Structural Requirements for Activity of Mind bomb1 in Notch Signaling

SUMMARY

Mind bomb 1 (MIB1) is a RING E3 ligase that ubiquitinates Notch ligands, a necessary step for induction of Notch signaling. The structural basis for binding of the JAG1 ligand by the N-terminal region of MIB1 is known, yet how the ankyrin (ANK) and RING domains of MIB1 cooperate to catalyze ubiquitin transfer from E2~Ub to Notch ligands remains unclear. Here, we show that the third RING domain and adjacent coiled coil region (ccRING3) drive MIB1 dimerization and that MIB1 ubiquitin transfer activity relies solely on ccRING3. We report x-ray crystal structures of a UbcH5B-ccRING3 complex and the ANK domain. Directly tethering the MIB1 N-terminal region to ccRING3 forms a minimal MIB1 protein sufficient to induce a Notch response in receiver cells and rescue mib knockout phenotypes in flies. Together, these studies define the functional elements of an E3 ligase needed for ligands to induce a Notch signaling response.

eTOC blurb

Cao et al. performed structure-function studies of MIB1, an E3 ligase required for signaling activity of Notch ligands. They found that engineering Mini-MIB1 by directly tethering the ligand-binding region to the C-terminal coiled-coil RING3 dimer sufficed to ubiquitinate substrates, signal in cells, and substantially rescue mib1 knockout defects in flies.

Graphical Abstract

INTRODUCTION

Notch signaling is a conserved system of cellular communication that plays a pivotal role in development and adult tissue homeostasis.^1–3 Signals transduced by Notch receptors influence cell fate decisions in many tissues, and mutations of various core protein components of the Notch pathway result in developmental disorders of the gastrointestinal, cardiovascular, hematopoietic, and central nervous systems.³

Notch signaling is initiated when a transmembrane ligand on a signal-sending cell binds a Notch protein on a receiver cell. Bound ligand then induces proteolytic cleavage of Notch at a juxtamembrane extracellular site by an ADAM metalloprotease at site S2, which enables subsequent proteolytic processing of the truncated Notch protein at the inner membrane leaflet by gamma secretase^4,5 at site S3 and release of the Notch intracellular domain (NICD) into the cell. Entry of NICD into the nucleus then leads to assembly of a transcriptional activation complex that induces the expression of Notch target genes.^6–9

A crucial event that links the formation of ligand-receptor complexes to productive signaling is the requirement for ubiquitination-dependent endocytosis of the ligand in sender cells.¹⁰ Genetic investigations in flies and zebrafish identified two distinct E3 ubiquitin ligases, Mind bomb (MIB) and Neuralized (NEUR), that can catalyze the transfer of ubiquitin to the cytoplasmic tails of Notch ligands.^11–13 MIB and NEUR have neither sequence nor structural similarity and they appear to recognize different sequences within the cytoplasmic tails of Notch ligands.¹⁴ The two E3 ligases, however, can functionally substitute for each other in certain cellular contexts,¹⁵ suggesting a degree of functional redundancy between them.

In mammals, there are two MIB proteins capable of ubiquitinating Notch ligands, MIB1 and MIB2. ^12,16 They are modular proteins that contain an N-terminal substrate recognition domain encompassing MZM and REP regions,¹⁷ a central ankyrin repeat domain (ANK), and a C-terminal region that includes a series of RING domains (Figure 1A). The main difference between MIB1 and MIB2 is that MIB1 has three RING domains, whereas MIB2 has only two, with its second RING domain homologous to RING3 of MIB1.

Fig. 1. The ccRING3 region is responsible for the ubiquitination activity of MIB1.

A, Domain organization of MIB1 and design of truncated MIB1 protein variants tested in the ubiquitination assay. B, SDS-PAGE gel of purified MIB1 truncation variants, visualized by staining with Coomassie Blue. C and D, SDS-PAGE and Westen Blot analysis of in vitro auto-ubiquitination activity of truncated MIB1 variants. Reactions were performed for 3h in the absence (−) or presence of Ub (+). Products were separated by SDS-PAGE, and detected either by Coomassie Blue staining (C), or with an anti-Ubiquitin (Ub) antibody (D). Arrowheads in panel C indicate the migration positions of the unmodified different MIB1 variants. See also Figure S1.

Functionally, MIB1 is essential for Notch signaling during mammalian development, whereas MIB2 appears to be dispensable. MIB2 knockout mice are viable and grossly normal, but MIB1 knockout mice die in utero at roughly embryonic day 10.5.^18–20 Conditional inactivation of MIB1 in different tissues also results in Notch loss of function phenotypes, again highlighting its importance in developmental Notch signaling.^21–24

MIB1 is also implicated in other signaling pathways and cellular processes. It influences Wnt/β-catenin signaling by ubiquitinating the receptor-like tyrosine kinase RYK, facilitating the endocytosis of RYK in response to Wnt signaling.²⁵ It is also linked to centriolar satellite formation and ciliogenesis, adenovirus infection, NF-kB activation, and signaling events that lead to cell death.^26–30 These other activities of MIB1 highlight its importance as a regulator of other cellular processes beyond Notch signaling.

Although previous work has elucidated the basis for substrate recognition by the N-terminal, MZM/REP region of MIB1,¹⁷ how the modular structural elements of MIB1 work together to coordinate the transfer of ubiquitin to its substrates is less clear. In the work reported here, we show that the ubiquitin transfer activity of MIB1 relies on RING3, but not on RING1 or RING2, and that formation of MIB1 dimers relies on RING3 and an adjacent coiled coil region, together termed ccRING3. We determine x-ray crystal structures of the ANK domain and of a complex of ccRING3 with UbcH5B, a functional E2 subunit for MIB1, as a fusion protein, and use negative staining electron microscopy to image full-length MIB1, identifying flexibility in the linkages between modular elements. Lastly, we investigate the structural elements of MIB1 required to stimulate Notch signals, and find that directly tethering the N-terminal, MZM/REP region to ccRING3 in a minimized MIB1 protein (mini-MIB1) is sufficient to induce a Notch signal in receiver cells and rescue mib knockout phenotypes in flies. Together, these studies define the functional elements of an E3 ligase needed for ligands to induce a Notch signaling response.

RESULTS

RING3 is responsible for the ubiquitination activity of MIB1

MIB1 contains three RING domains at its C-terminal end. We analyzed the autoubiquitination activity of a series of truncated MIB1 variants encompassing the ANK domain and the three RINGs (Figure 1A) to determine which RING domain(s) are necessary for ubiquitin transfer activity. We purified each protein to homogeneity, as judged by SDS-PAGE (Figure 1B), and performed an autoubiquitination assay for each protein in the presence of E1, the E2 UbcH5B, and ubiquitin (Figure 1C,D; Figure S1A,B, related to Figure 1). Whereas ANK-RING1–3 and RING1–3 proteins showed robust self-ubiquitination activity in the presence of E1, E2, and Ub, the two proteins lacking ccRING3, labeled ANK-RING1–2 and RING1–2, did not self-ubiquitinate, indicating that ccRING3 is absolutely required for self-ubiquitination. In isolation, purified ccRING3 did not self-ubiquitinate, likely because there is not a good lysine acceptor within the isolated ccRING3 polypeptide.

Structure of a UbcH5B-ccRING3 fusion protein

Efforts to determine the structure of an E2-ccRING3 complex using separately purified ccRING3 and UbcH5B proteins were not successful. Therefore, we constructed a fusion protein with UbcH5B at the N-terminus connected to the ccRING3 portion of MIB1 at residue 936 with an 18-residue glycine-serine (GS) linker (Figure 2A). After purification and crystallization of this fusion protein, we determined its x-ray crystal structure to 2.4 Å resolution (Table S1, related to Figure 2).

Fig. 2. Structure of a UbcH5B-ccRING3 fusion protein.

A, Schematic of the fusion protein used to mimic a UbcH5B-ccRING3 complex, in which UbcH5B was tethered to ccRING3 (residues 936–1006) using a Gly-Ser (GS) linker. B, Cartoon representation of the structure of the UbcH5B-ccRING3 dimer of heterodimers. The ccRING3 subunits are magenta and blue, and their partner UbcH5B subunits are cyan and green, respectively. Zn⁺⁺ ions are colored gray and rendered as spheres. C, Comparison of the UbcH5B-ccRING3 dimer (colored as in B) with the UbcH5B-Ub-BIRC7 dimeric complex (gray). D, Contacts between ccRING3 of MIB1 and UbcH5B. Residues that approach within van der Waals distance are rendered as sticks, and a hydrogen bond from W93 of UbcH5B to the R996 side chain of MIB1 is shown as a dotted red line. See also Figure S2 and Table S1.

In the structure, two molecules of ccRING3 form a homodimer, with each copy bound to one UbcH5B molecule in a complex with 2:2 stoichiometry (Figure 2B). The structure of each MIB1 subunit of the complex closely resembles that of BIRC7 in complex with UbcH5B-ubiquitin (Figure 2C), as well as that of other dimeric RING E3 ligase domains complexed with E2 or E2-ubiquitin.^31–33 Dimerization is mediated both by coiled-coil contacts and hydrophobic packing between the RING3 domains. Residues V965, M989, P993 and I994 of the RING3 domain, which are highly conserved among RING E3 ligases, form hydrophobic interactions with P61, F62 and P95 of UbcH5B, as seen in other complexes between E2 proteins and RING E3s (Figure 2D, Figure S1C, related to Figure 2). R996 of the RING3 domain also forms a hydrogen bond with the main chain of W93 of UbcH5B (Figure 2D).

Structure of the ANK repeat domain

We produced the ANK repeat domain (residues 409–794) in bacteria, purified it to homogeneity, grew diffracting crystals and determined its structure to 2.4 Å resolution using molecular replacement (Table S2, related to Figure 3). The model includes 10 ankyrin repeats, which adopt a horseshoe-like arrangement (Figure 3A), extending 90 Å across its length from residue 428 at the N-terminus of the first repeat to position 794 at the C-terminal end. The ninth repeat features an atypically extended alpha helix, which participates in crystal packing interactions (Figure S2A, related to Figure 3). Strikingly, the concave face of the ANK domain is highly conserved, suggesting functional importance (Figure S2B, related to Figure 3).

Fig 3. Structure of the ANK region and negative stain EM of full length MIB1.

A, Cartoon representation of the MIB1 ANK domain structure, colored from blue (N-terminus) to red (C-terminus). B, 2D class averages of negative-stain images of full length murine MIB1, illustrating the heterogeneity of conformations of the full-length protein. Scale bar, 10 nm. C, Cartoon representation of the Colabfold³⁴ model of MIB1 (left panel), colored by pLDDT value (per residue model confidence score) on a sliding scale from blue (pLDDT >90) to orange (pLDDT < 50). The right panel shows the expected position error plot, colored on a sliding scale from dark blue (0 Å) to red (>30 Å), for the Colabfold model of full-length MIB1, consistent with a lack of long-range interactions in the protein. Scale bar, 20 Å (2 nm). See also Figure S3 and Table S2.

Negative stain electron microscopy of purified, full-length murine MIB1 suggests interdomain flexibility

We purified full-length murine MIB1 and examined it using negative stain electron microscopy (EM) because the yield of full-length human MIB1, which we used for most ubiquitination assays (see below), was insufficient for structural studies (Figure S2C, related to Figure 3). The EM images show that MIB1 exhibits structural heterogeneity and adopts a variety of different conformations with extended and closed forms visible among the two-dimensional class averages (Figure 3B), suggesting that MIB1 is highly dynamic and has flexible linkers connecting individually structured elements. The Alphafold2³⁴ model for full-length MIB1 is consistent with this interpretation, with low position aligned error (PAE) values for residue pairs within the structured domains and large PAE values for residue pairs located in different domains (Figure 3C). The size of the particles also suggests that full-length MIB1 is dimeric like the isolated ccRING3 domain (see below).

Mutational structure-function analysis of MIB1

We examined the consequences of mutations of MIB1 on the ability of Delta-like 4 (DLL4) to induce a transcriptional response. This activity was tested using a co-culture assay in which DLL4 expressing sender cells were co-cultured with U2OS receiver cells expressing a Notch1-Gal4 chimeric protein and a UAS-regulated luciferase reporter gene³⁵ (Figure 4A). As sender cells we used U2OS MIB1^−/− knockout cells (Figure S3A–C, related to Figure 4), stably transfected with DLL4 alone, wild-type (wt, full-length) MIB1 alone, or with DLL4 and either wt or mutated MIB1 using lentiviral transduction (Figure S3D, related to Figure 4). We included an N-terminal mNeonGreen tag at the N-terminus of the MIB1 proteins, which allowed confirmation that all proteins were expressed in amounts comparable to or greater than full-length wt MIB1 using flow cytometry (Figure S3E, related to Figure 4). We also performed a co-culture assay using U2OS MIB1 knockout cells stably expressing DLL4-mCherry as sender cells, using transient transfection with increasing doses of plasmids encoding FLAG-tagged wild-type or mutated MIB1 variants, which gave very similar results (Figure S4, related to Figure 4), and which also allowed us to confirm that the mutant MIB1 proteins were expressed and largely intact (Figure S4, related to Figure 4).

Fig. 4. Reporter gene and ubiquitination assays testing the activity of MIB1 variants.

A, Reporter gene assay. Activation of U2OS-Notch1-Gal4 receiver cells by U2OS MIB1 knockout cells stably transfected with Full-length MIB1 alone, DLL4 alone or DLL4 and wild-type (Full-length) or mutant/truncated forms of MIB1. All results were normalized to the activity with U2OS MIB1 knockout cells stably transfected with DLL4 and wild-type MIB1. Error bars represent standard deviation over n ≥ 3 independent repeats, and p-values were determined using a one sample Wilcoxon signed rank test. ns: p>0.05, *, p<0.05, **, p<0.01; ***, p<0.001, ****, p<0.0001. B, Autoubiquitination assay of dimerization mutants. Wild-type (FL(WT)), I957E, and I974E forms of MIB1 were incubated with ubiquitin, E1, and E2. Protein products were separated by SDS-PAGE on 4–20% gradient gels. Products were detected by Western blot with an anti-MIB1 antibody (left), or an anti-Ubiquitin antibody (right). C. Ubiquitination of a Jag1 substrate by murine Mib1 and Mini-MIB1/22. Wild-type murine Mib1, Mini-MIB1/22, and ANK-RING1–2 were incubated with ubiquitin, E1, and E2. Protein products were separated by SDS-PAGE on 4–20% gradient gels. Products were detected by Coomassie blue staining (left panel) or by Western blot with an anti-Ubiquitin antibody (right panel). See also Figures S4–S6.

Addition of DLL4 to U2OS MIB1^−/− knockout cells did not induce a transcriptional response, confirming the requirement of MIB1 for the induction of a reporter signal (Figure 4A). As expected, delivery of wt (full-length) MIB1 and DLL4 into MIB1^−/− knockout sender cells leads to substantial reporter gene induction in Notch1-Gal4 receiver cells, whereas delivery of MIB1 lacking the MZM/REP region (ΔMZM/REP), which is required for binding of ligand cytoplasmic tails,¹⁷ fails to rescue reporter activity. Likewise, deletion of the ccRING3 region also renders MIB1 unable to rescue signaling activity in the reporter assay (Figure 4A), consistent with the requirement for ccRING3 in ubiquitin transfer (Figure 1).

Remarkably, despite the conservation of the concave face of the ANK domain (Figure S2B, related to Figure 3), deletion of the entire ANK domain results only in a minor reduction of Notch reporter activity that is not statistically significant. Similarly, an internal deletion of repeats 2–6 within the ANK domain retains some signaling activity, though the reduction is statistically significant. Deletion of either RING1 or RING2 also has no significant effect on signaling, whereas deletion of both RING1 and RING2 increases the reporter signal. This increased signal may result from an increased amount of ΔRING1–2 protein relative to wild-type MIB1 (Figure S3E, related to Figure 4), or it may hint at a minor autoinhibitory role for RING1–2.

Effect of dimer disrupting mutations on MIB1 activity

The isolated ccRING3 region forms a homodimer, as judged by multiple angle light scattering (SEC-MALS; Figure S5A, related to Figure 4). In contrast, SEC-MALS revealed that the isolated, purified ANK domain is a monomer (Figure S5B, related to Figure 4), that ANK-RING1–2 is predominantly monomeric (Figure S5C, related to Figure 4), and that ANK-RING1–3 forms a homodimer (Figure S5D, related to Figure 4). The MZM/REP region is monomeric in isolation, as judged by small angle X-ray scattering¹⁷, and Alphafold multimer³⁴ also predicts that the isolated ccRING3 region dimerizes using the interface seen in the crystal structure of the UbcH5B-ccRING3 complex (Figure 2). Together, these data indicate that dimerization of MIB1 relies primarily on the ccRING3 region.

To test the importance of dimerization of the cc-RING3 region of MIB1, we introduced an I957E mutation to disrupt the hydrophobic packing of the coiled coil, or an I974E mutation within the hydrophobic core of the RING3 domain (Figure S6A, related to Figure 4A). We purified each mutated ccRING3 protein to homogeneity (Figure S6B, related to Figure 4) and confirmed that each mutation converted ccRING3 from a dimer to a monomer, as judged using SEC-MALS (Figure S6C, related to Figure 4). When introduced into full-length MIB1, the I974E mutation did not result in a statistically significant increase in signaling activity compared to the negative control in the reporter assay, whereas I957E resulted in a partial, but incomplete rescue of signaling activity that was statistically significant compared to no added MIB1 (p = 0.019, ratio paired t-test; Figure 4A). A C995S mutation in the RING3 domain, which disables the RING domain of other E3 ligases and inactivates MIB1 in other contexts,^12,25 also eliminates MIB1 activity in the reporter assay (Figure 4A).

We conducted an autoubiquitination assay with purified full-length wild-type (FL(WT)) MIB1 protein and compared it with the activity of the purified I957E (FL(I957E)) and I974E (FL(I974E)) mutants using comparable amounts of MIB1 protein (Figure 4B). The autoubiquitination activity of the FL(WT), I957E, and I974E proteins closely tracked their relative signaling activity in the reporter assay, with WT MIB1 exhibiting extensive autoubiquitination, the I957E mutant weak partial autoubiquitination, and the I974E mutant negligible autoubiquitination (Figure 4B). Together, the reporter and ubiquitination data show that the MIB1 dimer is much more active than the monomer, but a stable dimer of the ccRING3 domain is not an absolute prerequisite for activity.

Construction of a functional mini-MIB1 without the ANK-RING1–2 region

Because the ANK, RING1, and RING2 domains are not essential for MIB1 activity in the reporter gene assay, we tested whether tethering MZM/REP to the ccRING3 region of MIB1 with a flexible linker is sufficient to catalyze ubiquitin transfer or to support DLL4-induced Notch signaling in the co-culture assay. We connected the MZM/REP and ccRING3 elements with two different-length linkers, one of 22 residues (Mini-MIB1/22) and the other of 43 residues (Mini-MIB1/43). Mini-MIB1/22 exhibited Ub transfer activity comparable to that of full-length murine Mib1 when a recombinant JAG1 tail polypeptide, produced as an N-terminal Sumo fusion¹⁷, was used as a receiver substrate (Figure 4C). In contrast, ANK-RING1–2 had no activity with the same substrate, confirming that tethering the N-terminal substrate binding domain of MIB to ccRING3 was sufficient to catalyze the ubiquitination of a JAG1 substrate. Both Mini-MIB1 proteins induced a signaling response indistinguishable from wild-type (full-length) MIB1 in the reporter gene assay (Figure 4A), confirming that the ANK, RING1, and RING2 domains are also dispensable for the function of MIB1 in Notch signal-sending cells.

Mini-MIB1 can complement Mib1 function in Drosophila

To investigate the functionality of Mini-MIB1 in an in vivo setting, we asked whether Mini-MIB1/22 can rescue the phenotype of mib1 mutant Drosophila. dMib1 (Drosophila Mib1) and human MIB1 are highly conserved orthologues. dMib1 mediates several Notch dependent developmental processes, such as eye, leg and wing development. mib1 mutant flies die as fully differentiated pharate adults in the pupal case. The mutant flies display Notch deficient phenotypes, such as the loss of most wing tissue and strong leg defects (Fig. 5A–B”) ^36,37.

Fig. 5. Mini-MIB1 activity in Drosophila.

(A, B, C, E, F, G) Expression of Wg in wing imaginal discs of the late third instar stage. (A-A”) Wildtype situation: imaginal disc (A), (A’) wing and leg (A”). The arrowhead in (A) points to the expression of Wingless (Wg) along the D/V-boundary, which reveals the activity of the pathway in the assay. (B-B”) The phenotype of mib1 mutant flies. (B) The expression of Wg along the D/V-boundary was lost. (B’) As a consequence of the loss of Notch activity, wing development was abolished to a large degree resulting in the formation of a small winglet. Moreover, the tarsal region of the leg was dramatically reduced and tarsal joints were absent. (C, C’) Rescue of mib1 mutants with one copy of MIB1 expressed under control of the tubulin promoter. The expression of Wg along the D/V boundary was restored. The only visible abnormalities were the generation of some extra vein fragments along vein 2 and a slight broadening of vein 5 (arrow and arrowhead, respectively, compare with A’). (D, D’) Full rescue of mib1 in the presence of two copies of MIB1. No developmental defects were observed (compare with A’, A”). (E-F”) Partial rescue with one copy (E-E”) and near complete rescue with two copies (F-F”) of Mini-MIB1/22. (G-G”) No rescue was observed in the presence of one copy of Mini-MIB1/22 (I974E) (compare with B-B”).

In the wing imaginal disc of mib1 mutants the expression of the Notch target gene wingless (wg) along the dorso-ventral compartment boundary (D/V-boundary, Figure 5A, arrowhead) is abolished (Figure 5B) ^36,37. This leads to a dramatic reduction of proliferation of the wing pouch, which later gives rise to the wing. Deficient Notch-signaling in the leg imaginal disc results in reduced outgrowth of the leg segments and fusion of femur and tibia. Especially the tarsal segments are dramatically reduced in size and the segments are fused due to the lack of joints (Figure 5B”, compare with A”).

The introduction of one copy of MIB1 full-length construct, ubiquitously expressed under control of a tubulin promoter (tub-MIB1) results in the complete rescue of the pupal lethality and a near complete rescue of the mutant phenotypes of mib1 mutants (Figure 5C–C”). In the presence of two copies of tub-MIB1 the rescue was complete, indicating that MIB1 can compensate for the loss of function of mib1 in Drosophila (Figure 5D–D”).

The expression of one copy of tub-Mini-MIB1/22 resulted in a partial, but significant rescue (Figure 5E–E”). The rescued flies hatched and displayed a fully formed femur and tibia, and an elongated tarsal region. However, the joints were still absent (Figure 5E”, compared with B” and A”). The wing developed partially, with reduced formation of the posterior half (Figure 5E’, compared with B’). In accordance, the expression of Wg along the D/V-boundary in the wing imaginal disc was only partially re-established (Figure 5E). Finally, the rescue of the mib1 mutants was stronger in the presence of two copies of tub-Mini-MIB1/22 (Figure 5F–F”). The wing was nearly completely rescued and the tarsal joint were re-established with the exception of the joint between segments 4 and 5 (Figure 5F–F”). In contrast, a Mini-MIB1/22 variant bearing the I974E mutation, tub-Mini-MIB1/22^I974E, failed to rescue the mib1 mutant phenotype at all when present in a single copy (Figure 5G–G”). These results confirm and extend the conclusions of the in vitro and cell-based experiments by showing that Mini-MIB1/22 has substantial functional activity in vivo.

DISCUSSION

This work reports a structure-function analysis of the ANK and RING regions of human MIB1 in Notch-Delta signaling. Previous studies have shown that the N-terminal MZM and REP domains bind the cytoplasmic tails of Notch ligands and defined the structural basis for ligand tail recognition.¹⁷ Early studies of the zebrafish and fly Mib proteins also implicated the third RING domain as most critical for function in Notch signaling.^12,37,38

Our crystal structure of the ccRING3 dimer in complex with UbcH5B shows why the zebrafish mib1 ta52b allele, M1013R (equivalent to M989 of human MIB1) is such a strong loss-of-function mutation ¹². This residue is packed tightly within a hydrophobic cluster of the RING3 domain at its interface with UbcH5B, where an arginine residue would not be tolerated.

In the BIRC7 dimer, the C-terminal tail of one RING stabilizes the bound ubiquitin loaded onto the second RING in trans, explaining why formation of a dimeric complex of the RING E3 with E2~Ub is required for ubiquitin transfer ³¹. There is a loss-of-function mutation of MIB1 found in patients with bicuspid aortic valve in which there is a stop codon at position 1001 that truncates the last six residues of the protein, suggesting that the C-terminal tail of MIB1 is also needed for its function ³⁹. Consistent with the notion that RING domain dimerization provides contacts from MIB1 to bound ubiquitin in trans, an I974E mutation that disrupts the dimerization interface within the RING domain completely abrogated activity in both in vitro ubiquitination assays and cell-based assays of signaling. In contrast, an I957E mutation, which prevents dimerization of the isolated ccRING3 domain by disrupting the coiled coil, retains a small but measurable amount of ubiquitination activity in vitro and signaling activity in cells. On the one hand, it is possible that the MIB1 RING domain in I957E retains sufficient binding affinity for E2~Ub as a monomer to retain residual ubiquitination activity. Conversely, it may be that this mutant is still weakly capable of dimerizing when in the presence of E2~Ub, accounting for its residual ubiquitination activity.

The contributions of the ANK domain and the other two RING domains in the function of MIB as a potentiator of Notch ligands, however, have been less clear. Work in flies showed that deletion of all three RING domains had dominant negative activity in Notch signaling like that seen when only RING3 was deleted, and forced expression of a variant containing only the ANK and RING domains did not show a phenotype in the same assay.³⁷ Others also showed that proteins lacking only MZM/REP or the ANK domains had strong autoubiquitination activity, whereas deletion of RING3 or all three RING domains suppressed ubiquitination of Delta in cellular assays.^12,37,38

Our studies with purified proteins showed that the ccRING3 region of MIB1 was absolutely required for E3 ligase activity when UbcH5B is used as an E2 subunit. In contrast, there was no detectable ubiquitination activity in proteins that include RING1 and RING2 but lack ccRING3. Moreover, a MIB1 deletant lacking RING1 and RING2 was completely able to substitute for wild type MIB1 in enabling DLL4 to stimulate Notch reporter activity in a cellular co-culture assay, establishing that RING1 and RING2 are not required for MIB1 function in Notch signal induction.

Most strikingly, deletion of roughly half of the protein, including the removal of the ANK, RING1, and RING2 domains, had no appreciable effect on the ability of MIB1 to support the activity of DLL4 as a functional Notch ligand in a co-culture assay. This finding established that the minimal elements required to potentiate DLL4 as a Notch ligand were the MZM-REP region and the ccRING3 domain, connected by a flexible tether, which approaches the activity of the full-length protein in JAG1 ubiquitination assays, Notch signaling assays and in vivo in flies (Figure 6). The dispensability of the ANK, RING1 and RING2 domains was unexpected because these domains are conserved in all metazoan MIB proteins. Moreover, the high conservation of the concave surface of the ANK domain suggests that it serves as a binding interface for a partner protein to execute one of its biological functions. For example, it is possible that the ANK domain (as well as the RNIG1 and RING2 domains) is required for other cellular roles of MIB1, such as centriolar satellite formation or internalization of the RYK tyrosine kinase. Although the Ryk binding region of MIB1 has been mapped to the N-terminus and depletion of Ryk protein is blocked by a RING3 point mutation or by deletion of all three RING domains, it is not clear whether Ryk depletion activity also depends on the ANK, RING1, or RING2 domains.²⁵

Fig. 6. Schematic models of MIB1 (top) and Mini-MIB1 (bottom) ligase complexes.

The N-terminal MZM-REP region of MIB1 recognizes a NOTCH ligand (e.g. JAG1 or DLL4), and the ccRING3 domain engages UbcH5B-Ub to promote ubiquitin (Ub) transfer. The linkers connecting MZM-REP to ANK and ANK to the RING1–2 region are flexible (schematically illustrated by lighter shading of domains and arrows to indicate movement) and not required for the signal activation function of NOTCH ligands.

Lastly, the signaling assays in this study were performed with DLL4, whereas ubiquitin transfer assays to probe the ubiquitination activity of Mini-MIB1/22 were carried out with a JAG1 substrate, suggesting that the minimal requirements for MIB1 functional activity are similar for both classes of Notch ligands. Moreover, Mini-MIB1/22 results in near-complete rescue of mib1 loss-of-function phenotypes in flies, which have both Delta and Serrate, homologs of mammalian Delta-like and Jagged proteins. Together, these results strongly argue that MIB1 structure-function relationships are broadly conserved across species and generally apply to both Delta-like and Jagged as substrates.

STAR Methods

RESOURCE AVAILABILITY

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Stephen C. Blacklow (stephen_blacklow@hms.harvard.edu).

Materials availability

• Plasmids, cell lines, and fly stocks generated in this study are available upon request.

Data and code availability

• Atomic coordinates and structure factors have been deposited in the RCSB Protein Data Bank (PDB) under the accession numbers 8V0D (UbcH5B-ccRING3) and 8V0E (Ank repeats) and are publicly available as of the date of publication. These accession numbers are also listed in the key resources table. Original Western Blot images, raw flow cytometry files and raw luciferase reporter data are available upon request.

• This paper does not report original code.

• Any additional information required to reanalyze the data reported in this work is available from the Lead Contact upon request.

Key Resources Table

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
anti-MIB1 (N-terminal)	Abcam	Cat# ab124929, RRID:AB_11127834
anti-GAPDH	Cell Signaling Technology	Cat# 2118, RRID:AB_561053
anti-Ub	Santa Cruz Biotechnology	Cat# sc-8017, RRID:AB_2762364
anti-Flag	Millipore Sigma	Cat# F1804-50UG
IRDye 800CW Donkey anti-Rabbit	LI-COR Biosciences	Cat# 926-32213, RRID:AB_621848
IRDye 680RD Goat anti-Mouse	LI-COR Biosciences	Cat#926-68070, RRID:AB_10956588
Mouse anti-Wg 4D4 antibody	Developmental studies Hybridoma Bank.	Antibody Registry ID: AB_528512, RRID: N/A
Bacterial and virus strains
BL21(DE3)	New England Biolabs (NEB)	Cat# C2527H
Stellar competent cells	Takara Bio	Cat# 636766
Chemicals, peptides, and recombinant proteins
FBS	GeminiBio	Cat# 100-106
Penicillin and streptomycin	ThermoFisher Scientific	Cat# 15140163
Trypsin/0.53 mM EDTA in HBSS	Corning	Cat# 25-051-CI
DMEM	Corning	Cat# 10-017-CV
DPBS	Corning	Cat# 21-031-CV
NaCl	VWR	Cat# 0241-10KG
Glycerol	americanbio	Cat# AB00751-04000
HEPES	Sigma-Aldrich	Cat# H4034-1KG
Trizma base	Sigma-Aldrich	Cat# T1503-5KG
Glycine	Sigma-Aldrich	Cat# G7126-5KG
β−Mercaptoethanol	Sigma-Aldrich	Cat# M6250-250ML
SDS	Sigma	Cat# 75746-1KG
Methanol	VWR	Cat# BDH2018-1GLP
Tween-20	Sigma	Cat# P7949-500ML
DMSO	Sigma-Aldrich	Cat# D2650
Polyplus-transfection FectoPRO®	VWR	Cat#10118-842
Valproic acid sodium salt	Sigma-Aldrich	P4543-100G
D-(+)-Glucose solution	Sigma-Aldrich	G8769-100ML
Tacsimate - 100% solution pH 6.0	Hampton Research	HR2-827
PEG3350 50%	Hampton Research	HR2-527
Sodium acetate trihydrate pH 4.6 Buffer	Hampton Research	HR2-731
2.0 M Ammonium tartrate dibasic	Hampton Research	HR2-679
Expi293 expression medium	ThermoFisher	Cat # A1435103
HisPur Ni-NTA resin	ThermoFisher	Cat # 88222
Pierce™ Glutathione Agarose	Thermo Scientific	Cat # PI16101
3C protease recombinant protein	Produced in-house	N/A
ULP1 protease	Produced in-house	N/A
Anti-Flag resin	Produced in-house	N/A
E1 enzyme (Ube1)	Produced in-house	N/A
UbcH5B protein	Produced in-house	N/A
Ubiquitin protein	Produced in-house	N/A
Critical commercial assays
QIAprep Spin Miniprep Kit	Qiagen	Cat# 27106
PureLink™ HiPure Plasmid Filter Maxiprep Kit	Invitrogen	Cat# K210016
Dual-Luciferase Reporter Assay System	Promega	Cat# E1910
Lipofectamine™ 2000	ThermoFisher Scientific	Cat# 11668019
Deposited data
UbcH5B-ccRING3 structure coordinates	This paper	PDB: 8V0D
ANK repeats structure coordinates	This paper	PDB: 8V0E
Experimental models: cell lines
Human: U2OS cells	ATCC	Cat# HTB-96, RRID: CVCL_0042
Human: U2OS Mib1 KO cells	This paper	N/A
Human: Expi293F cells	ThermoFisher	Cat # A14527
Drosophila: mib1EY09870	Lai et al.37	N/A
Oligonucleotides
sgRNA (MIB1ko): 5’-CACCGTGCCAACTACCGCTGCTCCG-3’	This paper	N/A
sgRNA (MIB1ko): 5’-AAACCGGAGCAGCGGTAGTTGGCAC-3’	This paper	N/A
NotI-V5-4xG-hMIB1-for (Fly, MIB1 and mini-MIB1): 5’-GATCTgcggccATGATCCCTAACCCTCTCCTCGGTCTCGATggcggcggcggcagtaactcccggaataacc-3’	This paper	N/A
NotI--Myc-4xG-hMIB1-for (Fly, MIB1 and mini-MIB1): 5’-GCgcggccGCGGAGTGGTAAAATGgaacaaaaacttattagcgaagaagatcttggcgggggcgggagtaactcccggaataaccg-3’	This paper	N/A
hMIB1-XhoI-rev (Fly, MIB1 and minni-MIB1) ccttcacaaagatcctctagaggtaccctcgagctaatacaaaagaatccttcg	This paper	N/A
SDM hMIB1 I974E for: (Fly, I974E point mutant in mini-MIB1 gaagaatatgGAGTTCCTTTGTGGTCACGGAACC	This paper	N/A
SDM hMIB1-I974E rev: (Fly, I974E point mutant in mini-MIB1) AGACGATCTAGACACACagg	This paper	N/A
Recombinant DNA
pcDNA3.1/Hygro(+)	pcDNA3.1/Hygro(+)	Cat # V87020
mMib1-Flag	Addgene	Cat #37116
Software and algorithms
Phenix	Adams, P. D. et al.44	https://sbgrid.org/software/
Coot	Emsley, P. & Cowtan, K.43	https://sbgrid.org/software/
HKL2000	Otwinowski, Z. & Minor, W.45	https://sbgrid.org/software/
PDB validation server	World Wide Protein Data Bank	https://www.wwpdb.org/
GraphPad Prism	GraphPad	RRID:SCR_002798

EXPERIMENTAL MODEL AND STUDY PARTICIPANT DETAILS

Protein for crystallography was isolated from E. coli BL21(DE3) cells and protein for in vitro ubiquitination assay were from both E. coli BL21(DE3) cells and conditioned media of Expi293F cells. Expi293 cells were maintained in suspension at 37 °C in Expi293 expression medium (ThermoFisher). U2OS osteosarcoma (sex: female; RRID: CVCL_0042) cell line was cultured at 37°C and 5% CO₂ in DMEM supplemented with 10% heat inactivated fetal bovine serum (FBS, GeminiBio, 100–106) and 100 U/ml penicillin and streptomycin (ThermoFisher Scientific, 15140163) unless otherwise specified. All cell lines were periodically tested for mycoplasma by PCR. Cells were detached from plates after a PBS rinse using 0.05% Trypsin/0.53 mM EDTA in HBSS (Corning) for 5–10 min at 37°C unless otherwise specified. Fly stocks were mib1^{EY09870 36,37}, and tub-MIB1, tub-Mini-MIB1, tub-Mini-MIB1^I974E inserted in attP 22A ⁴⁰, generated in this work.

METHOD DETAILS

Plasmid construction.

ANK-RING1–3 (residues 417–1006) of hMIB1 was cloned into a derivative of pGex-6p-1 called pGood6p⁴¹, with an N-terminal GST tag followed by a 3C cleavage site. RING1–3 (residues 813–1006), RING1–2 (residues 813–919), ccRING3 (residues 936–1006) were cloned into the ptd68 vector with an N-terminal HIS-SUMO tag. ANK-RING1–2 (residues 409–919), ANK (residues 409–794) and UbcH5B-GSlinker-ccRING3 were cloned into a pET-21a vector with an N-terminal His tag followed by a 3C cleavage site. Full length human MIB1 was cloned into a pcDNA3.1/hygro(+) vector with an N-terminal Flag tag. The mutations of full length MIB1 were made using site-directed mutagenesis. All MIB1 domain truncations were generated using overlap PCR. mMib1-Flag was purchased from Addgene (catalog #37116).

Protein expression and purification.

Recombinant ANK, ANK-RING1–2, ANK-RING1–3, RING1–3, RING1–2, ccRING3, and UbcH5B-GSlinker-ccRING3 proteins were produced in E. coli BL21(DE3) cells. Expression was induced with 0.2 mM isopropyl-1-thio-D-galactopyranoside (IPTG), and cells were grown overnight at 16°C. 100 μM ZnCl2 was added at the time of induction when at least one RING domain was present in the expressed construct. Cells were harvested by centrifugation and resuspended in lysis buffer. For cells expressing His-tagged proteins, the lysis buffer was 20 mM Tris HCl, pH 7.6, containing 150 mM NaCl, 20 mM Imidazole, and 2 mM TCEP. For cells expressing proteins that were not His-tagged, the lysis buffer was 20 mM Tris HCl, pH 7.6, containing 150 mM NaCl, and 2 mM TCEP (without Imidazole). After cells were lysed by sonication, the lysate was centrifuged to remove cell debris, and the supernatant was collected. Recombinant His-tagged proteins were affinity purified using Ni-NTA beads and GST-tagged proteins were affinity purified using glutathione beads. Each affinity captured protein was washed with 20 column volumes of lysis buffer before proteolytically releasing the tag by on-column cleavage. His-SUMO tagged proteins were released with ULP1 protease; GST-tagged and His-tagged proteins were released using 3C protease. The released MIB1 proteins were recovered, and further purified on a size exclusion column (Superdex 200 10/300 GL or Superdex 75 10/300 GL, depending on the construct) in 20 mM Tris HCl buffer, pH 7.6, containing 100 mM NaCl, and 2 mM TCEP.

Expression of the JAG1 cytoplasmic tail in BL21(DE3) cells was performed by induction with 1 mM IPTG at 37° C for 3 h, as described ¹⁷. The protein was affinity purified using Ni-NTA beads and tisolated as a single band on SDS-PAGE by passage over Superdex 75 10/300 GL in 25 mM HEPES pH 7.8, 500 mM NaCl, and 1 mM TCEP.

Full length human MIB1 WT, I957E, I974E proteins and murine MIB1 protein were expressed in Expi293F cells. Cells were grown in Expi293 media to a density of 3 × 10⁶ cells/ml and then transfected with 1.0 mg DNA/L of culture using the FectroPro transfection reagent (Polyplus) at a 1:1 DNA/FectroPro ratio. 24 hours after transfection, 45% D-(+)-Glucose solution (Sigma-Aldrich, 10 mL per L of culture) and 3 mM valproic acid sodium salt (Sigma-Aldrich) were added to the cells to enhance protein expression. The cells were cultured for an additional 24 hours before harvesting by centrifugation. Cells were then resuspended in lysis buffer. For hMIB1 and mutants, the lysis buffer was 20 mM HEPES pH 7.5, containing 500 mM NaCl, 10% Glycerol, 0.02% Tween 20, and 2 mM TCEP. For mMIB1, the lysis buffer was 20 mM HEPES pH 7.5, containing 500 mM NaCl, 10% Glucose, 100 mM L-Arginine, 10 μM ZnCl2, and 0.5 mM TCEP. After sonication, the lysate was centrifuged to remove cell debris, and the supernatant was collected. Recombinant Flag-tagged proteins were affinity purified using anti-Flag resin, washed with 20 column volumes of lysis buffer, and eluted with lysis buffer containing Flag peptide (0.2 mg/mL). Eluted WT and mutant MIB1 proteins were concentrated and used in the ubiquitination activity assay. mMIB1 was concentrated and further purified using Superdex 6 10/300 GL in 20 mM HEPES pH 7.5, containing 500 mM NaCl, 10% Glucose, 100 mM L-Arginine, 10 μM ZnCl2, and 0.5 mM TCEP. Protein purity was assessed by SDS-PAGE followed by Coomassie blue staining. Protein concentrations were determined by UV absorbance at 280 nm.

Crystallization, data collection and structure determination.

UbcH5B-GSlinker-ccRING3 was concentrated to 20 mg/ml in 20 mM Tris HCl, pH 7.6 buffer containing 100 mM NaCl, and 2 mM TCEP. Crystals were grown in sitting drops at 18°C by mixing equal volumes of protein and a reservoir solution containing 4% (v/v) Tacsimate pH 6.0, and 12% (w/v) polyethylene glycol 3,350. Microseeding was then performed to optimize growth of single crystals. Crystals were cryoprotected in reservoir solution supplemented with 25% (v/v) glycerol, and flash frozen in liquid nitrogen for shipment and data collection at Advanced Photon Source NE-CAT beamlines 24 ID-C and ID-E. UbcH5B (PDB ID code: 2ESK) and an AlphaFold predicted⁴² ccRING3 model were used as search models for molecular replacement in Phaser.⁴³ Model building and refinement were carried out with the programs COOT⁴⁴ and PHENIX.⁴⁵ Data collection and structural refinement statistics are reported in Table S1.

ANK was concentrated to 15 mg/mL in 20 mM Tris HCl, pH 7.6 buffer containing 100 mM NaCl, and 2 mM TCEP. Crystals were grown in sitting drops at 18° C by mixing equal volumes of protein and a reservoir solution containing 0.1 M Sodium acetate trihydrate, and 1.0 M Ammonium tartrate (dibasic) at pH 4.6. Crystals were cryoprotected in reservoir solution supplemented with 25% (v/v) glycerol, and flash frozen in liquid nitrogen for shipment and data collection at Advanced Photon Source NE-CAT beamlines 24 ID-C and ID-E. Diffraction images were indexed, integrated, and merged using HKL2000.⁴⁶ The phase was determined using the ankyrin domain of a DARPIN-erythropoetin receptor complex (PDB ID code:6MOL) as a search model for molecular replacement in Phaser.⁴³ Model building and refinement were carried out with the programs COOT⁴⁴ and PHENIX.⁴⁵ Data collection and structural refinement statistics are reported in Table S2.

Negative-stain electron microscopy.

Carbon-coated copper grids (Electron Microscopy Sciences, #CF400-Cu) were glow discharged at 30 mA for 30 s. A 4 μL aliquot of a mMIB1 full length sample (0.02 mg/mL) was applied to the grid. After incubating for 1 min, the grid was washed twice with 1.5% Uranyl formate followed by staining with 1.5% Uranyl formate for 2 min. The grids were imaged using a 120 kV Tecnai T12 (Thermo Fisher Scientific) microscope. Images were recorded using an Ultrascan 895 CCD camera (Gatan).

In vitro Ubiquitination assays.

Self-ubiquitination or Jag1 ubiquitination was performed by mixing E1 enzyme (50 nM), UbcH5B (500 nM), a MIB1 variant (1 μM), and Ubiquitin (5 μM) without/with Jag1 (1 μM) in a reaction buffer containing 25 mM HEPES pH 7.5, 100 mM NaCl, 5 mM MgCl2, 5 mM ATP, and 2 mM TCEP at 37°C for 3 h. SDS-loading buffer was added directly to each tube to terminate the reaction. 10 μL of each sample was subjected to SDS-PAGE and analyzed by staining with Coomassie blue dye. Duplicate samples (0.5 μL) were subjected to SDS-PAGE and analyzed by western blot with an anti-Ubiquitin antibody (Santa Cruz Biotechnology, sc-8017). When using full length MIB1 protein, a western blot with anti-MIB1 (Abcam, ab124929) antibody was also used to analyze the ubiquitin reaction.

Generation of cells: CRISPR/Cas9 Knockout of MIB1 in U2OS cells.

sgRNA sequences targeting bp 171–193 in the first exon of human MIB1 were designed using the chopchop online tool (https://chopchop.cbu.uib.no) and subcloned into the plasmid vector PX458. The forward sgRNA sequence was 5’-CACCGTGCCAACTACCGCTGCTCCG-3’ and the sequence for the reverse sgRNA was 5’-AAACCGGAGCAGCGGTAGTTGGCAC-3’. U2OS cells were transfected in 6-well plates with 4 μg sgRNA-PX458 and 10 μL lipofectamine. 48 hours after transfection, single GFP-positive cells were sorted by FACS. Each clone was grown until it was confluent on a 10 cm dish. MIB1 knockout was confirmed by TOPO cloning of the amplified genomic sequence and by the loss of MIB1 signal on western blot with antibodies for the N-terminal portions of MIB1 (Abcam, ab124929).

Co-culture luciferase reporter assays using lentivirus transduction of MIB1.

Wild-type DLL4 and wild-type or mutated forms of MIB1 were introduced into MIB1 knockout U2OS cells using lentiviral transduction in order to test the activities of different MIB1 variants in reporter gene activity assays. MIB1 and DLL4 proteins were inserted into the vector pLVX. All MIB1 variants were fused to mNeonGreen at their N-termini and DLL4 was tagged with mTurquoise2 at its C-terminus. Receiver (Notch-expressing) cells were U2OS-Notch1-Gal4 cells⁴⁷. All cells were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) and grown in an environment of 5% CO2 at 37°C. Receiver cells were transfected (Lipofectamine 3000) with a UAS-firefly luciferase reporter (350 ng) and pRL-SV40 Renilla luciferase (10 ng), in addition to a H2B-Cerulean plasmid (10 ng) to test transfection efficiency. Receiver cells were transferred onto plates containing the sender cells 24 h after transfection. Cells were lysed 24 h after the start of co-culture. Firefly and Renilla luciferase activities were measured using a luminometer (Promega GloMax(R) Navigator with Dual Injectors). Relative Notch activity was calculated from the ratio of luciferase to Renilla signal, normalizing to the value for MIB1 knockout sender cells lentivirally transduced with wild-type DLL4 and MIB1.

Co-culture luciferase reporter assays using transient transfection of MIB1.

To create a U2OS Mib1^−/− cell line stably expressing DLL4-mCherry, a pcDNA5.1 plasmid for expression of DLL4-mCherry (0.5 μg plasmid) was transfected into U2OS Mib1^−/− cells in a 6-well plate (using lipofectamine 2000 (2.5 μL). The mCherry positive cells (high signal) were sorted by FACS 48 h after transfection. Cells were then selected with hygromycin (150 μg/ml), and were maintained under antibiotic selection by weekly addition of fresh antibiotic. Receiver (Notch-expressing) cells were U2OS-Notch1-Gal4 cells⁴⁷. To assess signaling activity of MIB1 variants, 0.1×10⁶ U2OS Notch1-Gal4 receiver cells were seeded in 24-well plates in DMEM with 10% FBS. Separately, 0.12×10⁶ U2OS Mib1^−/− cells were seeded in 24-well plates in DMEM with 10% FBS. The following day, the U2OS Mib1^−/− cells were transfected with different amounts of wild-type or mutant MIB1 plasmid (1,10, 50, 100, 200, or 400 ng), or with 400 ng empty vector, using lipofectamine 2000 (1 μL). The Notch1-Gal4 receiver cells were transfected with 490 ng UAS-firefly luciferase and 10 ng Renilla reporter plasmids that same day using lipofectamine 2000 (1.5 μL). 48 h after transfection, expression of Notch1-Gal4 in the receiver cells was induced by media replacement containing Doxycycline (1 μg/mL). The transfected sender cells recovered from the plate using trypsin and overlayed onto the U2OS Notch1-Gal4 receiver cells to initiate co-culture. 24 h after initiation of the co-culture, luciferase activity was read using a Promega Dual Luciferase Reporter Assay System kit (cat #: E1910). Cells were also collected for analysis of MIB1 protein amounts by Western blot as described above.

Flow cytometry.

The amount of expressed mNeonGreen-MIB1 was analyzed by flow cytometry for each stably transfected MIB1 variant and the amount of expressed Dll4- mTurquoise2 was analyzed for stably expressed Dll4-mTurquoise2 in parental and MIB1^−/− U2OS cells. Cells were harvested from tissue culture plates with trypsin/EDTA in phosphate buffered saline containing fetal bovine serum (1% v/v). All analyses were performed on the same day with the same parameters, using a 488 nm (mNeonGreen) or 450 nm (mTurquoise2) laser on a CytoFLEX S Flow Cytometer (Beckman Instruments).

In vivo studies.

Fly stocks were mib1^{EY09870 36,37}, and tub-MIB1, tub-Mini-MIB1, tub-Mini-MIB1^I974E inserted in attP 22A ⁴⁰, generated in this work.

Generation of MIB1 constructs.

The MIB1 and Mini-MIB1/22 constructs were subcloned from a pcDNA vector into the Drosophila expression vector pattB. To ensure ubiquitous expression, the promoter of αTubulin from Drosophila was cloned from pCaSpeR-tubP and the 3’UTR of SV40 was cloned from a pUAStattB vector (RRID:DGRC_1419) to promote efficient termination of transcription. The variant Mini-MIB1/22^I974E was generated from Mini-MIB1/22 using the site directed mutagenesis kit from New England Biolabs. All constructs were injected into embryos bearing an attP landing site at position 22A on the second chromosome as described in ⁴⁰.

Primers used were:

NotI-V5-4xG-hMIB1-for GATCTgcggccATGATCCCTAACCCTCTCCTCGGTCTCGATggcggcggcggcagtaactcccggaataacc NotI--Myc-4xG-hMIB1-for GCgcggccGCGGAGTGGTAAAATGgaacaaaaacttattagcgaagaagatcttggcgggggcgggagtaactcccggaataaccg hMIB1-XhoI-rev ccttcacaaagatcctctagaggtaccctcgagctaatacaaaagaatccttcg SDM hMIB1 I974E for gaagaatatgGAGTTCCTTTGTGGTCACGGAACC SDM hMIB1-I974E rev AGACGATCTAGACACACagg

Antibody staining and imaging of flies.

Antibody staining was performed according to Klein ⁴⁸. The mouse anti-Wg 4D4 antibody (1:250) was purchased from the Developmental studies Hybridoma Bank. Alexa-Fluorochrome-conjugated secondary antibodies were purchased from Invitrogen/Molecular Probes. Images were acquired with a Zeiss AxioImager Z1 Microscope equipped with a Zeiss Apotome2. Adult wings and legs were mounted in Hoyers medium and images were acquired with a Zeiss Axiophot microscope, equipped with a Zeiss MRC digital camera.

QUANTIFICATION AND STATISTICAL ANALYSIS

Statistical analysis was performed using GraphPad Prism version 10 (GraphPad). Statistical details are indicated in the figure legend along with the value of n. Sample distribution and normality tests were performed for the data set and significance was determined using a one sample Wilcoxon signed rank test.

Crystallographic data collection and refinement statistics are shown in Tables S1 and S2.

Highlights.

• Crystal structure of a UbcH5B complex with the ccRING3 region of MIB1 was determined

• Conformational heterogeneity of full-length MIB1 dimers was observed

• Mini-MIB1 was engineered by directly tethering the ligand-binding region to ccRING3

• Mini-MIB1 is functional in ubiquitination, signaling assays, and flies