Skip to main content
BMC Biotechnology logoLink to BMC Biotechnology
. 2013 Oct 21;13:88. doi: 10.1186/1472-6750-13-88

Development of selectable marker free, insect resistant, transgenic mustard (Brassica juncea) plants using Cre/lox mediated recombination

Arpita Bala 1, Amit Roy 1,#, Ayan Das 1,#, Dipankar Chakraborti 2, Sampa Das 1,
PMCID: PMC3819271  PMID: 24144281

Abstract

Background

Antibiotic/ herbicide resistant marker genes have been proven to be very useful in plant transformation for the initial selection of desired transgenic events. However, presence of these genes in the genetically modified crops may render the crop less acceptable to the consumers. Among several different approaches, the effectiveness of Cre/lox mediated recombination strategy for selectable marker gene (SMG) elimination has previously been demonstrated by different groups in several plants including Brassica. In the present study exploiting Cre/lox mediated recombination strategy, attempt has been made for selectable marker gene elimination from Allium sativum leaf agglutinin (ASAL) expressing Brassica plants with hemipteran insect resistant phenotype.

Results

Allium sativum leaf agglutinin (ASAL) linked with lox flanked hygromycin resistant (hpt) gene was introduced in mustard. Cre recombinase gene cassette was also integrated in separate event. A Cre/lox mediated recombination using crossing strategy was adopted to remove the hpt gene from the subsequent generation of selected hybrid events. Reciprocal crosses were made between T1ASAL-lox-hpt-lox and cre-bar plants. Marker gene elimination was confirmed in the resulting F1 hybrid progenies by PCR analysis, using hpt, cre and ASAL specific primers followed by Southern hybridization. In marker free plants, expression of ASAL was also confirmed by western blotting and ELISA analysis. Retention of functionality of expressed ASAL was investigated by agglutination assay using rabbit erythrocytes. Expressed ASAL was also found to be thermo-sensitive. In planta insect bioassay on F1 hybrid progenies exhibited detrimental effect on the performance of devastating target pest, Lipaphis erysimi. The F1 hybrid hpt negative, ASAL positive plants were allowed to self- fertilize to obtain F2 progeny plants. In some of these plants cre gene was found to be segregated out of the ASAL gene by genetic segregation yielding completely marker free plants.

Conclusions

The present study establishes the efficient expression of the newly introduced insect resistant ASAL gene even after Cre/lox mediated recombination resulting in elimination of selectable marker gene.

Keywords: Agglutination, Allium sativum leaf agglutinin (ASAL), Cre/lox recombination, Lipaphis erysimi, Selectable marker gene (SMG)

Background

Genetic transformation of Brassica juncea (Indian mustard) has been an important area of research since the crop is one of the most important sources of edible oil and accounts for 12% of the total edible oil throughout the world. B. juncea is widely cultivated in many parts of the world. Unfortunately, mustard cultivation is seriously affected by sap sucking hemipteran pest- Lipaphis erysimi (mustard aphid). Infestation of the pest at the time of flowering and silique formation causes significant yield loss [1]. The nutritional constituents (lipid, carbohydrate, nitrogen and protein level) of mustard plant at different growth stages are also reduced due to the aphid attack [2]. In India aphid causes 10– 90% yield loss of mustard depending upon the severity of infestation and stage of the plant at which aphid attacks [3]. In addition to the nutrient loss of plants, aphids also transmit pathogenic viruses which contributes to additional yield loss [4,5].

Application of chemical insecticides for controlling these insects leads to evolution of resistant biotypes. The most commonly used bio-control agent Bt (Bacillus thuringiensis) toxin is useful for chewing insects such as lepidopteran and coleopterans but it is ineffective against hemipteran group of sucking insect pests [6]. Several other proteins including α- amylase inhibitor, ribosome– inactivating proteins, enzyme inhibitors, arcelins, chitinases, ureases, modified storage proteins and lectins have been reported to be involved in plant defence against various insects. Among these, plant lectins have been found to be potent insecticidal agents which play a crucial role in managing several important pests [7-10]. Previous reports from this group demonstrated that a homodimeric mannose binding Allium sativum leaf agglutinin (ASAL) exhibits insecticidal activity against sap sucking hemipterans namely, mustard aphid, rice brown planthopper, green leafhopper and chickpea aphid. Consequently, transgenic expression of ASAL had been accomplished in mustard, rice, and chickpea [11-13].

Generally, in the process of development of transgenic plants, selectable marker genes (SMGs) are utilised to select transgenic events. SMGs are generally conditionally dominant genes which code for enzymes capable of inactivating different toxic agents such as antibiotics, herbicides [14]. In recent days, public concern has developed regarding the indiscriminate introduction of SMGs in natural ecosystem [15]. Antibiotic or herbicide resistant genes may have chances to be transferred by outcrossing into weeds or rarely, through horizontal gene transfer to other organisms [16-20]. Additionally, continuous expression of the markers may interfere with normal plant growth and development [21]. Thus, it is desirable to eliminate the SMG after establishment of transgenic plant [17,22,23].

Development of herbicide or antibiotic resistant marker gene free transgenic plants could ease release and commercialization of transgenic crop [24]. In the last few years several strategies have been employed for removal of selectable markers [20,23,24] including co-transformation [25,26] transposon mediated repositioning of the gene of interest [27,28], exploitation of multi- auto- transformation system [29] and site – specific recombination system [30-33]. Among several strategies, Cre/lox P induced site- specific recombination strategy observed in bacteriophage P1 has been widely used for recombination mediated elimination of the SMGs [30,31,33-37]. The 38 kDa Cre recombinase specifically recognizes and induces precise excision of DNA fragment between two directly repeated asymmetric 34 bp lox P sites [35,38,39].

In the present study, Cre/lox mediated recombination system has been used to produce marker gene free ASAL expressing transgenic insect resistant mustard plants. To carry out this study, initially two types of transgenic lines were generated using two independent vectors, one having the antibiotic resistant hpt gene flanked by two lox P sites and ASAL gene under the control of CaMV 35S promoter and another vector with cre recombinase gene cassette along with the herbicide resistant gene bar. These T1 plants were reciprocally crossed. A substantial number of hybrid plants exhibited loss of hpt gene due to Cre/lox recombination, and were analysed for resistance against the target insect Lipaphis erysimi. These plants were allowed to self-fertilize to obtain F2 plants. Elimination of the cre gene (and of the associated selectable marker-bar) was accomplished by genetic segregation, thus obtaining completely marker-free mustard plants expressing ASAL.

Methods

Plant material

Brassica juncea cv. B-85 seeds were obtained from Berhampur Pulse Research Station, West Bengal, India and used for plant transformation.

Plant transformation vector

Details of construction of the vector pBKhgASAL (~ 7.0 kb) (Figure 1A) was reported earlier by the present group [33], which contains ASAL gene under the control of CaMV 35S promoter and nos terminator within HindIII/ EcoRI site plus the hygromycin resistance gene (hpt) cassette flanked by lox sites. The 1.1 kb cre coding sequence was cloned into the multiple cloning site of pCAMBIA3300 along with herbicide resistant marker bar and named as pBK16.2 (~10.6 kb) (Figure 1B). The details of this cloning were previously reported by Chakraborti et al. [30]. All these vectors were mobilized into the AGL-1 strain of Agrobacterium tumefaciens.

Figure 1.

Figure 1

Schematic representation of the T-DNA region of binary vectors used for mustard transformations. A pBKhgASAL showing ASAL gene under CaMV35S promoter and hpt gene cassette flanked by two lox sequences. B pBK16.2 showing the cre gene under CaMV35S promoter, also containing bar gene as selection marker; the respective restriction endonuclease sites are indicated. A1/B1, A2/B2 and A3/B3 indicate the primer sequences for ASAL, cre and hpt genes, respectively. 5′ → 3′: orientation of lox sequences. LB: T-DNA left border; RB: T-DNA right border.

Mustard transformation

A. tumefaciens mediated transformation and regeneration of mustard were performed according to the method described by Mehra et al. [40] with some modifications [11]. Selection media containing either 30 mg/l hygromycin or 5 mg/l bialaphos were used to select calli and shoots transformed by pBKhgASAL or pBK16.2. After root induction the plants were transferred to soil in glass house at 25°C under a 16/8 h light/dark photoperiod regime. Identical regeneration steps were also carried out without infecting explants with A. tumefaciens. These explants were grown in the absence of antibiotics and used as control plants.

Screening of transgenic plants by PCR

The analysis of T0, T1, F1 hybrid and F2 plants were carried out with the DNA extracted from mature leaf tissue of putative transformed plants as well as control plants [41]. Polymerase Chain Reactions (PCR) were performed in all lines using ASAL, hpt and cre specific forward and reverse primers (Table 1). Multiplex PCR was performed in F1 hybrid and F2 plants using Qiagen Multiplex PCR kit (GmbH, Hilden, Germany). Each 50 μl PCR reaction mixture contained 1x PCR master mix including Hot Start Taq DNA polymerase. Primers were used in 0.2 μM concentration. The reaction started with incubation for 15 min at 94°C followed by 35 cycles of 30s at 94°C, 90 s at 58°C, 90 s at 72°C and final extension with 10 min at 72°C in My Cycler (Bio Rad, Hercules, CA, USA). In all PCR experiments pBKhgASAL plasmid was taken as positive control for ASAL, hpt genes and pBK16.2 plasmid was taken as positive control for cre gene. The amplification products of ASAL, cre and hpt genes were checked in 0.8% agarose gel.

Table 1.

Sets of forward and reverse primers used in the experiments

Primers Sequences Annealing temperature (°C) Amplicon size (bp)
A1 (ASAL forward)
5′ATGGCCAGGAACCTACTGACGA 3′
56
362
B1 (ASAL reverse)
5′CTATCTTCTCTAGGTACCAGTA 3′
 
 
A2 (cre forward)
5′ ATGTCCAATTTACTGACC 3′
58
1100
B2 (cre reverse)
5′ CTAATCGCCATCTTCCAGC 3′
 
 
A3 (hpt forward)
5′ GCTTTCCACTATCGGCGA 3′
58
980
B3 (hpt reverse) 5′ AAAGCCTGAACTCACCGC 3′    

Crossing of T1 transgenic lines

T0 plants were self pollinated to obtain T1 seeds. Four T1 [ASAL-lox-hpt-lox] lines were crossed with four T1 [cre-bar] lines reciprocally. Eight independent crosses of transgenic plants were performed. F1 hybrid seeds were harvested, surface- sterilized and germinated on half strength MS basal medium in the dark at 25°C. Germinated seedlings were transferred to greenhouse and maintained for further analysis.

Southern blot analysis

Total genomic DNA was extracted from the mature leaves of one month old control and transgenic plants of T0 (both ASAL and cre plant types) and F1 hybrid lines. The Southern blot hybridization was carried out according to Sambrook et al. [42] with modifications [11]. A total of 10 μg of genomic DNA per line was digested with HindIII (Roche, Mannheim, Germany) followed by separation in 0.8% (w/v) agarose gel. The gels were blotted onto positively charged nylon membranes (Hybond-N+; Amersham™ Biosciences, Buckinghamshire, UK). In Southern blot experiment the following probes were used: 362 bp amplicon from the ASAL gene prepared by using primer pairs A1 and B1; 1.1 kb amplicon from the cre gene produced by using primer pairs A2 and B2; 980 bp amplicon from the hpt gene generated by using primer pairs A3 and B3 (Table 1). Each probe was radio labeled with [α-32P] dCTP separately using Rediprime II™ Random Prime Labeling System, (Amersham™ Biosciences, Buckinghamshire, UK). After hybridization followed by extensive washing the membranes were exposed to Kodak X-ray film for seven days at -80°C and finally developed.

Western blotting

Total soluble protein from the leaves of one month old control and transgenic plants were extracted as described by Dutta et al. [11] and quantified. Garlic leaf lectin (ASAL, 1 μg) purified from fresh garlic leaves [43] was used as positive control. Western blotting was performed with 10 μg of total soluble protein of four T0 ASAL positive lines and nine F1 hybrid lines using the method as reported earlier [11].

ELISA

ELISA was done as per the method described by Dutta et al. [11]. Microtiter (Immunomaxi, Switzerland) wells were coated with 50 μg of crude protein extracted from the leaves of F1 hybrid plants or purified native ASAL serially diluted from 5 μg to 500 ng overnight at 4°C in coating buffer. After addition of substrate O- phenylenediaminehydrochloride (OPD, Gibco BRL, Gaithersburg, MD) dissolved in citrate buffer colour reaction was developed and the reading of the microtiter plate was recorded at 415 nm in a microtiter plate reader (Biorad).

Hemagglutination and thermal stability assay

The hemagglutination assay was carried out with the total soluble protein extracted from the F1 hybrid lines containing ASAL gene. Blood was collected from the rabbit by a syringe pre- filled with 500 μl 0.9% NaCl solution and immediately transferred to a culture tube pre- filled with 0.9% saline [44] and subsequently dispensed into the wells of the plate. Hemagglutination activity of expressed ASAL in selected F1 hybrid lines was assayed in a 96-well microtiter U-plate. Protein was dispensed to each well at a 2-fold serial dilution starting from 250 μg to 15.6 μg/ well. The U-plate was kept for 1 hour at 37°C and then hemagglutination was assessed visually.

The stability of the protein was assessed by its ability to agglutinate rabbit erythrocytes upon incubation at different temperatures [45]. Rabbit blood was diluted in 0.9% NaCl to a final concentration of 5% erythrocytes (v/v). The amount of total soluble protein from each of the selected ASAL expressing plant lines causing complete agglutination of rabbit erythrocytes was measured prior to assessing the stability of expressed ASAL. Thus, 125 μg of the total soluble protein from all the selected ASAL expressing F1 hybrid plants were dissolved in phosphate buffered saline (PBS) and incubated separately at 4, 25, 37, 55, 75 and 95°C for 30 mins. Upon incubation, each sample was subjected to rapid cooling on ice and agglutination activity was monitored.

In planta insect bioassay

F1 hybrid plants bearing ASAL gene and control plants were subjected to bioassay with nymphs of L. erysimi. Cages with one end open were used for insect bioassay. About twenty nymphs of L. erysimi of 3rd instar stage were collected from the culture stock and transferred onto the leaf surface of the plants which were already placed in the glass cages. The open end of the cage was sealed with adhesive tape. Three such cages were used per individual transgenic and control plant. Three replications were performed for each individual line. The survival of insects within the cages was monitored at an interval of every 24 hrs for 9 days. The mean data per plant was expressed as the percentage of the total aphids surviving on the respective days. Effect of ASAL on fecundity of the insect was monitored by counting the total number of nymphs produced per individual transgenic plants at the end of the bioassay period. ANOVA followed by Duncun’s multiple range tests were conducted to compare the significance of differences among all the transgenic and control plants for the insect bioassay experiment.

Results

Development of ASAL and cre lines

Southern blot analysis was carried out to check successful integration of transgene in putatively transformed T0ASAL-lox-hpt-lox and cre - bar containing plants developed by Agrobacterium mediated transformation. Plant no. LA, LB, LD, LF showed single copy insertion of ASAL gene, LC was a double copy insertion event and LE was found to be Southern negative (Figure 2A). In case of cre plants, plant no. CA, CC, CD, CE were single copy insertion events and CB was found to be Southern negative (Figure 2B). Single copy insertion lines of ASAL and cre were used for further analysis. Expression of ASAL was also confirmed by western blotting in the single copy ASAL insertion lines (Figure 2C). Eight reciprocal crosses were made between four T1ASAL positive plants of ASAL-lox-hpt-lox lines: LA2, LB9, LD3, LF5 and four T1cre positive plants of cre-bar lines: CA2, CC3, CD1, CE5 (Table 2).

Figure 2.

Figure 2

Molecular analysis of gene integration and expression in T0 lines. A Southern blot analysis of genomic DNA from leaves of putative T0ASAL- lox- hpt - lox plants probed with [α-32P] dCTP labeled ASAL. Lane 1, 362 bp ASAL coding sequence was used as positive control; lane 2, untransformed genomic DNA as negative control; lanes 3–8, HindIII digested genomic DNA from six ASAL plants LA, LB, LC, LD, LE, LF. B Southern blot analysis of genomic DNA from leaves of putative T0cre-bar plants probed with [α-32P] dCTP labeled cre. Lane 9, 1.1 kb cre coding sequence as positive control; lane 10, untransformed genomic DNA as negative control; lanes 11–15, HindIII digested genomic DNA from five cre plants CA, CB, CC, CD, CE. Approximate molecular weight markers are indicated in the middle. C Western blots analysis of protein from four T0 Southern positive ASAL-lox-hpt-lox mustard plants. ~ 1 μg purified native ASAL used as positive control (lane 1) and crude protein from untransformed plant used as negative control (lane 2). Lane 3 – 6 crude protein from four transgenic mustard plants LA, LB, LD, and LF.

Table 2.

Crosses between ASAL and cre lines and estimation of the frequency of cre -mediated excision

Cross no. T 1 parent
T 1 parent
Hybrid line ID Total plants ASAL and cre positive plants hpt negative plants Recombination frequency (% )
1
LA2
CC3
LA2CC3
30
16
9
56.25
2
LB9
CD1
LB9CD1
35
18
9
50
3
LD3
CA2
LD3CA2
25
15
7
46.67
4
LF5
CE5
LF5CE5
30
17
5
29.41
5
CA2
LD3
CA2LD3
40
22
10
45.5
6
CC3
LA2
CC3LA2
25
16
6
37.5
7
CD1
LB9
CD1LB9
30
18
4
22.2
8 CE5 LF5 CE5LF5 40 21 6 28.5

Molecular analysis of gene excision

From the eight independent crossing events, seeds were collected separately and multiplex PCR was performed to screen out the hybrid plants. The results of hybrid line LA2CC3 is shown here (Figure 3A). Thirty seeds were randomly chosen from hybrid line LA2CC3 (Table 2). Multiplex PCR was performed with ASAL and cre gene specific primers (Table 1). Among the 30 progeny plants, 16 plants were found to be positive for both ASAL gene and cre gene; 8 for only ASAL gene, 4 plants only for cre gene and 2 plants were azygous for both the genes (Figure 3A). The marker gene excision among the 16 ASAL and cre positive hybrid plants of LA2CC3 2, 3, 6, 7, 9, 12, 13, 14, 16, 18, 21, 23, 24, 27, 28, 29 were further verified through PCR (Figure 3B) using hpt gene specific primers. This amplification identified nine hpt negative plants where cre did work efficiently; as a result excision of hpt took place through recombination event. Following nine plants: LA2CC3 3, 6, 9, 12, 14, 18, 23, 24, 27 were found to be hpt negative. Thus, the Cre/lox mediated recombination frequency was determined to be 56.25% in case of hybrid line LA2CC3. The nine hybrid plants were further verified through Southern blotting experiments using three different probes for ASAL, cre and hpt (Figure 4A,B,C) which clearly showed the absence of hpt gene (Figure 4C) but the presence of ASAL and cre genes (Figure 4A,B) in those nine hybrid plants. Recombination frequency in another seven hybrid lines varied between 22.2 - 50%.

Figure 3.

Figure 3

Molecular analysis of marker gene excision. A Multiplex PCR analysis of F1 hybrid line LA2CC3. Lane '+’, mix of pBKhgASAL and pBK16.2 plasmids as positive control; lane '- ’ genomic DNA of an untransformed plant. Lanes 1–30, 30 F1 hybrid progenies of line LA2CC3. The 362 bp and 1.1 kb amplicon derives from the ASAL and cre genes respectively and B PCR with hpt specific primers of 16 ASAL + cre + plants of F1 hybrid line LA2CC3. Lanes 1–16, F1 hybrid plants, where plant no. 3, 6, 9, 12, 14, 18, 23, 24 and 27 showed absence of hpt. Lane ' + ', pBKhgASAL ; lane ' – ', genomic DNA of an untransformed plant. The 980 bp amplicon derives from the hpt gene. Lane M in A and B, DNA molecular weight marker (GenerulerTM, MBI Fermentas, UK).

Figure 4.

Figure 4

Southern blot analysis of HindIII digested genomic DNA from nine hpt negative F1 hybrid lines. DNA from Gel blots were hybridized with probe for A 362 bp ASAL sequence B 1.1 kb cre sequence and C 980 bp hpt sequences. Lane '+’ represents in A PCR amplified ASAL gene, B PCR amplified cre gene, C PCR amplified hpt gene as positive control, lane ' – ' represents HindIII digested genomic DNA from control plants as negative control. Approximate molecular weight markers are indicated.

Expression of ASAL in F1 hybrid lines

Nine hpt negative LA2CC3 F1 hybrid progeny plants were analyzed to monitor the expression of ASAL. Western blot of total soluble protein extracted from 30 days old plants’ leaves of those nine lines showed identical signals at ~12 kDa region (Figure 5A), corresponding to the purified native ASAL protein when probed with anti- ASAL antibody. In control plants no such band was observed. ELISA was performed to quantify the level of expressed ASAL in the selected plants. These nine plants showed level of expression of ASAL in the range of 0.2% to 0.48% of the total soluble protein (Figure 5B).

Figure 5.

Figure 5

Expression of ASAL in F1 hybrid plants. A Western blot analysis of protein extracts from leaves of nine hpt –ve F1 hybrid mustard plants. Lane 1, ~ 1 μg purified native ASAL used as positive control; lane 2, crude protein from untransformed plant used as negative control; lanes 3 – 11, show crude protein of LA2CC3 3, 6, 9, 12, 14, 18, 23, 24, 27. B ELISA analysis for expression of ASAL in total soluble protein of those mentioned F1 hybrid lines respectively.

Agglutination and thermal stability assay

The hemagglutination assay was performed with the extracted total soluble protein from five F1 hybrid ASAL positive plants [LA2CC3 3, 9, 14, 18, 23]. A tight button of rabbit erythrocytes was formed indicating negative reaction in well no. 1 – no protein control and well no. 2 - containing protein samples of untransformed plants in panel I-V. Five F1 hybrid lines exhibited agglutination of RBCs resulting in the formation of a layer over the wells (well no. 3–7; panel I-V) of the microtiter plate (Figure 6A). This result confirmed the retention of agglutination property in the transgenically expressed ASAL protein.

Figure 6.

Figure 6

Agglutination and thermal stability assay of expressed ASAL protein from F1 hybrid plants. A Rabbit erythrocytes incubated with: Panel I-V; Wells 3 to 7: total soluble protein extracted from ASAL expressing F1 hybrid plants namely LA2CC3 3, 9, 14, 18, 23 respectively in a twofold serial dilution started from 250 μg to 15.6 μg/ well; Panel I-V; Well 1: No protein control. Panel I-V; Well 2: protein from untransformed control plant. B Thermal Stability Assay: Rabbit erythrocytes incubated with total soluble protein (125 μg) from ASAL positive F1 hybrid plants [LA2CC3 3, 9, 14, 18, 23 in panel I-V respectively] pre-incubated at different temperatures as- 4°C, 25°C, 37°C, 55°C, 75°C and 95°C in Panel I-V; wells 2–7 respectively. Well 1 (I-V): No protein control (100 μl of 1.5% rabbit erythrocytes incubated without ASAL).

Thermal stability assay was conducted by monitoring the agglutination characteristics of ASAL, extracted from the above mentioned five F1 hybrid plants. ASAL lost its agglutination activity when treated at 55-75°C (wells 5–6; panel I-V; Figure 6B).

In planta insect bioassay

In order to investigate the effect of ASAL on survivability of L. erysimi, in planta insect bioassay was carried out in bioassay cages (Figure 7A,B) over 9 days time period using five ASAL expressing hpt negative F1 hybrid plants of LA2CC3 line. The survival of aphid was monitored with third instar nymphs at an interval of 24 h. It was observed that survival of the nymphs declined from 20 ± 0 (mean ± SE) to 13 ± 0.58 (65%) per control plant over the assay period, but the decline of mustard aphid on the ASAL expressing five progenies of LA2CC3 hybrid plant line varied from 6 ± 0.57 (30%) to 7 ± 0.57 (35%) at the end of the bioassay period (Figure 7C). The mean number of surviving Lipaphis on control and transgenic plants were found to be statistically significant (P < 0.05) after 3rd day. It was observed that after 9 days of the experiment the ASAL expressing line no. LA2CC3 (9), LA2CC3 (18), and LA2CC3 (23) showed maximum decrease in insect survivability. The effect of ASAL on fecundity was determined by counting the total nymphs produced by the adult insects on transformed and control plants at the end of the bioassay period. The nymph started developing into non- feeding alate form after 4 days of the initiation of bioassay experiment. The number of nymphs produced per plant was reduced by approximately 41% – 59% compared to control plants (Figure 7D).

Figure 7.

Figure 7

Insect bioassay setup and effect of expressed ASAL on Lipaphis erysimi. A, BIn planta insect bioassay setup of Lipaphis erysimi on transgenic mustard plants. Inset in A shows Lipaphis erysimi culture on control mustard plant. Bar represents 1 mm. C Graph shows the percentage of survival of mustard aphid on untransformed control plant and five ASAL expressing F1 hybrid plants LA2CC3 3, 9, 14, 18, 23. D Bar diagram showing fecundity pattern (mean number of nymphs produced per plant) of L. erysimi fed on control and five F1 hybrid plants- LA2CC3 3, 9, 14, 18, 23.

Establishment of marker free F2 plants

Since the F1hpt negative hybrid plants are cre positive, it is very likely that they are also bar positive. Therefore, some of the F1 progeny plants were allowed to self- fertilize to obtain F2 plants and analyzed for complete marker removal mediated by genetic segregation. Ten F2 progeny plants of the hpt negative line LA2CC3 (3) were analyzed for the presence of ASAL, hpt and cre genes. Three plants [F2 plant no. LA2CC3 (3) - 3, 6, 9] were found to contain only ASAL, one plant [no. LA2CC3 (3) – 8] showed the presence of only cre and six plants contained both ASAL and cre genes [no. LA2CC3 (3) – 1, 2, 4, 5, 7, 10] (Figure 8).

Figure 8.

Figure 8

PCR analysis of F2 progeny plants. Ten randomly chosen seeds from LA2CC3(3) line were analysed through multiplex PCR using ASAL and cre gene specific primer pairs. Lane 1–10 represents plant no. LA2CC3(3) 1–10 respectively, lane '+’ represents mix of pBKhgASAL and pBK16.2 plasmids as positive control and lane '-’ represents negative control (genomic DNA of untransformed plant); lane M, DNA molecular weight marker (GenerulerTM, MBI Fermentas, UK).

Discussion

The elimination of the marker gene product is desirable in the context of environmental safety [16,20,24,46,47]. In view of this, Cre/loxP site specific recombination system was used in the present study for the development of antibiotic resistant SMG free mustard lines with enhanced insect resistance property. The Cre/lox system has been tested for several plants including Arabidopsis thaliana[36], tobacco [30,48], maize [49] and rice [33,35,38] and found to be highly effective.

Cre/lox mediated marker gene elimination in Brassica juncea was reported for the first time by Arumugam et al.[37] where they cross pollinated the plants after the development of two homozygous lines with two different constructs. Kopertekh et al.[31] has shown marker elimination phenomenon in Brassica napus using a binary vector containing both cre and marker gene within the same lox sites which was adopted earlier in Arabidopsis[36], maize [49] and tobacco [39].

The average frequency of marker gene elimination in the present study was 39.5% which was significantly higher than the recombination frequency of 26.0% and 29.1% observed earlier by Hoa et al. [35] and Sreekala et al. [38] respectively. The recombination frequency obtained herein was also higher than the frequency of 19.1% obtained by Chakraborti et al.[30] and 27.4% by Sengupta et al. [33] in case of marker gene free transgenic lines of tobacco and rice, respectively. The efficiency of recombination was also comparable to that reported in the FLP/frt hybrids of tobacco [50]. Incidentally, Arumugam et al. [37] got higher marker excision frequency of 53% by using Cre/lox system in quiescent, differentiated somatic tissues of F1 plants. Previous studies by Stuurman et al. in tomato [51], Bar et al. in tobacco [50], Onouchi et al. in Arabidopsis[52] and Sreekala et al. in rice [38] have shown that recombination efficiency varied among and within crosses. The cause of such variation might be due to chromosomal localization of the transgene or variations in the Cre recombinase activity in different events. To overcome this problem Bayley et al. [53] proposed to select parents with strong expression of Cre recombinase. The sexual crossing between two different lines led to the precise and complete elimination of the lox flanked marker gene in the subsequent generation indicating the advantage of the crossing strategy over others. In the present study, the cre gene was found to be segregated out in F2 progeny plants of hpt negative ASAL expressing line LA2CC3(3) as it was observed in ASAL expressing hygromycin resistance marker gene free transgenic rice lines developed earlier by this group [33,54]. Finally, ASAL positive and both hpt and cre negative F2 mustard plants were established.

The transgenically expressed ASAL protein was found to be stable up to 37°C, but loses its functionality when heated at 55- 75°C which is comparable to the data shown by Mondal et al. [45] which eliminated all the possibility of native ASAL protein to be an allergen.

Extensive in planta insect bioassay was performed on ASAL expressing marker gene free F1 hybrid plants with L. erysimi. Effect of ASAL on the mortality of mustard aphid was comparable to the results shown by Dutta et al. [11]. Insect mortality in the present ASAL expressing transgenic plants was 70% which is comparable to 89% observed by Dutta et al. [11] while in control plants the insect mortality was 35%. However, insect mortality observed in the present study was either comparable or higher than most of the results of earlier work where constitutive expression of GNA led to mortality of BPH up to 48 -62% [55] and 45-50% [56] and in case of GLH up to 51-54% [56]. But Sengupta et al. [33] documented insect mortality in ASAL expressing rice plants as high as 72% in GLH and 71% in BPH bioassay. The level of ASAL expression observed in the transgenic mustard plants was fairly comparable to the data of Dutta et al. [11]. The level of ASAL expression was also correlated with the fecundity of the insects. The number of nymphs produced per plant was reduced compared to control plants. Usually L. erysimi propagates parthenogenetically, resulting in formation of huge population in a short period of time. Thus, reduction in number of nymphs produced due to the effect of ASAL is of considerable significance in controlling aphid infestation.

Conclusions

The present study significantly establishes the efficient expression of the insect resistant ASAL gene in transgenic Brassica juncea plants following Cre/lox mediated recombination which resulted in the elimination of the selectable marker gene. This important achievement has a great impact on development of insect-resistant, environment- friendly mustard crop which could be important components of integrated pest management programme.

Abbreviations

ANOVA: Analysis of variance; ASAL: Allium sativum leaf agglutinin; ELISA: Enzyme-linked immunosorbent assay; SMG: Selectable marker gene; PBS: Phosphate buffered saline; hpt: Hygromycin phosphotransferase.

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

AB, AR and AD conceived the experiments: AB and AR performed western blotting, hemagglutination and thermal stability assay. AB and AD carried out Southern analysis, ELISA and in planta insect bioassay experiments. All the other experiments were done by AB. AB, AR, AD, DC and SD prepared the manuscript. SD supervised the research. All authors have read and approved the final manuscript.

Contributor Information

Arpita Bala, Email: bala.arpita9@gmail.com.

Amit Roy, Email: amitroy_81@yahoo.co.in.

Ayan Das, Email: ayandas80@gmail.com.

Dipankar Chakraborti, Email: dipankar_12@yahoo.co.in.

Sampa Das, Email: sampa@jcbose.ac.in.

Acknowledgements

The authors are thankful to Department of Biotechnology, Government of India for financial support. AR and AD are thankful to Council of Scientific and Industrial Research for providing fellowship. The technical assistance of Mr. Arup Kumar Dey, Mr. Swarnava Das and Mr. Sudipta Basu are sincerely acknowledged.

References

  1. Amjad M, Islam N, Kakakhel SA. Turnip aphid Lipaphis erysimi Kalt. (Homoptera: Aphididae) biology, intrinsic rate of increase and development threshold temperature on oilseed Brassica. Pakistan J of Bio Sci. 1999;2:599–602. [Google Scholar]
  2. Singh P, Sinhal VK. Effect of aphid infestation on the biochemical constituents of mustard (Brassica juncea) plant. J Phytology. 2011;3:28–33. [Google Scholar]
  3. Rana JS. Performance of Lipaphis erysimi (Homoptera: Aphididae) on different Brassica species in a tropical environment. J Pest Sci. 2005;78:155–160. doi: 10.1007/s10340-005-0088-3. [DOI] [Google Scholar]
  4. Sharma S, Gill CK. Comparative efficiency of Myzus persicae (Sulzer) and Lipaphis erysimi (Kaltenbach) in transmitting radish mosaic virus. J Res. 2004;41:239–245. [Google Scholar]
  5. Dombrovsky A, Huet H, Chejanovsky N, Raccah B. Aphid transmission of a potyvirus depends on suitability of the helper component and the N terminus of the coat protein. Arch Virol. 2005;150:287–298. doi: 10.1007/s00705-004-0407-7. [DOI] [PubMed] [Google Scholar]
  6. Rao KV, Rathore KS, Hodges TK, Fu X, Stoger E, Sudhakar S, Williams P, Christou P, Bharathi M, Brown DP, Powell KS, Spence J, Gatehouse A, Gatehouse JA. Expression of snpwdrop lectin (GNA) in transgenic plants confers resistance to rice brown plant hopper. Plant J. 1998;15:469–477. doi: 10.1046/j.1365-313X.1998.00226.x. [DOI] [PubMed] [Google Scholar]
  7. Hilder VA, Powell KS, Gatehouse AMR, Gatehouse J, Gatehouse LN, Shi Y, Halminton W, Merryweather A, Newell CA, Timans JC. Expression of snowdrop lectin in transgenic tobacco plants results in added protection against aphids. Transgenic Res. 1995;4:18–25. doi: 10.1007/BF01976497. [DOI] [Google Scholar]
  8. Powell KS, Gatehouse AMR VAH, Gatehouse AJ. Antifeedant effects of plant lectins and an enzyme on the adult stage of the rice brown planthopper, Nilaparvata legens. Entomol Exp Appl. 1995;75:51–59. doi: 10.1111/j.1570-7458.1995.tb01909.x. [DOI] [Google Scholar]
  9. Fitches E, Gatehouse AMR, Gatehouse JA. Effects of snowdrop lectin (GNA) delivered via artificial diet and transgenic plants on the development of tomato moth (Lacanobia oleracea) larvae in laboratory and glasshouse trials. J Insect Physiol. 1997;43:727–739. doi: 10.1016/S0022-1910(97)00042-5. [DOI] [PubMed] [Google Scholar]
  10. Gatehouse A, Gatehouse J. Identifying proteins with insecticidal activity: use of encoding genes to produce insect resistant transgenic crops. Pestic Sci. 1998;52:165–175. doi: 10.1002/(SICI)1096-9063(199802)52:2<165::AID-PS679>3.0.CO;2-7. [DOI] [Google Scholar]
  11. Dutta I, Majumder P, Saha P, Ray K, Das S. Constitutive and phloem specific expression of Allium sativum leaf agglutinin (ASAL) to engineer aphid (Lipaphis erysimi) resistance in transgenic Indian mustard (Brassica juncea) Plant Sci. 2005;169:996–1007. doi: 10.1016/j.plantsci.2005.05.016. [DOI] [Google Scholar]
  12. Saha P, Dasgupta I, Das S. A novel approach for developing resistance in rice against phloem limited viruses by antagonizing the phloem feeding hemipteran vectors. Plant Mol Biol. 2006;62:735–752. doi: 10.1007/s11103-006-9054-6. [DOI] [PubMed] [Google Scholar]
  13. Chakraborti D, Sarkar A, Mondal H, Das S. Tissue specific expression of potent insecticidal Allium sativum leaf agglutinn (ASAL) in important pulse crop, chickpea (Cicer arietinum L.) to resist the phloem feeding Aphis craccivora. Transgenic Res. 2009;18:529–544. doi: 10.1007/s11248-009-9242-7. [DOI] [PubMed] [Google Scholar]
  14. Aragao FJL, Brasileiro ACM. Positive, negative and marker-free strategies for transgenic plant selection. Braz J of Plant Physiol. 2002;14:1–10. doi: 10.1590/S1677-04202002000100001. [DOI] [Google Scholar]
  15. Daniell H. Molecular strategies for gene containment in transgenic crops. Nat Biotechnol. 2002;20:581–586. doi: 10.1038/nbt0602-581. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Dale PJ, Clarke B, Fontes EMG. Potential for the environmental impact of transgenic crops. Nat Biotechnol. 2002;20:567–574. doi: 10.1038/nbt0602-567. [DOI] [PubMed] [Google Scholar]
  17. Puchta H. Marker-free transgenic plants. Plant Cell Tissue Org Cult. 2003;74:123–134. doi: 10.1023/A:1023934807184. [DOI] [Google Scholar]
  18. Warwick SI, Simard MJ, Légère A, Beckie HJ, Braun L, Zhu B, Mason P, Séguin-Swartz G, Stewart CN Jr. Hybridization between transgenic Brassica napus L. and its wild relatives: Brassica rapa L., Raphanus raphanistrum L., Sinapis arvensis L., and Erucastrum gallicum (Willd.) O.E. Schulz. Theor Appl Genet. 2003;107:528–539. doi: 10.1007/s00122-003-1278-0. [DOI] [PubMed] [Google Scholar]
  19. Londo JP, Bautista NS, Sagers CL, Lee EH, Watrud LS. Glyphosate drift promotes changes in fitness and transgene gene flow in canola (Brassica napus) and hybrids. Ann Bot. 2010;106:957–965. doi: 10.1093/aob/mcq190. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Yau Y, Stewart Jr CN. Less is more: strategies to remove marker genes from transgenic plants. BMC Biotechnol. 2013;13:36. doi: 10.1186/1472-6750-13-36. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Ebinuma H, Sugita K, Matsunaga E, Yamakado M. Selection of marker-free transgenic plants using the iso-pentenyl transferase gene. Proc Natl Acad Sci. 1997;94:2117–2121. doi: 10.1073/pnas.94.6.2117. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Ow DW. The right chemistry for marker gene removal? Nat Biotechnol. 2001;19:115–116. doi: 10.1038/84362. [DOI] [PubMed] [Google Scholar]
  23. Darbani B, Eimanifar A, Stewart CN, Camargo WN. Methods to produce marker-free transgenic plants. Biotechnol J. 2007;2:83–90. doi: 10.1002/biot.200600182. [DOI] [PubMed] [Google Scholar]
  24. Tuteja N, Verma S, Sahoo RK, Raveendar S, Reddy IBL. Recent advances in development of marker-free transgenic plants: regulation and biosafety concern. J Biosci. 2012;37:167–197. doi: 10.1007/s12038-012-9187-5. [DOI] [PubMed] [Google Scholar]
  25. Lu HJ, Zhou XR, Gong ZX, Upadhyaya NM. Generation of selectable marker-free transgenic rice using double right-border (DRB) binary vectors. Aust J Plant Physiol. 2001;28:241–248. [Google Scholar]
  26. Sripriya R, Sangeetha M, Parameswari C, Veluthambi B, Veluthambi K. Improved Agrobacterium-mediated co-transformation and selectable marker elimination in transgenic rice by using a high copy number pBin19-derived binary vector. Plant Sci. 2011;180:766–774. doi: 10.1016/j.plantsci.2011.02.010. [DOI] [PubMed] [Google Scholar]
  27. Cotsaftis O, Sallaud C, Breitler JC, Meynard D, Greco R, Pereira A, Guiderdoni E. Transposon-mediated generation of T-DNA and marker free rice plants expressing a Bt endotoxin gene. Mol Breed. 2002;10:165–180. doi: 10.1023/A:1020380305904. [DOI] [Google Scholar]
  28. Charng YC, Li KT, Tai HK, Lin NS, Tu J. An inducible transposon system to terminate the function of a selectable marker in transgenic plants. Mol Breed. 2008;21:359–368. doi: 10.1007/s11032-007-9137-3. [DOI] [Google Scholar]
  29. Khan RS, Nakamura I, Mii M. Development of disease resistant marker-free tomato by R/RS site-specific recombination. Plant Cell Rep. 2011;30:1041–1053. doi: 10.1007/s00299-011-1011-4. [DOI] [PubMed] [Google Scholar]
  30. Chakraborti D, Sarkar A, Mondal H, Schuermann D, Hohn B, Sarman B, Das S. Cre/lox system to develop selectable marker free transgenic tobacco plants conferring resistance against sap sucking homopteran insect. Plant Cell Rep. 2008;27:1623–1633. doi: 10.1007/s00299-008-0585-y. [DOI] [PubMed] [Google Scholar]
  31. Kopertekh L, Broer I, Schiemann J. Developmentally regulated site-specific marker gene excision in transgenic B. napus plants. Plant Cell Rep. 2009;28:1075–1083. doi: 10.1007/s00299-009-0711-5. [DOI] [PubMed] [Google Scholar]
  32. Li B, Li N, Duan X, Wei A, Yang A, Zhang J. Generation of marker-free transgenic maize with improved salt tolerance using the FLP/FRT recombination system. J Biotechnol. 2010;145:206–213. doi: 10.1016/j.jbiotec.2009.11.010. [DOI] [PubMed] [Google Scholar]
  33. Sengupta S, Chakraborti D, Mondal HA, Das S. Selectable antibiotic resistance marker gene-free transgenic rice harbouring the garlic leaf lectin gene exhibits resistance to sap-sucking planthoppers. Plant Cell Rep. 2010;29:261–271. doi: 10.1007/s00299-010-0819-7. [DOI] [PubMed] [Google Scholar]
  34. Ghosh K, Duyne GDV. Cre-loxP Biochemistry. Methods. 2002;28:374–383. doi: 10.1016/S1046-2023(02)00244-X. [DOI] [PubMed] [Google Scholar]
  35. Hoa TTC, Bong BB, Hug E, Hodge TK. Cre/lox site-specific recombination controls the excision of a transgene from the rice genome. Theor Appl Genet. 2002;104:518–525. doi: 10.1007/s001220100748. [DOI] [PubMed] [Google Scholar]
  36. Zuo J, Niu QW, Møller SG, Chua NH. Chemical-regulated, site-specific DNA excision in transgenic plants. Nat Biotechnol. 2001;19:157–161. doi: 10.1038/84428. [DOI] [PubMed] [Google Scholar]
  37. Arumugam N, Gupta V, Jagannath A, Mukhopadhyay A, Pradhan A, Pental D. A passage through in vitro culture leads to efficient production of marker-free transgenic plants in Brassica juncea using the Cre/loxP system. Transgenic Res. 2007;16:703–712. doi: 10.1007/s11248-006-9058-7. [DOI] [PubMed] [Google Scholar]
  38. Sreekala C, Wu L, Gu K, Wang D, Tian D, Yin Z. Excision of selectable marker in transgenic rice (Oryza sativa L.) using a chemically regulated Cre/loxP system. Plant Cell Rep. 2005;24:86–94. doi: 10.1007/s00299-004-0909-5. [DOI] [PubMed] [Google Scholar]
  39. Wang Y, Chen B, Hu Y, Li J, Lin Z. Inducible excision of selectable marker gene from transgenic plants by the Cre/lox site-specific recombination system. Transgenic Res. 2005;14:605–614. doi: 10.1007/s11248-005-0884-9. [DOI] [PubMed] [Google Scholar]
  40. Mehra S, Pareek A, Bandyopadhyay P, Sharma P, Burma PK, Pental D. Development of transgenics in Indian oilseed mustard (Brassica juncea) resistant to herbicide phosphinothricin. Curr Sci. 2000;78:1358–1364. [Google Scholar]
  41. Dellaporta SJ, Wood J, Hicks JB. A Plant DNA minipreparation: version II. Plant Mol Biol Rep. 1983;4:19–21. [Google Scholar]
  42. Sambrook J, Fritsch E, Maniatis T. Molecular clonning: a laboratory manual, 2nd edn. Cold Spring Harbor: Cold Spring Harbor Laboratory Press; 1989. [Google Scholar]
  43. Bandyopadhyay S, Roy A, Das S. Binding of garlic (Allium sativum) leaf lectin to the gut receptors of homopteran pests is correlated to its insecticidal activity. Plant Sci. 2001;161:1025–1033. doi: 10.1016/S0168-9452(01)00507-6. [DOI] [Google Scholar]
  44. Banerjee N, Sengupta S, Roy A, Ghosh P, Das K, Das S. Functional alteration of a dimeric insecticidal lectin to a monomeric antifungal protein correlated to its oligomeric status. Plos One. 2011;6:18593. doi: 10.1371/journal.pone.0018593. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Mondal HA, Chakraborti D, Majumder P, Roy P, Roy A, Bhattacharya SG, Das S. Allergenicity assessment of Allium sativum leaf agglutinin, a potential candidate protein for developing sap sucking insect resistant food crops. Plos One. 2011;6:e27716. doi: 10.1371/journal.pone.0027716. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Bryant J, Leather S. Removal of selectable marker genes from transgenic plants: needless sophistication or social necessity. Trends Biotechnol. 1992;10:274–275. [Google Scholar]
  47. Gressel J. Indiscriminate use of selectable markers - sowing wild oats? Trends Biotechnol. 1992;10:382. [Google Scholar]
  48. Gleave AP, Mitra DS, Mudge SR, Morris BA. Selectable marker-free transgenic plants without sexual crossing: transient expression of cre recombinase and use of a conditional lethal dominant gene. Plant Mol Biol. 1999;40:223–235. doi: 10.1023/A:1006184221051. [DOI] [PubMed] [Google Scholar]
  49. Zhang W, Subbarao S, Addae P, Shen A, Armstrong C, Peschke V, Gilbertson L. Cre/lox-mediated marker gene excision in transgenic maize (Zea mays L.) plants. Theor Appl Genet. 2003;107:1157–1168. doi: 10.1007/s00122-003-1368-z. [DOI] [PubMed] [Google Scholar]
  50. Bar M, Lesham B, Gilboa N, Gidoni D. Visual characterization of recombination at FRT-gusA loci in transgenic tobacco mediated by constitutive expression of the native FLP recombinase. Theor Appl Genet. 1996;43:407–413. doi: 10.1007/BF00223183. [DOI] [PubMed] [Google Scholar]
  51. Stuurman J, de Vroomen MJ, Nijkamp HJJ, M.J.J H. Single-site manipulation of tomato chromosomes in vitro and in vivo using Cre-lox site-specific recombination. Plant Mol Biol. 1996;32:901–903. doi: 10.1007/BF00020487. [DOI] [PubMed] [Google Scholar]
  52. Onouchi H, Nishimana R, Kudo M, Machida Y, Machida C. Visualization of site-specific recombination catalyzed by a recombinase from Zygosaccharomyces rouxii in Arabidopsis thaliana. Mol Gen Genet. 1995;247:653–660. doi: 10.1007/BF00290396. [DOI] [PubMed] [Google Scholar]
  53. Bayley CC, Morgan M, Dale EC, Ow DW. Exchange of gene activity in transgenic plants catalyzed by the Cre- lox site-specific recombination system. Plant Mol Biol. 1992;18:353–362. doi: 10.1007/BF00034962. [DOI] [PubMed] [Google Scholar]
  54. Bala A, Roy A, Behura N, Hess D, Das S. Insight to the mode of action of Allium sativum leaf agglutinin (ASAL) expressing in T3 rice lines on brown planthopper. Am J of Plant Sci. 2013;4:400–4007. doi: 10.4236/ajps.2013.42A052. [DOI] [Google Scholar]
  55. Loc NT, Tinjuangjun P, Gatehouse AMR, Christou P, Gatehouse JA. Linear transgene constructs lacking vector backbone sequences generate transgenic rice plants which accumulate higher levels of proteins conferring insect resistance. Mol Breed. 2002;9:231–244. doi: 10.1023/A:1020333210563. [DOI] [Google Scholar]
  56. Ramesh S, Nagadhara D, Reddy VD, Rao KV. Production of transgenic indica rice resistant to yellow stem borer and sap-sucking insects using super- binary vectors of Agrobacterium tumefaciens. Plant Sci. 2004;166:1077–1085. doi: 10.1016/j.plantsci.2003.12.028. [DOI] [Google Scholar]

Articles from BMC Biotechnology are provided here courtesy of BMC

RESOURCES