , Flavobacterium sp. JUb43, and Providencia sp. JUb39, as well as the culture media LB without bacteria (Worthy et al., 2018a).
First, we examined the chemotaxis behavior of wildtype N2 animals to 1-butanol. As previously shown (Bargmann et al., 1993) , C. elegans was attracted to 1-butanol at a range of dilutions, 1:10, 1:100 and 1:1000 ( Fig. 1A ). Second, to determine which neurons are involved in detecting 1-butanol, we tested C. elegans strains that have mutations in genes that affect the cell fate or sensory function of specific chemosensory neurons in 1-butanol chemotaxis assays. Overall, we found that mutations that affected the function or cell-fate of AWC neurons exhibited defective chemotaxis behavior to 1-butanol. The mutant ceh-36 , which lacks AWC neurons (Lanjuin et al., 2003; Koga and Ohshima, 2004) , had defective chemotaxis to 1-butanol ( Fig. 1B ). The mutant ceh-36 also affects ASE taste neurons (Chang et al., 2003; Koga and Ohshima 2004) , but the ASE neurons are unlikely to be involved because the che-1 mutant, which lacks ASE neurons (Uchida et al., 2003) , exhibited wildtype chemotaxis towards 1-butanol. Other mutants affecting different chemosensory neurons exhibited wildtype 1-butanol chemotaxis. Specifically, the odr-7 mutant which affects AWA cell fate (Sengupta et al., 1994) and lim-4 mutant which affects AWB cell fate (Sagasti et al., 1999) resembled wildtype animals in their chemotaxis to 1-butanol. Additionally, the mutant osm-9 which lacks sensory function of ASH, ADL and AWA neurons (Tobin et al., 2002) also showed strong chemotaxis for 1-butanol. These results suggest that AWC neurons are important for 1-butanol chemotaxis.
Next, we examined the role of AWC neurons in chemotaxis to 1-butanol. The AWC neuron class contains two neurons, AWC ON and AWC OFF , that are functionally distinct and detect different sets of overlapping odorants. AWC ON detects 2-butanone, 2-heptanone, and acetone, AWC OFF detects 2,3-pentanedione, and both detect benzaldehyde, isoamyl alcohol, and other odors (Troemel et al., 1999; Wes and Bargmann, 2001; Zhang et al., 2016; Worthy et al., 2018b; Ferkey et al., 2021) . Animals mutant for the gene nsy-1 have cell fate transformation that results in the elimination of the AWC OFF neuron, resulting in two AWC ON neurons (Sagasti et al., 2001) . The nsy-1 mutants were defective in 1-butanol chemotaxis indicating that AWC OFF is likely important for attraction to 1-butanol ( Fig. 1B ). Consistent with this, the nsy-7 mutant, which lacks the AWC ON neuron and has two AWC OFF neurons (Chuang et al., 2007; Lesch et al., 2009) , retained wildtype chemotaxis for 1-butanol ( Fig. 1B ). We tested the nsy-1 and nsy-7 mutants at two additional dilutions (1:10 and 1:1000) of 1-butanol ( Fig. 1C ). The nsy-1 mutant was defective at all dilutions; the nsy-7 mutant was no different from wildtype N2 at all dilutions. Thus, having two AWC OFF neurons does not seem to increase chemotaxis to 1-butanol. Taken together, these results suggest that AWC OFF is necessary for chemotaxis to 1-butanol.
Sensory transduction in many sensory neurons, including AWC, requires a cyclic nucleotide-gated channel ( TAX-4 ) (Komatsu et al., 1996) . The tax-4 mutant was also defective for 1-butanol chemotaxis ( Fig. 1D ). Attraction to 1-butanol was partially restored by tax-4 expression under the ceh-36 * promoter which is selective for AWC neurons ( ceh-36 * is a modified ceh-36 promoter with 12 bp removed) ( Fig. 1D ) (Chang et al., 2003; Koga and Ohshima 2004) . This result provides evidence that AWC is important for chemotaxis to 1-butanol. The partial rescue may indicate that the expression level of tax-4 in the AWC OFF neuron in the strain was not sufficient for complete rescue or that other neurons in addition to AWC are involved in chemotaxis to 1-butanol.
In conclusion, we have found that the AWC OFF is important for the detection of 1-butanol. We hope this observation will facilitate studies of AWC OFF involvement in odor detection and discrimination.
Methods
Chemotaxis assays
Chemotaxis assays were performed using 10 cm square chemotaxis plates as described (Tsunozaki et al., 2008) . In brief, assay agar was 2% agar, 1mM MgSO 4 , 1mM CaCl 2 , 5mM phosphate buffer [pH 6.0]. Chemical dilutions were in ethanol at the concentrations indicated in figure legends. 2 μL of diluted chemical was pipetted on one side of the plate, 2 μl of ethanol on the other side, and 2 μL of 1M sodium azide on both sides to anaesthetize animals that reached odor or ethanol sources. Adult animals were washed twice in S-basal buffer and one time in water, 50–200 animals were placed at the center of chemotaxis plate, plate was covered with lid, and the distribution of animals counted after 1 hour. The lim-4 ( ky403 ) mutant animals move more slowly and were counted after 20 hours.
Statistical analysis
Means represent data pooled from assays run on at least two different days with at least 6 replicates. Error bars in all figures are standard error of means. The data were analyzed using statistics described in figure legend with GraphPad Prism v10.3 for Mac (GraphPad Software, San Diego, California USA).
Reagents
C. elegans strains
1 ceh-36*p is genomic sequence upstream of ceh-36 gene, ctcacatccatctttctggcgactgtttca…gcctgcccccgcatgcacaa with 12bp removed, gaagaagcctta.
Acknowledgments
Acknowledgments
We thank Dr. Cori Bargmann for strains. Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440).
Funding Statement
Thank you for support from the Pomona College Neuroscience Department and Pomona College Summer Undergraduate Research Program.
References
- Bargmann CI, Hartwieg E, Horvitz HR. Odorant-selective genes and neurons mediate olfaction in C. elegans. Cell. 1993 Aug 13;74(3):515–527. doi: 10.1016/0092-8674(93)80053-h. [DOI] [PubMed] [Google Scholar]
- Chang Sarah, Johnston Robert J., Hobert Oliver. A transcriptional regulatory cascade that controls left/right asymmetry in chemosensory neurons of C. elegans . Genes & Development. 2003 Sep 1;17(17):2123–2137. doi: 10.1101/gad.1117903. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chuang CF, Vanhoven MK, Fetter RD, Verselis VK, Bargmann CI. An innexin-dependent cell network establishes left-right neuronal asymmetry in C. elegans. Cell. 2007 May 18;129(4):787–799. doi: 10.1016/j.cell.2007.02.052. [DOI] [PubMed] [Google Scholar]
- Ferkey DM, Sengupta P, L'Etoile ND. Chemosensory signal transduction in Caenorhabditis elegans. Genetics. 2021 Mar 31;217(3) doi: 10.1093/genetics/iyab004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Koga M, Ohshima Y. The C. elegans ceh-36 gene encodes a putative homemodomain transcription factor involved in chemosensory functions of ASE and AWC neurons. J Mol Biol. 2004 Feb 20;336(3):579–587. doi: 10.1016/j.jmb.2003.12.037. [DOI] [PubMed] [Google Scholar]
- Komatsu H, Mori I, Rhee JS, Akaike N, Ohshima Y. Mutations in a cyclic nucleotide-gated channel lead to abnormal thermosensation and chemosensation in C. elegans. Neuron. 1996 Oct 1;17(4):707–718. doi: 10.1016/s0896-6273(00)80202-0. [DOI] [PubMed] [Google Scholar]
- Lanjuin A, VanHoven MK, Bargmann CI, Thompson JK, Sengupta P. Otx/otd homeobox genes specify distinct sensory neuron identities in C. elegans. Dev Cell. 2003 Oct 1;5(4):621–633. doi: 10.1016/s1534-5807(03)00293-4. [DOI] [PubMed] [Google Scholar]
- Lesch BJ, Gehrke AR, Bulyk ML, Bargmann CI. Transcriptional regulation and stabilization of left-right neuronal identity in C. elegans. Genes Dev. 2009 Feb 1;23(3):345–358. doi: 10.1101/gad.1763509. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sagasti A, Hisamoto N, Hyodo J, Tanaka-Hino M, Matsumoto K, Bargmann CI. The CaMKII UNC-43 activates the MAPKKK NSY-1 to execute a lateral signaling decision required for asymmetric olfactory neuron fates. Cell. 2001 Apr 20;105(2):221–232. doi: 10.1016/s0092-8674(01)00313-0. [DOI] [PubMed] [Google Scholar]
- Sagasti A, Hobert O, Troemel ER, Ruvkun G, Bargmann CI. Alternative olfactory neuron fates are specified by the LIM homeobox gene lim-4. Genes Dev. 1999 Jul 15;13(14):1794–1806. doi: 10.1101/gad.13.14.1794. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sengupta P, Colbert HA, Bargmann CI. The C. elegans gene odr-7 encodes an olfactory-specific member of the nuclear receptor superfamily. Cell. 1994 Dec 16;79(6):971–980. doi: 10.1016/0092-8674(94)90028-0. [DOI] [PubMed] [Google Scholar]
- Tobin DM, Madsen DM, Kahn-Kirby A, Peckol EL, Moulder G, Barstead R, Maricq AV, Bargmann CI. Combinatorial expression of TRPV channel proteins defines their sensory functions and subcellular localization in C. elegans neurons. Neuron. 2002 Jul 18;35(2):307–318. doi: 10.1016/s0896-6273(02)00757-2. [DOI] [PubMed] [Google Scholar]
- Troemel ER, Sagasti A, Bargmann CI. Lateral signaling mediated by axon contact and calcium entry regulates asymmetric odorant receptor expression in C. elegans. Cell. 1999 Nov 12;99(4):387–398. doi: 10.1016/s0092-8674(00)81525-1. [DOI] [PubMed] [Google Scholar]
- Tsunozaki M, Chalasani SH, Bargmann CI. A behavioral switch: cGMP and PKC signaling in olfactory neurons reverses odor preference in C. elegans. Neuron. 2008 Sep 25;59(6):959–971. doi: 10.1016/j.neuron.2008.07.038. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Uchida O, Nakano H, Koga M, Ohshima Y. The C. elegans che-1 gene encodes a zinc finger transcription factor required for specification of the ASE chemosensory neurons. Development. 2003 Apr 1;130(7):1215–1224. doi: 10.1242/dev.00341. [DOI] [PubMed] [Google Scholar]
- Wes PD, Bargmann CI. C. elegans odour discrimination requires asymmetric diversity in olfactory neurons. Nature. 2001 Apr 5;410(6829):698–701. doi: 10.1038/35070581. [DOI] [PubMed] [Google Scholar]
- Worthy SE, Haynes L, Chambers M, Bethune D, Kan E, Chung K, Ota R, Taylor CJ, Glater EE. Identification of attractive odorants released by preferred bacterial food found in the natural habitats of C. elegans. PLoS One. 2018 Jul 23;13(7):e0201158–e0201158. doi: 10.1371/journal.pone.0201158. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Worthy SE, Rojas GL, Taylor CJ, Glater EE. Identification of Odor Blend Used by Caenorhabditis elegans for Pathogen Recognition. Chem Senses. 2018 Feb 26;43(3):169–180. doi: 10.1093/chemse/bjy001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhang Chunmei, Zhao Ninghui, Chen Yao, Zhang Donghua, Yan Jinyuan, Zou Wei, Zhang Keqin, Huang Xiaowei. The Signaling Pathway of Caenorhabditis elegans Mediates Chemotaxis Response to the Attractant 2-Heptanone in a Trojan Horse-like Pathogenesis. Journal of Biological Chemistry. 2016 Nov 1;291(45):23618–23627. doi: 10.1074/jbc.m116.741132. [DOI] [PMC free article] [PubMed] [Google Scholar]

