Skip to main content
PLOS One logoLink to PLOS One
. 2025 Nov 7;20(11):e0335898. doi: 10.1371/journal.pone.0335898

Efficient DNA extraction from cytogenetic suspensions: A new possibility for obtaining DNA, with potential applications in studies of molecular markers

Geórgia Liz Monteiro Sant’ana-Arruda 1,#, Paulo Cesar Venere 1,2,#, Daniela Cristina Ferreira 2,*
Editor: Windsor E Aguirre3
PMCID: PMC12594425  PMID: 41202045

Abstract

The present study demonstrates the viability of extracting DNA for genomic analyses from cell suspensions prepared for cytogenetic analyses, specifically, samples fixed in Carnoy’s solution (3:1 methanol: acetic acid) and stored at –20 °C for more than 10 years. Cell suspensions from 27 specimens of fish of the subfamily Loricariinae, which had been prepared originally for cytogenetic studies, were used to test a DNA extraction procedure based on a routinely-used protocol with specific minor adjustments. The spectrophotometric and electrophoretic analyses of the extracted samples revealed DNA at good concentrations (5.9–1739 ng.μL-1) and high purity (A260/A280 ratios of 1.75–2.07), indicating negligible contamination and no significant fragmentation. The integrity of the material was confirmed by the successful amplification by PCR of four different genes (COI, 5S, 18S, and RAG2), with the COI gene being sequenced efficiently. These results demonstrate that DNA can be extracted from samples collected for other purposes, even after long-term storage, producing high-quality genomic DNA from sources that might otherwise be overlooked. The exploitation of these samples as a source of DNA represents a useful potential strategy for the acquisition of material for analysis when fresh samples are scarce or difficult to obtain. This novel approach expands considerably the possibilities for retrospective molecular studies, especially in the fields of conservation and systematics.

Introduction

The development of fast, efficient, and low-cost protocols for the extraction of DNA from different types of materials is fundamental to the advancement of molecular biology. Various cytological preparations originally intended for cytogenetic analyses—even those stored for extended periods—may represent an important source of DNA for genomic studies. In this context, the quality and the quantity of the DNA extracted from these sources can both have a direct influence on the eventual success of downstream applications, such as the in vitro amplification of specific genomic regions via Polymerase Chain Reaction (PCR) and enzymatic digestion [1,2]. A number of scientific fields depend on the efficient extraction of DNA for analysis, including molecular systematics, the identification of species, forensic medicine, criminal investigations, paternity testing, and the detection of tumor markers or infectious agents [3,4].

Most of the available protocols for the extraction of DNA, such as those described by Jobes et al. [5], Aljanabi and Martinez [1], and Cheng et al. [6], require tissue samples that have been stored in good conditions, and generally involve time-consuming processing procedures that have a high risk of degrading the DNA. The available commercial DNA extraction kits are also often either expensive or relatively difficult to obtain in developing countries [2]. In this context, the development of a simple, rapid, and low-cost protocol for the extraction of different types of DNA is not only essential for molecular studies, but is also highly desirable when large numbers of samples need to be processed [24].

Obtaining biological material for phylogenetic, systematic, or phylogeographic studies can be complex and costly, often leading to the exclusion of key species due to the lack of DNA samples [7]. These difficulties can be exacerbated by factors such as the intrinsic rarity of some species, the challenges of collecting specimens in remote and isolated areas, the need for specialized taxonomic knowledge for the accurate identification of specimens, and even the fact that some species are already extinct [8]. These challenges may be further accentuated by ongoing habitat degradation and the resulting loss of biodiversity [7].

Given these considerations, the present study describes a protocol for the extraction of DNA from samples obtained from fish for cytogenetic preparations, for which they were fixed in Carnoy’s solution (methanol and acetic acid at a ratio of 3:1) and stored at −20°C for more than 10 years. It is important to note here that the potential for the extraction of DNA from samples of cells stored for more than a decade paves the way to a vast reserve of material collected for a range of other, unrelated purposes. The extraction protocol described here expands significantly the diversity of potential sources for the extraction of DNA for molecular studies that would otherwise lack an adequate quantity of samples for analysis.

Materials and methods

Acquisition of the samples

The present study was based on the processing of a total of 27 cytogenetic suspensions extracted from fish specimens of the subfamily Loricariinae. These samples were initially collected for conventional chromosomal analyses, they were fixed in Carnoy’s solution (methanol and acetic acid at a ratio of 3:1) and were subsequently stored untouched in freezers (−20ºC) for more than 10 years. The chromosomal suspensions were prepared from kidney cells in 2010, following the protocols described by Bertollo et al. [9] and Foresti et al. [10]. The samples were then stored in the collections of the Research Group on the Fish of the Middle Araguaia Region (GEPEMA) and the Laboratory of Cytogenetics and Animal Genetics (LABGEN) at the Federal University of Mato Grosso in Cuiabá, Brazil.

Extraction of the DNA from cells fixed in Carnoy’s solution

The protocol described in this peer-reviewed article is published on protocols.io (https://dx.doi.org/10.17504/protocols.io.e6nvw4289lmk/v1) and is included for printing purposes as S1 File.

Cell suspensions prepared for cytogenetic analyses and stored at −20°C were vortexed for 10 seconds. A 150 μL aliquot of each sample was pipetted into a new, pre-labeled 1.5 mL microcentrifuge tube and centrifuged at 8,000 rpm for 10 minutes. After the supernatant was discarded, the tube was placed in an incubator at 37°C for 45 minutes, to ensure the complete evaporation of the fixative.

Subsequent DNA extraction steps followed the protocol of Aljanabi and Martinez [1] with the modifications detailed below. To begin with, 440 μL of extraction buffer was added to each tube. This buffer contained 8 mL of 5 M NaCl, 1 mL of 1 M Tris-HCl (pH 8.0), 400 μL of 0.5 M EDTA (pH 8.0), 20 mL of 10% SDS, and ultrapure water for a final volume of 100 mL. A further 16 μL of proteinase K (10 mg.mL-1) was also added to each tube at this stage. The contents of the tubes were then vortexed to ensure homogenization and incubated in a dry bath at 55°C for 1 hour and 30 minutes.

Subsequently, 300 μL of 5 M NaCl were added to each tube, followed by inversion and vortexing for 30 seconds. The samples were then centrifuged at 10,000 rpm for 10 minutes. An aliquot of 500 μL of the supernatant of each sample was then transferred to a new 1.5 mL microtube and mixed with 500 μL of ice-cold 100% isopropanol. The tubes were then inverted gently to precipitate the DNA, and centrifuged once again at 10,000 rpm for 10 minutes. The supernatant was discarded, and the resulting pellet was washed with 300 μL of ice-cold 70% ethanol, and then centrifuged 10,000 rpm for 5 minutes. The ethanol was discarded, and the DNA pellet was air-dried in an incubator at 37°C for one hour. In the final step, the DNA was resuspended in 30 μL of autoclaved ultrapure water.

Following extraction, the concentration and purity of the DNA were assessed using a spectrophotometer (DENOVIX), with the results being expressed in nanograms per microliter (ng.μL-1). The integrity of the DNA was then evaluated by electrophoresis in 1.5% agarose gel, using a horizontal electrophoresis system with 1 × TBE buffer. A 1 Kb molecular ladder (Kasvi) was included for reference. For the analysis of each sample, 2 μL of the extracted DNA were combined with 1 μL of GelRed™ fluorescent dye (20 × , Biotium) and 1 μL of Blue Juice loading dye. The samples were then electrophoresed at 120 volts and 240 milliamps for 30 minutes, and the DNA bands were visualized under an ultraviolet light using a Loccus Biotechnology photo-documentation system.

Evaluation of the Efficiency of the DNA Extraction Protocol by Polymerase Chain Reaction (PCR)

The efficiency of the extraction of the DNA obtained from the cytogenetic cell suspensions was assessed by amplifying four different genes by Polymerase Chain Reaction (PCR). These genes were the mitochondrial cytochrome oxidase subunit I (COI) and three nuclear markers, 5S rDNA, 18S rDNA, and RAG2 (Table 1). The PCRs were run in a final volume of 25 μL, containing: 17.9 μL of ultrapure water, 2.5 μL of 10 × buffer, 1.5 μL of dNTP mix (1.25 mM), 1 μL of MgCl₂ (50 mM), 0.5 μL of each primer, 0.1 μL of Taq DNA polymerase (Platinum®, Invitrogen; 5 U/μL), and 1 μL of the DNA template extracted from each sample. The samples were amplified in a Veriti® thermal cycler (Applied Biosystems) with the following cycling conditions: initial denaturation at 95°C for 3 minutes, followed by 35 cycles of denaturation at 95°C for 30 seconds, annealing at 50–55°C for 45 seconds, and extension at 72°C for 50 seconds, with a final extension at 72°C for 7 minutes.

Table 1. The genes and primer sequences used for the amplification of the samples analyzed in the present study, in the 5’ → 3’ direction.

Gene Primer Sequence Reference
COI FISH F1 TCAACCAACCACAAAGACATTGGCAC [11]
FISH R1 TAGACTTCTGGGTGGCCAAAGAATCA [11]
RAG2

1st PCR
164F AGCTCAAGCTGCGYGCCAT [12]
RAG2-R6 TGRTCCARGCAGAAGTACTTG [13]
RAG2

2nd PCR
176R GYGCCATCTCATTCTCCAACA [12]
RAG2 Ri AGAACAAAAGATCATTGCTGGTCGGG [12]
5S 5S-A TACGCCCGATCTCGTCCGATC [14]
5S-B CAGGCTGGTATGGCCGTAAGC [14]
18S NS1 GTAGTCATATGCTTGTCTC [15]
NS8 TCCGCAGGTTCACCTACGGA [15]

The PCR products were visualized by electrophoresis in 1.5% agarose gel, using the same protocol as that used for the assessment of the integrity of the DNA, except for the inclusion of a 100-bp molecular ladder, rather than a 1Kb reference marker. The samples were electrophoresed at for 40 minutes at 90 volts and 240 milliamps.

The mitochondrial cytochrome c oxidase subunit I (COI) gene was amplified from all 27 of the DNA samples extracted from the cytogenetic suspensions analyzed here. In the case of the nuclear markers, a test was done with a few samples just to check the efficiency of DNA extraction, for the ribosomal genes (5S and 18S rDNA) were each amplified from only two samples, while the Recombination-Activating Gene 2 (RAG2) was amplified from a single sample.

Results and discussion

The technique that was adapted here for the extraction of DNA from the cytogenetic preparations fixed in Carnoy’s solution yielded satisfactory results, with the extracted DNA being of good quality and available at high concentrations (Fig 1). The spectrophotometric readings indicated DNA concentrations ranging from 5.902 ng.µL-1 to 1739.05 ng.µL-1, with most samples in the range of less than 100 ng.µL-1 range (Table 2). The purity of the extracted DNA was confirmed by absorbance ratios (A260/A280) of 1.75–2.07 across all samples, indicating low protein contamination. Absorbance ratios of between 1.7 and 2.0 are generally considered to be adequate for analytical applications in molecular biology [16]. Regitano [17] also reported that ratios as low as 1.4 can be considered satisfactory for the extraction of DNA from fresh blood using the salting-out method described by Olerup & Zetterquist [18], which provides samples adequate for PCR amplification.

Fig 1. Electrophoretic gel showing the quality of the genomic DNA extracted from the samples (cytogenetic suspensions) processed in the present study.

Fig 1

The sample numbers correspond to those in Table 2. Electrophoresis was performed under constant voltage (120 V) for 30 minutes, using a 1 Kb DNA ladder as molecular size marker.

Table 2. Molecular data and BOLD Systems accession numbers for the analyzed specimens. Specimens marked with an * were not sequenced by Sanger.

Species Sample identification code DNA concentration A260/A280 Amplified genes Bold Systems access number (COI)
Rineloricaria parva LABGEN-8313 32.114 1.75 COI SUBLO026−25
Rineloricaria parva LABGEN-8315 97.353 1.89 COI SUBLO027−25
Rineloricaria parva LABGEN-8316 13.54 1.74 COI SUBLO028−25
Rineloricaria parva LABGEN-8333 31.283 1.99 COI SUBLO029−25
Rineloricaria lanceolata LABGEN-8635 24.553 2.07 COI SUBLO050−25
Rineloricaria lanceolata LABGEN-8636 47.309 1.72 COI SUBLO051−25
Loricaria cf. lata GEPEMA-4188 17.579 1.71 COI SUBLO044−25
Loricaria cf. lata GEPEMA-4189 210.515 1.82 COI SUBLO045−25
Loricaria cf. lata GEPEMA-4191 6.904 1.85 COI SUBLO053−25
Loricaria sp. 1 GEPEMA-4192 84.359 1.79 COI SUBLO018–25
Loricaria sp. 1 GEPEMA-4193 15.726 1.96 COI SUBLO019–25
Loricaria sp. 2 GEPEMA-4211 11.139 2.01 COI SUBLO020–25
Sturisoma ghazziae GEPEMA-4213 179.022 1.97 COI, RAG2 *
Spatuloricaria sp. 1 GEPEMA-4220 66.859 2.07 COI SUBLO034−25
Loricariichthys cf. nudirostris GEPEMA-4224 273.283 1.83 COI SUBLO046−25
Spatuloricaria sp. 1 GEPEMA-4310 1375.344 1.92 COI, 5S, 18S SUBLO035−25
Spatuloricaria sp. 1 GEPEMA-4311 770.557 1.79 COI SUBLO036−25
Loricaria sp. 3 GEPEMA-4314 419.127 1.81 COI SUBLO021–25
Spatuloricaria sp. 1 GEPEMA-4315 1739.05 1.91 COI SUBLO037−25
Spatuloricaria sp. 1 GEPEMA-4316 18.777 1.51 COI *
Sturisoma sp. 1 GEPEMA-4317 686.664 1.78 COI SUBLO052−25
Spatuloricaria sp. 1 GEPEMA-4318 97.248 1.87 COI SUBLO038−25
Loricaria sp. 3 GEPEMA-6513 17.432 1.91 COI SUBLO022–25
Rineloricaria sp. 2 GEPEMA-6864 5.902 1.82 COI SUBLO032−25
Spatuloricaria sp. GEPEMA-6865 58.686 1.86 COI, 5S, 18S SUBLO032−25
Spatuloricaria sp. 2 GEPEMA-6866 38.789 1.86 COI SUBLO033−25
Loricariichthys cf. nudirostris GEPEMA-6868 75.089 1.8 COI SUBLO023–25

The collection of high-quality genomic DNA is a fundamental and critical step in molecular biology, which can have a significant effect on the outcome of any subsequent analyses [2]. In particular, the extracted material should contain negligible amounts of proteins, RNA and any other substance that might inhibit the PCR, and the fragmentation of the DNA during the extraction process should be avoided as far as possible [19]. The quality and integrity of the DNA obtained here (Fig 1) indicate that these objectives were achieved effectively during the extraction process tested in the present study.

Appropriate procedures for the storage of the tissue are essential to prevent possible degradation and guarantee the extraction of stable DNA of good quality at high concentrations. Ideally, tissue samples should be preserved in absolute ethanol and stored at temperatures of between –20°C and –80°C to ensure the integrity of the DNA [20]. When material of this type is lacking, samples prepared for other purposes – such as the cytogenetic suspensions analyzed here – can possibly be used, depending on the availability of alternative methods for the extraction of the DNA. The results of the present study have shown that Carnoy’s solution, which contains methanol and acetic acid in the ratio of 3:1, preserves chromosomal structure without compromising the integrity of the DNA significantly. Cytogenetic suspensions fixed in Carnoy’s solution and stored at –20°C for over 10 years were successfully processed, demonstrating that this procedure can yield high-quality DNA for molecular analyses from alternative sources.

In order to assess more fully the integrity of the genomic DNA obtained using the new method, four genes targeted frequently in laboratory analyses – COI, 5S rDNA, 18S rDNA, and RAG2 – were amplified from the samples by PCR (Table 2). The PCRs were successful for all the primers tested (Fig 2), which indicates a lack of inhibitory substances in the extracted DNA. This confirms the viability and high quality of the DNA for use in molecular studies.

Fig 2. Electrophoretic gel showing the PCR products generated by the primers for the COI, 5S rDNA, 18S rDNA, and RAG2 genes, applied to DNA extracted from samples of cytogenetic suspension fixed in Carnoy’s solution.

Fig 2

The sample numbers correspond to those in Table 2. NC = Negative Control. Electrophoresis was performed at 90 V for 40 minutes, using a 100 bp DNA ladder as molecular size marker.

The PCR technique amplifies specific segments of the DNA, and supports a wide range of molecular studies, including the development of highly sensitive diagnostic methods, the production of DNA for sequencing, and the analysis of the genetic diversity in populations [20]. While the PCR is a relatively simple procedure, it depends on the adequate adjustment of DNA extraction protocols to ensure the availability of good quality DNA. In particular, the appropriate adjustment of the extraction parameters to obtain good-quality DNA from material processed originally for other purposes will be essential to ensure the availability of DNA of adequate quality for successful PCR amplifications [21].

Once amplified, the DNA extracted using the method described here was sequenced by the Sanger method. In the specific case of the COI gene, a 623 bp fragment was recovered, with quality scores of over 90% for all 27 samples, the sequences were previously deposited in BOLD (Table 2). This further highlights the effectiveness of the proposed DNA extraction method, and its suitability for a number of different areas of molecular biology.

Fixatives or certain types of preservatives can compromise the quality of the nucleic acids extracted from a sample, given the potential for chemical interactions [22]. However, the evidence presented here indicates that the use of Carnoy’s solution did not degrade the samples, which contained amplifiable DNA even after long-term storage.

Conclusions

The present study describes an alternative protocol for the extraction of samples of genomic DNA from stored cytogenetic suspensions fixed in Carnoy’s solution (three parts methanol to one part acetic acid). The protocol proved to be highly efficient, yielding extremely pure DNA at a satisfactory concentration, with results comparable with conventional methods used to extract DNA from muscle tissue. The proposed protocol therefore represents a viable alternative for obtaining high-quality DNA when fresh samples are scarce or difficult to collect, while also reducing cell lysis time. This makes the extraction process faster, more practical, and more cost-effective.

Supporting information

S1 File. Step-by-step protocol, also available on protocols.io.

(PDF)

pone.0335898.s001.pdf (3.5MB, pdf)
S1 images raw. Unedited images corresponding to Figs 1 and 2.

(PDF)

pone.0335898.s002.pdf (18.5MB, pdf)

Acknowledgments

The authors thank Prof. Dr. Marielle Cristina Schneider for her valuable contributions to the preparation of the manuscript.

Data Availability

All relevant data are within the manuscript and its Supporting Information files.

Funding Statement

This study was supported by Instituto Nacional de Ciência e Tecnologia (INCT-Peixes), funded by MCTIC/CNPq (proc. 405706/2022-7), Conselho Nacional de Desenvolvimento Científico e Tecnológico-CNPq (grant 421733/2017-9 to GLMSA; INAU II to PCV and DCF), and Fundação de Amparo a Pesquisa do Estado de Mato Grosso (PRO.000339/2023 to DCF). The funders had no role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Aljanabi SM, Martinez I. Universal and rapid salt-extraction of high quality genomic DNA for PCR-based techniques. Nucleic Acids Res. 1997;25(22):4692–3. doi: 10.1093/nar/25.22.4692 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Wang TY, Wang L, Zhang JH, Dong WH. A simplified universal genomic DNA extraction protocol suitable for PCR. Genet Mol Res. 2011;10(1):519–25. doi: 10.4238/vol10-1gmr1055 [DOI] [PubMed] [Google Scholar]
  • 3.Barea JA, Pardini MIMC, Gushiken T. Extração de DNA de materiais de arquivo e fontes escassas para utilização em reação de polimerização em cadeia (PCR). Rev Bras Hematol Hemoter. 2004;26(4). doi: 10.1590/s1516-84842004000400008 [DOI] [Google Scholar]
  • 4.Bueno V. DNA e aperfeiçoamento das técnicas de extração. Rev Bras Hematol Hemoter. 2004;26(4). doi: 10.1590/s1516-84842004000400001 [DOI] [Google Scholar]
  • 5.Jobes DV, Hurley DL, Thien LB. Plant DNA isolation: a method to efficiently remove polyphenolics, polysaccharides, and RNA. TAXON. 1995;44(3):379–86. doi: 10.2307/1223408 [DOI] [Google Scholar]
  • 6.Cheng Y-J, Guo W-W, Yi H-L, Pang X-M, Deng X. An efficient protocol for genomic DNA extraction fromCitrus species. Plant Mol Biol Rep. 2003;21(2):177–8. doi: 10.1007/bf02774246 [DOI] [Google Scholar]
  • 7.Schander C. DNA, PCR and formalinized animal tissue ? a short review and protocols. Organisms Diversity & Evolution. 2003;3(3):195–205. doi: 10.1078/1439-6092-00071 [DOI] [Google Scholar]
  • 8.Tin MM-Y, Economo EP, Mikheyev AS. Sequencing degraded DNA from non-destructively sampled museum specimens for RAD-tagging and low-coverage shotgun phylogenetics. PLoS One. 2014;9(5):e96793. doi: 10.1371/journal.pone.0096793 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Bertollo LAC, Takahashi CS, Moreira-Filho O. Cytotaxonomic considerations on Hoplias lacerdae (Pisces, Erythrinidae). Brazilian J Genetic. 1978;1:103–20. [Google Scholar]
  • 10.Foresti F, Oliveira C, Foresti de Almeida-Toledo L. A method for chromosome preparations from large fish specimens using in vitro short-term treatment with colchicine. Experientia. 1993;49(9):810–3. doi: 10.1007/bf01923555 [DOI] [Google Scholar]
  • 11.Ward RD, Zemlak TS, Innes BH, Last PR, Hebert PDN. DNA barcoding Australia’s fish species. Philos Trans R Soc Lond B Biol Sci. 2005;360(1462):1847–57. doi: 10.1098/rstb.2005.1716 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Oliveira C, Avelino GS, Abe KT, Mariguela TC, Benine RC, Ortí G, et al. Phylogenetic relationships within the speciose family Characidae (Teleostei: Ostariophysi: Characiformes) based on multilocus analysis and extensive ingroup sampling. BMC Evol Biol. 2011;11:275. doi: 10.1186/1471-2148-11-275 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Lovejoy NR, Collette BB. Phylogenetic relationships of new world needlefishes (Teleostei: Belonidae) and the biogeography of transitions between marine and freshwater habitats. Copeia. 2011;2011(1):324–38. [Google Scholar]
  • 14.Martins C, Galetti PM Jr. Chromosomal localization of 5S rDNA genes in Leporinus fish (Anostomidae, Characiformes). Chromosome Res. 1999;7(5):363–7. doi: 10.1023/a:1009216030316 [DOI] [PubMed] [Google Scholar]
  • 15.Black WC 4th, Klompen JS, Keirans JE. Phylogenetic relationships among tick subfamilies (Ixodida: Ixodidae: Argasidae) based on the 18S nuclear rDNA gene. Mol Phylogenet Evol. 1997;7(1):129–44. doi: 10.1006/mpev.1996.0382 [DOI] [PubMed] [Google Scholar]
  • 16.Green MR, Sambrook J. Isolation and Quantification of DNA. Cold Spring Harb Protoc. 2018;2018(6):10.1101/pdb.top093336. doi: 10.1101/pdb.top093336 [DOI] [PubMed] [Google Scholar]
  • 17.Regitano LCA. Extração de DNA para aplicação em reação em cadeia da polimerase (PCR). In: Regitano LCA, Coutinho LL, editors. Biologia molecular aplicada à produção animal. Brasília: Embrapa Informação Tecnológica. 2001. p. 0–215. [Google Scholar]
  • 18.Olerup O, Zetterquist H. HLA-DR typing by PCR amplification with sequence-specific primers (PCR-SSP) in 2 hours: an alternative to serological DR typing in clinical practice including donor-recipient matching in cadaveric transplantation. Tissue Antigens. 1992;39(5):225–35. doi: 10.1111/j.1399-0039.1992.tb01940.x [DOI] [PubMed] [Google Scholar]
  • 19.Chapela MJ, Sotelo CG, Pérez-Martín RI, Pardo MÁ, Pérez-Villareal B, Gilardi P, et al. Comparison of DNA extraction methods from muscle of canned tuna for species identification. Food Control. 2007;18(10):1211–5. doi: 10.1016/j.foodcont.2006.07.016 [DOI] [Google Scholar]
  • 20.Oliveira MCS, Regitano LCA, Roese AD, Anthonisen DG, Patrocínio E, Parma MM, et al. Fundamentos teórico-práticos e protocolos de extração e de amplificação de DNA por meio da técnica de reação em cadeia da polimerase. São Carlos: Embrapa Pecuária Sudeste; 2007. [Google Scholar]
  • 21.Araújo FR, Ramos CA do N, Luíz HL, Peres IAHFS, Oliveira RHM de, Souza IIF. Avaliação de um Protocolo de Extração de DNA Genômico a Partir de Sangue Total. 120. Campo Grande: Embrapa Gado de Corte. 2009. [Google Scholar]
  • 22.Hunt JL. Molecular pathology in anatomic pathology practice: a review of basic principles. Arch Pathol Lab Med. 2008;132(2):248–60. doi: 10.5858/2008-132-248-MPIAPP [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 File. Step-by-step protocol, also available on protocols.io.

(PDF)

pone.0335898.s001.pdf (3.5MB, pdf)
S1 images raw. Unedited images corresponding to Figs 1 and 2.

(PDF)

pone.0335898.s002.pdf (18.5MB, pdf)

Data Availability Statement

All relevant data are within the manuscript and its Supporting Information files.


Articles from PLOS One are provided here courtesy of PLOS

RESOURCES