Skip to main content
PLOS One logoLink to PLOS One
. 2011 Dec 28;6(12):e29200. doi: 10.1371/journal.pone.0029200

Enrichment of Variations in KIR3DL1/S1 and KIR2DL2/L3 among H1N1/09 ICU Patients: An Exploratory Study

David La 1, Chris Czarnecki 1, Hani El-Gabalawy 3, Anand Kumar 4, Adrienne F A Meyers 1,2, Nathalie Bastien 1, J Neil Simonsen 1, Francis A Plummer 1,2, Ma Luo 1,2,*
Editor: Johan K Sandberg5
PMCID: PMC3247251  PMID: 22216211

Abstract

Background

Infection by the pandemic influenza A (H1N1/09) virus resulted in significant pathology among specific ethnic groups worldwide. Natural Killer (NK) cells are important in early innate immune responses to viral infections. Activation of NK cells, in part, depend on killer-cell immunoglobulin-like receptors (KIR) and HLA class I ligand interactions. To study factors involved in NK cell dysfunction in overactive immune responses to H1N1 infection, KIR3DL1/S1 and KIR2DL2/L3 allotypes and cognate HLA ligands of H1N1/09 intensive-care unit (ICU) patients were determined.

Methodology and Findings

KIR3DL1/S1, KIR2DL2/L3, and HLA -B and -C of 51 H1N1/09 ICU patients and 105 H1N1-negative subjects (St. Theresa Point, Manitoba) were characterized. We detected an increase of 3DL1 ligand-negative pairs (3DL1/S1+ Bw6+ Bw4−), and a lack of 2DL1 HLA-C2 ligands, among ICU patients. They were also significantly enriched for 2DL2/L3 ligand-positive pairs (P<0.001, Pc<0.001; Odds Ratio:6.3158, CI95%:2.481–16.078). Relative to St. Theresa aboriginals (STh) and Venezuelan Amerindians (VA), allotypes enriched among aboriginal ICU patients (Ab) were: 2DL3 (Ab>VA, P = 0.024, Pc = 0.047; Odds Ratio:2.563, CI95%:1.109–5.923), 3DL1*00101 (Ab>VA, P<0.001, Pc<0.001), 3DL1*01502 (Ab>STh, P = 0.034, Pc = 0.268), and 3DL1*029 (Ab>STh, P  = 0.039, Pc = 0.301). Aboriginal patients ligand-positive for 3DL1/S1 and 2DL1 had the lowest probabilities of death (Rd) (Rd = 28%), compared to patients that were 3DL1/S1 ligand-negative (Rd = 52%) or carried 3DL1*029 (Rd = 52%). Relative to Caucasoids (CA), two allotypes were enriched among non-aboriginal ICU patients (NAb): 3DL1*00401 (NAb>CA, P<0.001, Pc<0.001) and 3DL1*01502 (CA<NAb, P = 0.012, Pc = 0.156). Non-aboriginal patients with ligands for all three KIRs (3DL1/S1, 2DL2/L3, and 2DL1) had the lowest probabilities of death (Rd = 36%), compared to subjects with 3DL1*01502 (Rd = 48%) and/or 3DL1*00401 (Rd = 58%).

Conclusions

Specific KIR3DL1/S1 allotypes, 3DL1/S1 and 2DL1 ligand-negative pairs, and 2DL2/L3 ligand-positive pairs were enriched among ICU patients. This suggests a possible association with NK cell dysfunction in patients with overactive immune responses to H1N1/09, leading to severe disease.

Introduction

The recent pandemic influenza A (H1N1/09) virus, relative to seasonal influenza, was observed to have higher transmissibility, albeit with lower mortality rates [1], [2]. Although there were more than 622,482 reported cases worldwide as of November 2009 [3], [4], overactive immune responses to H1N1/09 infections leading to significant pathology were reported to be highly prevalent among youths and young adults. Recently, the basis for this observation was suggested to be a lack of antigenic site recognition for the hemagglutinin structure among those age groups [5], [6]. Nonetheless, those of specific ethnic backgrounds were also observed to be disproportionately affected, namely aboriginal and minority groups [7]–[11]. Although the factors behind the disproportionate impact of H1N1/09 remain to be fully elucidated, there is some evidence to suggest a role for natural killer (NK) cells in the control of influenza viral loads.

The importance of NK cells was suggested in a recent study, where NK cell frequencies were found to be significantly reduced in patients with severe responses to H1N1/09 infections, relative to mild cases and healthy controls [12]. On the other hand, CD8+ effector T cells, regardless of patient disease status, were detected at normal levels. A study of NK cells in infected mice also showed that reduced NK cell activity in the earlier stages led to significantly increased viral growth [13].

NK cells function as the primary innate immune response against viruses and tumours and are capable of inducing stimulatory and regulatory effects on the adaptive immune response [14]–[16]. Their functions are determined by a broad array of activating and inhibitory receptors [17]. Killer-cell immunoglobulin-like receptors (KIR) are a large family of receptors comprised mainly of those with inhibitory capacities that recognize HLA Class I ligands [18], [19], along with a few variants that possess activating functions. In the context of all known KIR variants in humans, the KIR3DL1/S1 subset is widespread and encode for both an inhibitory (3DL1) and activating (3DS1) receptor [19]. KIR3DL1 receptors recognize class I HLA-B proteins that carry a Bw4 motif [20], while HLA-B Bw4-80I proteins are the putative ligands of KIR3DS1 [21]. Analogous inhibitory KIR subsets, such as KIR2DL1 and KIR2DL2/L3, recognize HLA-C2 and HLA-C1 ligands, respectively [22], [23]. Given the independent diversities of KIR and HLA, there likely exist combinations which can variably influence the efficacy of NK cell responses in the control of viral infections due to the presence of certain NK cell receptor/ligand pairs [24]–[26].

To date, there have been no published reports pertaining to KIR receptors and their ligands, in relation to NK cell dysfunction, in severe cases of H1N1/09 infections. Identification of potential associations of specific KIR allotypes and their ligands with severe responses to H1N1/09 infections may assist in the predetermination of populations most at risk via information on frequencies of molecular immune response allotypes. In this study, we compared H1N1/09 ICU patients with H1N1-negative subjects from St. Theresa Point and similar world populations. We investigated KIR3DL1/KIR3DS1 and KIR2DL2/KIR2DL3 in this study, as each pair share the same locus, encode for both inhibitory and/or activating receptors, and their HLA ligands are highly polymorphic [27].

Results

KIR3DL1/S1 allotype and KIR2DL2/L3 frequencies of H1N1/09 ICU patients

The KIR3DL1/S1 and KIR2DL2/L3 frequencies of ICU patients are summarized in Table 1. In total, fourteen 3DL1 and two 3DS1 allotypes were detected. 3DS1*01301 was the most prevalent (26.5%), followed by 3DL1*00101(15.7%), 3DL1*01502(15.7%), 3DL1*00401 (9.8%), and 3DL1*00501(8.8%). Three allotypes, 3DS1*01301, 3DL1*00101, and *01502, were found to account for 70% of allotypes among ICU patients of aboriginal descent (Ab). Greater diversity was found among patients of non-aboriginal descent (NAb), as five allotypes accounted for a combined frequency of 77%: 3DS1*01301, 3DL1*00401, *00101, *01502, *002.

Table 1. KIR3DL1/S1 allele frequencies of ICU patients and St. Theresa aboriginals.

ICU Patients, C
All (2n  =  102) Ab (2n = 40) NAb (2n = 62) STh (2n = 210) P (Pc)
KIR Allele 2n AF 2n AF 2n AF 2n AF Ab vs STh
3DL1*00101 16 15.7% 8 20.0% 8 12.9% 46 21.9% 0.486
3DL1*002 7 6.9% 0 0.0% 7 11.3% 1 0.5% 1.000
3DL1*00401 10 9.8% 0 0.0% 10 16.1% 0 0.0% -
3DL1*00402 2 2.0% 0 0.0% 2 3.3% 0 0.0% -
3DL1*00501 9 8.8% 3 7.5% 6 9.7% 38 18.1% 0.108
3DL1*007 4 3.9% 1 2.5% 3 4.8% 0 0.0% 0.163
3DL1*008 1 1.0% 0 0.0% 1 1.6% 0 0.0% -
3DL1*009 1 1.0% 0 0.0% 1 1.6% 0 0.0% -
3DL1*01501 0 0.0% 0 0.0% 0 0.0% 0 0.0% -
3DL1*01502 16 15.7% 8 20.0% 8 12.9% 16 7.6% 0.034 (0.268) 1
3DL1*019 0 0.0% 0 0.0% 0 0.0% 0 0.0% -
3DL1*020 1 1.0% 0 0.0% 1 1.6% 0 0.0% -
3DL1*029 4 3.9% 4 10.0% 0 0.0% 5 2.4% 0.039 (0.301) 2
3DL1*051 1 1.0% 1 2.5% 0 0.0% 1 0.5% 0.300
3DS1*010 3 2.9% 3 7.5% 0 0.0% 5 2.4% 0.119
3DS1*01301 27 26.5% 12 30.0% 15 24.2% 98 46.7% 0.055
3DL1 72 70.6% 25 62.5% 47 75.8% 107 51.0% 0.227
3DS1 30 29.4% 15 37.5% 15 24.2% 103 49.0%
2DL2 22 21.6% 7 17.5% 15 24.2% 31 14.8% 0.635
2DL3 80 78.4% 33 82.5% 47 75.8% 179 85.2%

AF, allele frequency; Ab, Aboriginal; NAb, Non-aboriginal.

STh, St. Theresa aboriginals; C, H1N1 confirmed cases.

1

Odds Ratio:3.031(CI95%:1.199–7.663);

2

Odds Ratio:4.556(CI95%:1.167–17.779).

KIR2DL2/L3 were detected in all patients, with a high number of patients carrying only 2DL3 allotypes (Ab, 70%; NAb, 54.8%). Patients with only 2DL2 were rare among both ICU subgroups (Ab, 5%; NAb, 3.2%). These results were consistent with another study on First Nations KIR gene profiles [28]. Differences in 2DL2/L3 distributions between Ab and St. Theresa Point (STh) subjects were not statistically significant.

Enrichment of KIR3DL1/S1 allotypes in H1N1/09 ICU patients of aboriginal descent

In order to further characterize the diversity and distribution of allotypes among Ab patients, we compared those with high frequencies to St. Theresa Point subjects. This was a viable group for comparison, as STh subjects were highly susceptible to severe responses during the first wave of the pandemic [29], [30]. Because aboriginal ICU patient samples were derived from hospitals across the country, they were assumed to be more ethnically diverse than St. Theresa aboriginals. This was confirmed when their distributions of HLA-B and C were compared.

Nine different allotypes were detected between Ab and STh (Table 1). 3DS1*01301 and 3DL1*00101 were especially widespread among both groups. Similar to Ab patients, a lack of diversity was detected among the STh subjects, as three allotypes (3DS1*01301, 3DL1*00101, and *00501) accounted for a combined frequency of 86.7%.

Prior to correction for multiple comparisons, two allotypes were found to be significantly enriched among Ab patients: 3DL1*01502 (Ab>STh, P = 0.034, Pc = 0.268; Odds Ratio:3.031, CI95%:1.199–7.663) and 3DL1*029 (Ab>STh, P = 0.039, Pc = 0.301; Odds Ratio:4.556, CI95%:1.167–17.779). 3DS1*010 was detected at a higher frequency in Ab patients, but the difference was not statistically significant (Ab>STh, P = 0.119).

Lack of KIR3DL1/S1 and HLA-B Bw4 ligand pairs in H1N1/09 ICU patients

In the absence of cognate ligands, the presence and function of KIR3DL1/S1 receptors are deemed negligible, due to their inability to elicit a relevant response within NK cells [18], [20], [21]. Subjects detected as KIR3DL1/S1+ HLA-B Bw6+ Bw4− were considered to be ligand-negative. To determine the relative degree of ligand-negative pairs present among ICU patients, we determined the prevalence of 3DL1/S1 and their cognate ligands (Bw4+), among the ICU patients and St. Theresa subjects. Overall, compared to STh subjects, 3DL1 ligand-negative pairs were found to be proportionally higher in H1N1/09 ICU patients (ICU>STh, P = 0.093) (Table 2), albeit not statistically different due to the small sample size. In contrast, 3DL1/S1-Bw4+ pairs were common among the healthy STh subjects (81%). Of the highly prevalent 3DL1/S1 allotypes that were common among both groups, the frequencies of several ligand-negative pairs (3DL1*00101, 3DL1*01502, 3DS1*010, and 3DS1*01301) were much higher among the H1N1/09 patient groups.

Table 2. Comparison of KIR3DL1/S1 allotypes in the presence or absence of their ligands within H1N1- confirmed ICU patients and St. Theresa aboriginals.

ICU patients, Confirmed
KIR Allele Ab Nab STh
3DL1*00101
Bw4+ 5 (71.4%) 5 (62.5%) 37 (86.0%)
Bw6+, Bw4− 2 (28.6%) 3 (37.5%) 6 (14.0%)
3DL1*002
Bw4+ 0 (0%) 4 (66.7%) 1 (100%)
Bw6+, Bw4− 0 (0%) 2 (33.3%) 0 (0%)
3DL1*00501
Bw4+ 2 (66.7%) 4 (66.7%) 25 (69.4%)
Bw6+, Bw4− 1 (33.3%) 2 (33.3%) 11 (30.6%)
3DL1*01502
Bw4+ 4 (57.1%) 5 (71.4%) 15 (93.7%)
Bw6+, Bw4− 3 (42.9%) 2 (28.6%) 1 (6.3%)
3DS1*10
Bw4+ 1 (33.3%) 0 (0%) 5 (100%)
Bw6+, Bw4− 2 (66.7%) 0 (0%) 0 (0%)
3DS1*01301
Bw4+ 9 (90.0%) 9 (75.0%) 56 (77.8%)
Bw6+, Bw4− 1 (10.0%) 3 (25.0%) 16 (22.2%)
3DL1
Bw4+ 13 (72.2%) 18 (64.3%) 63 (79.8%)
Bw6+, Bw4− 5 (27.8%) 10 (35.7%) 16 (20.3%)
3DS1
Bw4+ 10 (76.9%) 9 (75.0%) 61 (79.2%)
Bw6+, Bw4− 3 (23.1%) 3 (25.0%) 16 (20.8%)
3DL1*
Bw4+ 31 (67.4%) 85 (81.0%)
Bw6+, Bw4− 15 (32.6%) 20 (19.0%)
2DL2
C1+ 4 (66.7%) 14 (100%) 14 (45.2%)
C1−, C2+ 2 (33.3%) 0 (0%) 17 (54.8%)
2DL3
C1+ 13 (68.4%) 30(100%) 57 (54.3%)
C1−, C2+ 6 (31.6%) 0 (0%) 48 (45.7%)
2DL2/L3**
C1+ 45 (88.2%) 57 (54.3%)
C1−, C2+ 6 (11.8%) 48 (45.7%)

Ab, Aboriginal; NAb, Non-aboriginal; STh, St. Theresa aboriginals.

**P<0.001, Pc<0.001.

*P<0.10.

Enrichment of KIR2DL2/L3 and HLA-C C1 ligand pairs among H1N1/09 ICU patients

In order to further determine the frequency of other functional KIR allotype-ligand relationships, the distribution of KIR2DL2/L3 and HLA-C1/C2 were determined. Subjects with 2DL2/L3+ C1+ C2+/− were considered to be ligand-positive (Table 2). All NAb patients were ligand-positive. Compared to STh subjects, ligand-positive pairs were significantly higher in H1N1/09 ICU patients overall (P<0.001, Pc<0.001; Odds Ratio:6.3158, CI95%:2.481–16.078). Conversely, there was a significant lack of C2 allotypes (KIR2DL1 ligands) among NAb patients, as compared to both Ab and STh subjects (NAb (12.9%)<Ab (50.0%)<STh (68.1%), P NAbvsAb<0.001, Pc<0.001; P NAbvsSTh<0.001, Pc<0.001).

Comparison of KIR3DL1/S1 and KIR2DL2/L3 frequencies between H1N1/09 ICU subgroups and world populations

During the initial waves of the H1N1/09 pandemic, several populations were disproportionately affected by overactive immune responses to infections. We compared the frequencies of KIR3DL1/S1 allotypes enriched among the ICU subgroups (Ab and NAb) to that of analogous populations in the world; the Venezuelan Amerindians (VA) and Caucasoids (CA) of various countries [31]. The VA group consisted of three Amerindian tribes: the Yucpa, Bari, and Warao [32]. The CA group consisted mainly of six different populations: England, Georgia, Spain, Turkey, USA California, and USA European [33], [34].

The Amerindian tribes were similarly found to lack diversity in 3DL1/S1 and their most prevalent allotypes were 3DS1*01301, 3DL1*005, and *01502 (Table 1, 3). 3DL1*00101, common to both Ab and STh subjects, was absent in VA subjects (VA<Ab, P<0.001, Pc<0.001; Odds Ratio:infinite). In Ab patients, KIR2DL2 and KIR2DL3 allotypes were found to be significantly reduced and enriched, respectively, in comparison to VA subjects (Ab>VA, P = 0.024, Pc = 0.047; Odds Ratio:2.563, CI95%:1.109–5.923).

Table 3. Comparison of KIR3DL1/S1 allele frequencies between ICU patients and analogous world populations.

ICU Patients, C Ethnic Groups P (Pc)
KIR Allele Ab NAb Vaa , b Caa , c Ab vs VA NAb vs CA
3DL1*001 0.200 0.129 0.000± 0.162± <0.001 (<0.001) 1 0.603
3DL1*002 0.000 0.113 0.000 0.120 - 1.000
3DL1*00401 0.000 0.161 0.002 0.034 1.000 <0.001 (<0.001) 2
3DL1*00402 0.000 0.033 0.000 0.119 - 0.029
3DL1*005 0.075 0.097 0.128± 0.145± 0.455 0.841
3DL1*007 0.025 0.048 0.002 0.033 0.154 0.167
3DL1*008 0.000 0.016 0.005 0.051 0.222 1.000
3DL1*009 0.000 0.016 0.000 0.020 - 0.562
3DL1*01501 0.000 0.000 0.000 0.004 - 1.000
3DL1*01502 0.200 0.129 0.373 0.064 0.038 0.012 (0.156) 3
3DL1*019 0.000 0.000 0.000 0.001 - 1.000
3DL1*020 0.000 0.016 0.000 0.008 - 0.386
3DL1*029 0.100 0.000 0.065 0.001 0.336 1.000
3DS1*01301 0.300 0.242 0.407 0.233 0.239 0.878
3DL1 0.625 0.758 0.578 0.802d 0.619 0.424
3DS1 0.375 0.242 0.422 0.198d
2DL2 0.175 0.242 0.352 0.320d 0.024 (0.047) 4 0.220
2DL3 0.825 0.758 0.648 0.680d

Ab, Aboriginal; NAb, Non-aboriginal; VA, Venezuelan Amerindian; CA, Caucasoid.

3DL1*051, 3DS1*010 comparisons not available.

a

Allele frequencies derived from Allele frequency net (28).

b

2n = 460;

c

2n = 4056;

d

2n = 17,680.

±

Frequencies derived from low-resolution data.

1

Odds Ratio:infinite;

2

Odds Ratio:5.460(CI95%:2.717–10.970);

3

Odds Ratio:2.163(CI95%:1.019–4.593);

4

For 2DL2, Odds Ratio:0.390(CI95%:0.169–0.902); For 2DL3, Odds Ratio:2.563(CI95%:1.109–5.923).

World Caucasoids were highly diversified for 3DL1/S1 (Table 3). Eighty-seven percent of NAb ICU patients were Caucasoids and when compared to the CA group, 3DL1*00401 was significantly found to be enriched (CA<NAb, P<0.001, Pc<0.001; Odds Ratio:5.460, CI95%:2.717–10.970). Prior to correction for multiple comparisons, 3DL1*01502 was also markedly enriched in NAb (CA<NAb, P = 0.012, Pc = 0.156; Odds Ratio:2.163, CI95%:1.019–4.593). Differences in 2DL2/L3 between NAb patients and the CA group were not statistically significant.

APACHE II score comparison between H1N1/09 ICU subgroups and allotype/ligand pairs

APACHE II is a severity of disease classification system, commonly used for ICU patients, which calculates risk of hospital death on the basis of twelve routine physiologic measurements and their degree of divergence from typical thresholds [35]. Total APACHE II scores were calculated for all H1N1/09 ICU patients and probabilities of death (Rd) were determined (Table 4). Because KIR3DS1 has only been shown to bind to Bw4-80I ligands [26], 3DS1+/3DL1− Bw4-80T+ 80I− pairs were considered to be ligand-negative, when correlating allotype-ligand pairs with APACHE II scores.

Table 4. Comparison of average probabilities of death among H1N1 ICU patients based on APACHE II severity of disease classification system.

Aboriginal Non-Aboriginal
Allele/Ligand n Death Rate (%) n Death Rate (%)
2DL2/L3 C1het 8 (40%) 36 9 (29%) 40
2DL2/L3 C1hom 6 (30%) 43 22 (71%) 40
2DL2/L3 C2hom 6 (30%) 38 - -
2DL2/L3 C1+ 14 (70%) 39 9 (29%) 40
2DL2+ C1+ 3 (15%) 21 12 (39%) 38
2DL2+ 2DL3− C1+ 10 (50%) 46 19 (61%) 42
3DL1/S1 Bw4het 10 (50%) 29 15 (48%) 41
3DL1/S1 Bw4hom 4 (20%) 41 2 (7%) 48
3DL1/S1 Bw6hom 6 (30%) 52 11 (36%) 39
3DL1/S1 Bw4+ 14 (70%) 34 17 (55%) 43
Bw4+ and C1− 5 (25%) 35 - -
Bw4− and C1+ 5 (25%) 52 10 (32%) 38
Bw4+ and C2+ C1+/− 9 (45%) 28 6 (19%) 36
Bw4− and C2+ C1+/− 4 (20%) 51 1 (3%) 55
Bw4+ and C1+ C2+ 5 (25%) 27 6 (19%) 36
3DL1*00101 Bw4+ 5 (25%) 40 5 (16%) 37
3DL1*01502 Bw4+ 4 (20%) 33 5 (16%) 48
3DL1*029 Bw4+ 3 (15%) 52 - -
3DL1*00401 Bw4+ - - 5 (16%) 58
3DS1*01301 Bw4-80I+ 9 (45%) 32 8 (26%) 48

het, heterozygous; hom, homozygous.

Among Ab patients, the mean probability of death was 38% (Range: 8%–75%). Low death rates were consistently observed in subjects that were 3DL1/S1 Bw4+ ligand-positive and in combination with HLA-C2 (Rd = 28%). No notable differences were found based solely on the presence of 2DL2/L3 C1+/− pairs. Of the 3DL1 allotypes enriched in aboriginal patients, only 3DL1*029, which was rare in most ethnic groups with exception to the Yucpa Amerindians from Venezuela [31], was associated to a higher probability of death (Rd = 52%). Because of the variations in binding affinity of 2DL2 and 2DL3 to HLA-C1 [36], the disease severities between patients with these allotypes were compared. Differences in death rates were found between 2DL2+ (Rd = 21%) and 2DL3+ 2DL2− patients (Rd = 46%).

Non-aboriginal ICU patients had slightly higher probabilities of death with a mean of 40% (Range: 8%–80%). All NAb patients were 2DL2/L3 C1+ ligand-positive. Contrary to Ab patients, low probabilities of death (Rd = 39%) were found in 3DL1/S1 Bw6+ ligand-negative pairs. However, a comparable death rate (Rd = 36%) was also observed in 3DL1/S1 Bw4+ HLA-C2+ subjects, which may indicate either a lack of effect by 3DL1/S1 on disease severity in non-aboriginals, or confounding due to an absence of 2DL2/L3 C1+ ligand-negative patients. Patients with ligands for all three KIRs (2DL1, 2DL2/L3, and 3DL1/S1) had the lowest probability of death (Rd = 36%). 3DL1*01502 and 3DL1*00401, allotypes enriched in non-aboriginal patients, were correlated with high disease severity (Rd = 48%; and Rd = 58%, respectively). There were no significant differences in disease severity between 2DL2+ (Rd = 38%) and 2DL3+ 2DL2− (Rd = 42%) patients.

Discussion

The objective of this study was to identify KIR3DL1/S1 and KIR2DL2/L3 allotypes, and corresponding ligands, enriched in aboriginal and non-aboriginal H1N1/09 ICU patients from the initial 2009 H1N1 pandemic waves. The premise was that specific allotypes and/or ligand combinations could predispose patients towards severe responses to H1N1/09 infections. In a general population, only a small proportion of individuals will develop such overactive immune responses [37]–[39]. The enrichment of specific KIR allotypes was evident when viewed in comparison to an H1N1-negative control population, St. Theresa Point; a First Nations community that was severely impacted during the first and second wave of the pandemic [29], [30]. Specific KIR allotype enrichment was also present, relative to Amerindians and world Caucasoids. Despite the small sample size of the ICU patients, several significant differences between groups were observed. As this is an exploratory study, further confirmation of the findings in future studies will be necessary.

In general, patients and populations of aboriginal descent were all found to lack 3DL1/S1 diversity, relative to world Caucasoids and ICU non-aboriginal patients. Although nine allotypes were detected, four allotypes accounted for the majority among all aboriginal subjects. This relatively low degree of diversity may nonetheless confer a greater susceptibility to infectious diseases, in general [11]. Additionally, 2DL3 allotypes were prevalent among ICU and St. Theresa subjects, in addition to a lack of 2DL2/2DL2 (homozygous) allotype carriers, especially among St. Theresa subjects. Enrichment of 2DL3 was also detected in aboriginal patients, in comparison to Venezuelan Amerindians. However, the 2DL2/L3 distributions between all other groups were similar and were consistent with the report from a study on KIR profiles in First Nations and Caucasoids of European Descent [28].

Highly expressed allotypes of KIR3DL1 (3DL1*001, *002, 01502), defined by their expression levels and/or inhibitory capacities [40]–[42], were common to both healthy St. Theresa and H1N1/09 ICU subjects. Yet among the ICU patients, these allotypes were frequently found ligand-negative. Overall, there was a larger proportion of 3DL1 ligand-negative ICU patients, relative to St. Theresa subjects. Although presumptive, it is highly possible then that, in conjunction with their cognate ligands, KIR3DL1 may play a partial role in preventing infection or inhibiting the development of severe responses.

Conversely, the significant enrichment of 2DL2/L3 ligand-positive pairs in ICU patients, in comparison to St. Theresa subjects, may imply that 2DL2/L3-ligand interactions contribute to greater disease severity. APACHE II scores (probability of hospital death) and available KIR/ligand data further suggested this possibility. Interestingly, correlations between disease severity and absence of 3DL1/S1 ligands and 2DL2 allotypes, were evident in aboriginal ICU patients only. The lack of clarity among non-aboriginal patients may be due to a lack of C2 ligands that was specifically observed in non-aboriginal ICU patients, and the expected high prevalence of their corresponding 2DL1 allotypes in both First Nations and Caucasoids of European descent [28], [31]. Nonetheless, the small proportion of non-aboriginal patients with ligands for all three KIR subtypes had the least severe responses.

Taken together, severe responses to H1N1/09, among other factors, may be dependent on 3DL1/S1, 2DL1, and 2DL2 ligand interactions, at least in the case of aboriginal patients. On the other hand, non-aboriginal patients may be affected by specific 3DL1 allotypes and a lack of 2DL1 allotype-ligands interactions. In future studies, it would be interesting to determine the distribution of specific 2DL1 and 2DL2/L3 allotypes, in conjunction with their ligands, for a larger sample of H1N1/09 ICU patients. This would allow for further clarification and characterization of the function, or lack thereof, of NK cells in patients with severe responses.

Lastly, marked differences were found in the frequencies of two synonymous allotypes, 3DL1*00401 and 3DL1*00402, between non-aboriginal ICU patients and Caucasoids. Although highly speculative, the mutations could produce two different proteins, possibly via changes in mRNA stability or alternative splice sites [43], [44]. Their phenotypic effects, if any, will need to be further investigated.

In summary, among ICU patients with severe responses to H1N1/09, 3DL1*00101, 3DL1*01502, and 3DL1*029, were enriched in aboriginal ICU patients, while 3DL1*00401 and 3DL1*01502 were enriched in non-aboriginals ICU patients. Likewise, the ligand-negative pairs KIR3DL1/S1+ Bw6+ Bw4− and KIR2DL1 C2− C1+, and ligand-positive pair KIR2DL3 C1+, were also observed to be proportionally higher in ICU patients, relative to healthy St. Theresa controls. As such, the study shows that the enrichment of specific allotypes and a disproportional distribution of cognate HLA class I ligands are likely factors that mediated NK cell dysfunction and lead to the development of severe responses to H1N1/09 in ICU patients.

Materials and Methods

Study Population

The study used data from two separate cohorts with a total of 156 subjects (125 Aboriginal, 27 Caucasoid, 2 South Asian, and 2 unknown/mix ethnics). The first cohort consisted of 51 H1N1/09 intensive-care unit (ICU) patients with severe cases of infection. The second included 105 aboriginal H1N1-negative subjects from St. Theresa Point. Screening of the St. Theresa Point population was undertaken by analyzing DNA samples obtained in 2007–09, in the context of a study evaluating the prevalence of rheumatoid arthritis (RA) risk factors in the community. Individuals aged 18–55 were randomly selected from the community at large based on their willingness to participate in the RA study. All ICU patients were H1N1-confirmed by RT-PCR testing.

Ethics Statement

Permission to use the St. Theresa Point samples for the H1N1/09 study was specifically obtained from the Research Ethics Board of the University of Manitoba and from the leadership of the community through the Band Council. The study of ICU patients was approved using a full consent process through the Research Ethics Board of the University of Manitoba. The data were analyzed anonymously.

KIR3DL1/S1 and HLA Genotyping

Genomic DNA was isolated from whole blood samples that were stored in PAXgene Blood RNA tubes (PreAnalytix) using a QIAmp DNA Mini Kit and the EZ1 BioRobot (QIAgen Inc, Mississauga, Ontario, Canada).

PCR amplification

KIR3DL1/S1 exons 1–5, 7, and 9, KIR2DL2/3 exon 4 [45], and HLA-B exons 2 and 3 [46] were amplified using genomic DNA with gene-specific primers (Table 5). PCR amplifications were confirmed by 1% agarose gel electrophoresis with ethidium bromide. PCR products were purified using Agencourt AMPure XP Kits (Beckman Coulter) and resuspended in Tris-EDTA buffer (pH 8.0).

Table 5. Amplification and sequencing primers for KIR3DL1/S1 typing.
Name Specificity Primer Sequence (5′ 3′) Location Annealing Temperature
L1S1-1FPCR 5′ Exon 1 CGAGGTGTCAATTCTAGTGAGAG Intron 1 61 to 51°Cc
L1S1-1RPCR 3′ Exon 1 CACTTCAGGCCCATAACTCCAC Intron 2 61 to 51°Cc
L1S1-1FSEQ Exon 1 CGAGGTGTCAATTCTAGTGAGAG Intron 1 53.0°C
L1S1-1RSEQ Exon 1 CTAGGCCCATATCTTTACCTCC Intron 2 55.0°C
L1S1-2-3FPCR 5′ Exon 2 GAGATCCTTGTTCCTGGGG Intron 2 56.2°C
L1S1-2-3RPCR 3′ Exon 3 CGTCTCCCTCCCACTACAC Intron 3 56.2°C
L1S1-2FSEQ Exon 2 CAGCGAGGGTGAGTTTAC Intron 2 56.9°C
L1S1-2RSEQ Exon 2 GAGGGTCCCCTCTTCCTAGTG Intron 3 55.0°C
L1S1-3FSEQ Exon 3 GTGGAAATGGGGAGAATCTTCTGG Intron 3 55.0°C
L1S1-3RSEQ Exon 3 CAGAAGCTCTGGGATTCAG Intron 4 58.0°C
L1S1-4FPCR 5′ Exon 4 CATGCAGCCTGTCCTCTTC Intron 4 57.6°C
L1S1-4RPCR 3′ Exon 4 ACACGGCATCTGTAGGTGG Intron 5 57.6°C
L1S1-4FSEQ Exon 4 GGGAGGAGAGAGACAGACACG Intron 4 53.0°C
L1S1-4RSEQ Exon 4 CAGACCTCACCAAGTCAC Intron 5 52.0°C
L1S1-5FPCR 5′ Exon 5 GACAGAGAGGCAGACAGAGAGG Intron 5 64 to 54°Cc
L1S1-5RPCR 3′ Exon 5 CTGACTCCGCCCTCACACCTG Intron 6 64 to 54°Cc
L1S1-5FSEQ Exon 5 GAGAGAGAGAGAGAGAGCATTAG Intron 5 55.0°C
L1S1-5RSEQ Exon 5 CTCTGCATCTGTCCATGCTTTTC Intron 6 55.0°C
L1S1-7-9FPCRa 5′ Exon 7 GCTATAACTGAGAAAGCAGGAGG Intron 7 64 to 54°Cc
L1S1-7-9RPCRa 3′ Exon 9 CATTTGTAAGCAAGWGAGAGGCAC Intron 9 64 to 54°Cc
L1S1-7FSEQa Exon 7 GGGTGCTTGTCCKAAAGAGAYGC Intron 7 58.9°C
L1-9FSEQa , b Exon 9 CACTCAGCATTTCCCTCCCTCAC Intron 9 54.4°C
L1-9RSEQa , b Exon 9 GGCTGTTGTCTCCCTAGAAGACG Intron 10 58.0°C
a

Does not amplify 3DL1*059, 3DL1*060, 3DL1*061.

b

3DL1 only.

c

Touchdown PCR temperature range.

Sequencing

PCR products were sequenced using BigDye™ Terminator Cycle Sequencing Kits (Applied Biosystems) V1.1. Purified PCR products were analyzed using an ABI PRISM 3130×l Genetic Analyzer (Applied Biosystems) and genotyped using Codon Express™, a taxonomy-based sequencing analysis software, with the KIR and HLA databases from IMGT/HLA and IPD/KIR, respectively [47]–[49].

Statistical Analysis

Frequency analysis was performed using SPSS 13.0 for Windows. The statistical significance of difference between allele frequencies were calculated using Fisher's Exact Test for small numbers via Microsoft Research and VassarStats [50], [51]. Correct P values (Pc) were obtained using the Sidak method by calculating 1-(1- P)n, where n is the number of alleles analyzed in each group. A P value of less than 0.05 was considered significant.

Acknowledgments

We thank Nicole Marten (St. Boniface General Hospital and Grace Hospital) and Wendy Janz (Winnipeg Health Sciences Centre) for collecting and cataloguing samples from ICU patients across the country, and Nathalie Bastien and her staff in the Influenza and Respiratory Virus Section (National Microbiology Laboratory) for confirming H1N1-positive patients. In addition, we thank Shafquat Siddiqi and his staff, and Don Ashley (National Microbiology Laboratory) for transporting and maintaining the database for all ICU patient samples.

Footnotes

Competing Interests: This study was supported in part by Roche, Canada. This does not alter the authors' adherence to all the PLoS ONE policies on sharing data and materials.

Funding: This study was supported by the Federal funding for H1N1 research and in part by Roche, Canada. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Presanis AM, Angelis DD, Hagy A, Reed C, et al. The New York City Swine Flu Investigation Team. The severity of pandemic H1N1 influenza in the United States, from April to July 2009: A Bayesian analysis. PLoS Med. 2009;6:e1000207. doi: 10.1371/journal.pmed.1000207. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Paine S, Mercer GN, Kelly PM, Bandaranayake D, Baker MG, et al. Transmissibility of 2009 pandemic influenza A(H1N1) in New Zealand: Effective reproduction number and influence of age, ethnicity and importations. Euro Surveill. 2010;15:19591. [PubMed] [Google Scholar]
  • 3.World Health Organization (WHO) Pandemic (H1N1) 2009 - update 76. 2009. Available: http://www.who.int/csr/don/2009_11_27a/en/index.html. Accessed 2010 Oct 19.
  • 4.World Health Organization (WHO) Pandemic (H1N1) 2009 - update 112. 2010. Available: http://www.who.int/csr/don/2010_08_06/en/index.html. Accessed 2010 Oct 19.
  • 5.Turner SJ, Doherty PC, Kelso A. Q&A: H1N1 pandemic influenza–what's new? BMC Biol. 2010;8:130. doi: 10.1186/1741-7007-8-130. 10.1186/1741-7007-8-130. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Xu R, Ekiert DC, Krause JC, Hai R, Crowe JE, Jr, et al. Structural basis of preexisting immunity to the 2009 H1N1 pandemic influenza virus. Science. 2010;328:357–360. doi: 10.1126/science.1186430. 10.1126/science.1186430. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.La Ruche G, Tarantola A, Barboza P, Vaillant L, Gueguen J, et al. The 2009 pandemic H1N1 influenza and indigenous populations of the Americas and the Pacific. Euro Surveill. 2009;14:pii = 19366. doi: 10.2807/ese.14.42.19366-en. [DOI] [PubMed] [Google Scholar]
  • 8.Dee S, Jayathissa S. Clinical and epidemiological characteristics of the hospitalised patients due to pandemic H1N1 2009 viral infection: Experience at Hutt Hospital, New Zealand. N Z Med J. 2010;123:45–53. [PubMed] [Google Scholar]
  • 9.Wada K, Nishiura H, Kawana A. An epidemiological analysis of severe cases of the influenza A (H1N1) 2009 virus infection in Japan. Influenza Other Respi Viruses. 2010;4:179–186. doi: 10.1111/j.1750-2659.2010.00143.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Chitnis AS, Truelove SA, Druckenmiller JK, Heffernan RT, Davis JP. Epidemiologic and clinical features among patients hospitalized in Wisconsin with 2009 H1N1 influenza A virus infections, April to August 2009. WMJ. 2010;109:201–208. [PubMed] [Google Scholar]
  • 11.Zarychanski R, Stuart TL, Kumar A, Doucette S, Elliott L, et al. Correlates of severe disease in patients with 2009 pandemic influenza (H1N1) virus infection. CMAJ. 2010;182:257–264. doi: 10.1503/cmaj.091884. 10.1503/cmaj.091884. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Denney L, Aitken C, Li CK, Wilson-Davies E, Kok WL, et al. Reduction of natural killer but not effector CD8 T lymphocytes in three consecutive cases of severe/lethal H1N1/09 influenza A virus infection. PLoS One. 2010;5:1–9. doi: 10.1371/journal.pone.0010675. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Liu B, Mori I, Hossain MJ, Dong L, Takeda K, et al. Interleukin-18 improves the early defence system against influenza virus infection by augmenting natural killer cell-mediated cytotoxicity. J Gen Virol. 2004;85:423–428. doi: 10.1099/vir.0.19596-0. [DOI] [PubMed] [Google Scholar]
  • 14.Fauci AS, Mavilio D, Kottilil S. NK cells in HIV infection: Paradigm for protection or targets for ambush. Nature Immunology Reviews. 2005;5:835–843. doi: 10.1038/nri1711. [DOI] [PubMed] [Google Scholar]
  • 15.Vivier E, Tomasello E, Baratin M, Walzer T, Ugolini S. Functions of natural killer cells. Nat Immunol. 2008;9:503–510. doi: 10.1038/ni1582. 10.1038/ni1582. [DOI] [PubMed] [Google Scholar]
  • 16.Vivier E, Raulet DH, Moretta A, Caligiuri MA, Zitvogel L, et al. Innate or adaptive immunity? The example of natural killer cells. Science. 2011;331:44–49. doi: 10.1126/science.1198687. 10.1126/science.1198687. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Hoglund P, Brodin P. Current perspectives of natural killer cell education by MHC class I molecules. Nat Rev Immunol. 2010;10:724–734. doi: 10.1038/nri2835. 10.1038/nri2835. [DOI] [PubMed] [Google Scholar]
  • 18.Lanier LL. NK cell recognition. Annu Rev Immunol. 2005;23:225–274. doi: 10.1146/annurev.immunol.23.021704.115526. [DOI] [PubMed] [Google Scholar]
  • 19.Carrington M, Norman P. The KIR gene cluster. Bethesda, MD: National Library of Medicine (US). 48 p. 2003. Available: http://www.ncbi.nlm.nih.gov/books/NBK10134/. Accessed 2010 Oct 19.
  • 20.Gumperz JE, Litwin V, Phillips JH, Lanier LL, Parham P. The Bw4 public epitope of HLA-B molecules confers reactivity with natural killer cell clones that express NKB1, a putative HLA receptor. J Exp Med. 1995;181:1133–1144. doi: 10.1084/jem.181.3.1133. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Gillespie GM, Bashirova A, Dong T, McVicar DW, Rowland-Jones SL, et al. Lack of KIR3DS1 binding to MHC class I Bw4 tetramers in complex with CD8+ T cell epitopes. AIDS Res Hum Retroviruses. 2007;23:451–455. doi: 10.1089/aid.2006.0165. 10.1089/aid.2006.0165. [DOI] [PubMed] [Google Scholar]
  • 22.Colonna M, Borsellino G, Falco M, Ferrara GB, Strominger JL. HLA-C is the inhibitory ligand that determines dominant resistance to lysis by NK1- and NK2-specific natural killer cells. Proc Natl Acad Sci U S A. 1993;90:12000–12004. doi: 10.1073/pnas.90.24.12000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Wagtmann N, Rajagopalan S, Winter CC, Peruzzi M, Long EO. Killer cell inhibitory receptors specific for HLA-C and HLA-B identified by direct binding and by functional transfer. Immunity. 1995;3:801–809. doi: 10.1016/1074-7613(95)90069-1. [DOI] [PubMed] [Google Scholar]
  • 24.Kulkarni S, Martin MP, Carrington M. The yin and yang of HLA and KIR in human disease. Semin Immunol. 2008;20:343–352. doi: 10.1016/j.smim.2008.06.003. 10.1016/j.smim.2008.06.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Khakoo SI, Carrington M. KIR and disease: A model system or system of models? Immunol Rev. 2006;214:186–201. doi: 10.1111/j.1600-065X.2006.00459.x. 10.1111/j.1600-065X.2006.00459.x. [DOI] [PubMed] [Google Scholar]
  • 26.Jamil KM, Khakoo SI. KIR/HLA interactions and pathogen immunity. J Biomed Biotechnol. 2011;2011:298348. doi: 10.1155/2011/298348. 10.1155/2011/298348. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Lutz CT, Smith KD, Greazel NS, Mace BE, Jensen DA, et al. Bw4-reactive and Bw6-reactive antibodies recognize multiple distinct HLA structures that partially overlap in the alpha-1 helix. J Immunol. 1994;153:4099–4110. [PubMed] [Google Scholar]
  • 28.Rempel JD, Hawkins K, Lande E, Nickerson P. The potential influence of KIR cluster profiles on disease patterns of Canadian aboriginals and other indigenous peoples of the Americas. Eur J Hum Genet. 2011;19:1276–1280. doi: 10.1038/ejhg.2011.114. 10.1038/ejhg.2011.114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Webster P. Federal policies fuel spread of swine flu, experts say. CMAJ. 2009;181:E90–91. doi: 10.1503/cmaj.091355. 10.1503/cmaj.091355. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Embree J. Pandemic 2009 (A)H1N1 influenza (swine flu) - the Manitoba experience. Biochem Cell Biol. 2010;88:589–593. doi: 10.1139/O10-025. 10.1139/o10-025. [DOI] [PubMed] [Google Scholar]
  • 31.Gonzalez-Galarza FF, Christmas S, Middleton D, Jones AR. Allele frequency net: A database and online repository for immune gene frequencies in worldwide populations. Nucleic Acids Res. 2011;39:D913–919. doi: 10.1093/nar/gkq1128. 10.1093/nar/gkq1128. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Gendzekhadze K, Norman PJ, Abi-Rached L, Layrisse Z, Parham P. High KIR diversity in Amerindians is maintained using few gene-content haplotypes. Immunogenetics. 2006;58:474–480. doi: 10.1007/s00251-006-0108-3. 10.1007/s00251-006-0108-3. [DOI] [PubMed] [Google Scholar]
  • 33.Carrington M, Gao X, Norman P. KIR gene allele frequencies in populations from USA (African American) USA (European) and England. Hum Immun. 2004;65:1191–1191. [Google Scholar]
  • 34.Norman PJ, Abi-Rached L, Gendzekhadze K, Korbel D, Gleimer M, et al. Unusual selection on the KIR3DL1/S1 natural killer cell receptor in Africans. Nat Genet. 2007;39:1092–1099. doi: 10.1038/ng2111. 10.1038/ng2111. [DOI] [PubMed] [Google Scholar]
  • 35.Knaus WA, Draper EA, Wagner DP, Zimmerman JE. APACHE II: A severity of disease classification system. Crit Care Med. 1985;13:818–829. [PubMed] [Google Scholar]
  • 36.Moesta AK, Norman PJ, Yawata M, Yawata N, Gleimer M, et al. Synergistic polymorphism at two positions distal to the ligand-binding site makes KIR2DL2 a stronger receptor for HLA-C than KIR2DL3. J Immunol. 2008;180:3969–3979. doi: 10.4049/jimmunol.180.6.3969. [DOI] [PubMed] [Google Scholar]
  • 37.Kaufman MA, Duke GJ, McGain F, French C, Aboltins C, et al. Life-threatening respiratory failure from H1N1 influenza 09 (human swine influenza). Med J Aust. 2009;191:154–156. doi: 10.5694/j.1326-5377.2009.tb02726.x. [DOI] [PubMed] [Google Scholar]
  • 38.Echevarria-Zuno S, Mejia-Arangure JM, Mar-Obeso AJ, Grajales-Muniz C, Robles-Perez E, et al. Infection and death from influenza A H1N1 virus in Mexico: A retrospective analysis. Lancet. 2009;374:2072–2079. doi: 10.1016/S0140-6736(09)61638-X. 10.1016/S0140-6736(09)61638-X. [DOI] [PubMed] [Google Scholar]
  • 39.O'Riordan S, Barton M, Yau Y, Read SE, Allen U, et al. Risk factors and outcomes among children admitted to hospital with pandemic H1N1 influenza. CMAJ. 2010;182:39–44. doi: 10.1503/cmaj.091724. 10.1503/cmaj.091724. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Carr WH, Pando MJ, Parham P. KIR3DL1 polymorphisms that affect NK cell inhibition by HLA-Bw4 ligand. J Immunol. 2005;175:5222–5229. doi: 10.4049/jimmunol.175.8.5222. [DOI] [PubMed] [Google Scholar]
  • 41.Gardiner CM, Guethlein LA, Shilling HG, Pando M, Carr WH, et al. Different NK cell surface phenotypes defined by the DX9 antibody are due to KIR3DL1 gene polymorphism. J Immunol. 2001;166:2992–3001. doi: 10.4049/jimmunol.166.5.2992. [DOI] [PubMed] [Google Scholar]
  • 42.Yawata M, Yawata N, Draghi M, Little AM, Partheniou F, et al. Roles for HLA and KIR polymorphisms in natural killer cell repertoire selection and modulation of effector function. J Exp Med. 2006;203:633–645. doi: 10.1084/jem.20051884. 10.1084/jem.20051884. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Duan J, Wainwright MS, Comeron JM, Saitou N, Sanders AR, et al. Synonymous mutations in the human dopamine receptor D2 (DRD2) affect mRNA stability and synthesis of the receptor. Hum Mol Genet. 2003;12:205–216. doi: 10.1093/hmg/ddg055. [DOI] [PubMed] [Google Scholar]
  • 44.Reinders J, Rozemuller EH, Otten HG, Houben AJ, Dormoy A, et al. Identification of HLA-A*0111N: A synonymous substitution, introducing an alternative splice site in exon 3, silenced the expression of an HLA-A allele. Hum Immunol. 2005;66:912–920. doi: 10.1016/j.humimm.2005.06.010. 10.1016/j.humimm.2005.06.010. [DOI] [PubMed] [Google Scholar]
  • 45.Hardie RA, Czarnecki C, Ball TB, Plummer FA, Luo M. Identification of four novel KIR2DL2 alleles and two novel KIR2DL3 alleles in an East African population. Hum Immunol. 2010;71:1251–1254. doi: 10.1016/j.humimm.2010.09.013. 10.1016/j.humimm.2010.09.013. [DOI] [PubMed] [Google Scholar]
  • 46.Luo M, Embree J, Ramdahin S, Ndinya-Achola J, Njenga S, et al. HLA-A and HLA-B in Kenya, Africa: Allele frequencies and identification of HLA-B*1567 and HLA-B*4426. Tissue Antigens. 2002;59:370–380. doi: 10.1034/j.1399-0039.2002.590503.x. [DOI] [PubMed] [Google Scholar]
  • 47.Robinson J, Malik A, Parham P, Bodmer JG, Marsh SGE. IMGT/HLA - a sequence database for the human major histocompatibility complex. Tissue Antigens. 2000;55:280–287. doi: 10.1034/j.1399-0039.2000.550314.x. [DOI] [PubMed] [Google Scholar]
  • 48.Robinson J, Waller MJ, Stoehr P, Marsh SGE. IPD - the immuno polymorphism database. Nucleic Acids Research. 2005;331:D523–D526. doi: 10.1093/nar/gki032. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Robinson J, Mistry K, McWilliam H, Lopez R, Parham P, et al. The IMGT/HLA database. Nucleic Acids Research. 2011;39:D1171–D1176. doi: 10.1093/nar/gkq998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Carlson JM, Heckerman D, Shani G. Estimating false discovery rates for contingency tables (MSR-TR-2009-53). 2009. Available: http://research.microsoft.com/en-us/um/redmond/projects/MSCompBio/FalseDiscoveryRate. Accessed 2010 Oct 19.
  • 51.Lowry R. VassarStats: Website for statistical computation. 2011. Available: http://faculty.vassar.edu/lowry/odds2x2.html. Accessed 2011 Jun 22.

Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES