Abstract
Background
Cystic Fibrosis (CF) patients are vulnerable to airway colonization with Pseudomonas aeruginosa. In case eradication fails after antibiotic treatment, patients become chronically colonized with P. aeruginosa, with recurrent pulmonary exacerbation, for which patients typically are hospitalized for 2 weeks and receive intravenous antibiotic treatment. Normally, improvement of the patients' health is established.
Aim
Determination of the correspondence between patient improvement and changes of the P. aeruginosa and total bacterial load in the sputum.
Methods
Eighteen CF patients with exacerbation were included for a total of 27 hospitalization episodes. At day 1, 8 and 15, inflammation and lung function parameters were determined, together with the P. aeruginosa load in the sputum using culture, quantitative PCR (qPCR) and propidium monoazide qPCR.
Results
Patients improved during hospitalization (decrease in levels of C-reactive protein, white blood cell counts and erythrocyte sedimentation rate, increase of FEV1), reaching normal values already after one week. Also the P. aeruginosa load and the total bacterial load decreased during the first week of antibiotic treatment (p<0.05), except for patients with a low lung function (FEV1≤39.4%), for whom no significant decrease of P. aeruginosa was established. Comparison of culture-based and propidium monoazide qPCR-based quantification of P. aeruginosa showed that at the end of the treatment on average 62% of the P. aeruginosa cells are not cultivable, indicating that many cells are alive but dormant, or dead but still structurally intact.
Conclusion
Improvement of the clinical status is accompanied with a decrease of the P. aeruginosa load, whereby both occur mainly during the first week of antibiotic treatment. However, for patients with a low lung function, no decrease of the P. aeruginosa load is observed. Comparison of detection techniques shows that a large amount of noncultivable or dead bacteria are present in the samples.
Introduction
In cystic fibrosis (CF), the CFTR protein, which is expressed in epithelial cells, is not or only partially functional due to mutations in the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene. As a consequence, these patients are vulnerable to pulmonary bacterial infections. Although a diverse set of bacterial species can be found in the CF airways [1], 80% of the patients at the age of 25–34 are colonized with Pseudomonas aeruginosa, which is still the most frequently isolated pathogen in CF patients [1]. In many CF centres, the patients immediately receive aggressive antibiotic treatment aiming at early eradication in case of P. aeruginosa isolation in respiratory samples [2]–[5]. However, complete eradication is not always achieved and patients may become colonized. Colonized patients often have recurrent infectious pulmonary exacerbations which is associated with bronchial damage, reduced lung function, a faster decline in lung function and a decreased median survival time [6]–[10]. The cause for the increased frequency of these pulmonary exacerbations remains poorly understood. It has been shown that the increased frequency is at least partially correlated with oestrogens, the use of inhaled steroids, lower FEV1 and/or a high frequency of previous exacerbations [11], [12]. At the Ghent University Hospital, patients with an exacerbation are hospitalized for a period of 2 weeks and receive intravenous antibiotics (aminoglycoside and beta-lactam).
Although in general, CF patients improve during this hospitalization period, the reason for the improvement is still not well explored. In this study, we investigated whether this improvement can be correlated with a change in P. aeruginosa density and/or a change of the total bacterial density in the sputum.
Materials and Methods
Patients and sampling
This study was approved by the ethical committee of Ghent University Hospital (B67020109390). Written informed consent was obtained from all the patients >18 years, or from the parents and children older than 12 years.
All 18 patients that participated in the study were chronically colonized with P. aeruginosa (according to the European Consensus Criteria [2]). Clinical data and the antibiotic regime for each patient are shown in Table 1. Sputum and blood samples were collected at day 1 (prior to the start of the antibiotic treatment on the same day), day 8 and day 15 of treatment for a total of 27 hospitalization periods, and inflammation parameters (C-reactive protein (CRP), white blood cells (WBC), erythrocyte sedimentation rate (ESR) and lung function (FEV1 and FVC) were determined.
Table 1. Overview of the clinical background of the patients and the antibiotic treatment received during hospitalization.
| Patient | Gender | Age | CFTR Genotype | # Episodes | Antibiotic treatmenta | |||||
| Macrolide | TOBb | COLb | MPMb | TAZb | CAZb | |||||
| 1 | M | 26 | ΔF508/ΔF508 | 1 | Yes | Yes | ? | ? | Yes | ? |
| 2 | V | 20 | ΔF508/ΔF508 | 3 | Yes | Yes (2, 3)c | Yes (1, 2, 3) | Yes (1, 2, 3) | No | No |
| 3 | M | 24 | ΔF508/ΔF508 | 2 | Yes | Yes (1, 2) | No | No | Yes (1) | Yes (2) |
| 4 | M | 23 | ΔF508/1717–1G-A | 1 | Yes | Yes | No | No | Yes | No |
| 5 | M | 14 | ΔF508/ΔF508 | 2 | Yes | Yes (1, 2) | No | No | Yes (1, 2) | No |
| 6 | V | 28 | ΔF508/ΔF508 | 1 | Yes | Yes | No | No | No | Yes |
| 7 | M | 14 | ΔF508/G502X | 2 | Yes | Yes (1, 2) | No | No | Yes (2) | Yes (1) |
| 8 | V | 31 | ΔF508/ΔF508 | 3 | Yes | Yes (1, 2, 3) | Yes (1, 2, 3) | No | Yes (3) | Yes (1, 2) |
| 9 | V | 28 | ΔF508/ΔF508 | 2 | Yes | Yes (2) | No | No | Yes (2) | Yes (1) |
| 10 | M | 16 | ΔF508/ΔF508 | 1 | Yes | Yes (1) | No | No | No | Yes (1) |
| 11 | M | 30 | ΔF508/ΔF508 | 2 | Yes | Yes (1, 2) | No | Yes (1, 2)e | Yes (1)e | No |
| 12 | V | 18 | ΔF508/L927P | 1 | Yes | Yes | No | No | No | Yes |
| 13 | V | 25 | ΔF508/ΔF508 | 1 | No | Yesd | Yesd | No | Yes | No |
| 14 | M | 29 | ΔF508/N1303K | 1 | Yes | No | Yes | No | Yes | No |
| 15 | M | 34 | ΔF508/S1251N | 1 | Yes | No | No | No | Yesd | No |
| 16 | V | 19 | ΔF508/ΔF508 | 1 | No | Yes | No | No | Yes | No |
| 17 | V | 44 | ΔF508/ΔF508 | 1 | Yes | Yes | No | No | Yes | No |
| 18 | V | 22 | ΔF508/ΔF508 | 1 | Yes | Yes | No | No | Yes | No |
Legend:
a: Antibiotic during hospitalization (except for the macrolide treatment).
b: TOB: tobramycin, COL: colimycine, MPM: meropenem, TAZ: tazocin, CAZ: ceftazidim.
c: Numbers between brackets: episode numbers during which the antibiotic was administered.
d: TOB was replaced by COL after one week of treatment.
e: During the first episode, TAZ was replaced by MPM after one week of treatment.
Sample processing
Sputum samples were homogenized with Sputasol (Oxoid Ltd., Basingstoke, UK) (1∶1, vol/vol, 1 h incubation at 37°C). Samples were processed immediately after arrival at the lab, within 4 hours of sample collection.
Microbiological culture
Homogenized sputum samples were diluted serially tenfold in physiological saline. Twenty five µl of each dilution was inoculated in triplicate on cetrimide agar plates. The P. aeruginosa load was determined after 72 h of incubation at 37°C in ambient atmosphere.
Propidium monoazide based inactivation of DNA from dead cells
In order to inhibit the amplification of the DNA derived from dead bacteria in the respiratory samples, the samples were treated with propidium monoazide (PMA) [13], [14]. In order to improve the PMA cross-linking efficacy, the homogenized sputum sample was split in four parts of each 200 µl and washed 3 times (centrifugation for 5 min at 5000 g followed by resuspension of the pellet in saline). After the final washing step, the 4 washed aliquots were transferred to a 24-well plate and 10 µl 1 mM PMA (final concentration: 50 mM) (Biotium, Hayward, CA) was added to two 190 µl sample aliquots (for PMA-qPCR) and 10 µl saline was added to the other two 190 µl sample aliquots. After 30 min incubation in the dark on a shaker, the samples were exposed to a 500 W halogen light source for 10 min at a distance of 20 cm. During exposure, the 24-well plate was kept on ice to avoid overheating of the samples.
DNA extraction
DNA extraction from the sputum samples was performed as described previously [15], [16]. Briefly, the sputum aliquots, pretreated or not with 1 mM PMA as described above, were pre-incubated during 1 h at 55°C with 200 µl proteinase K buffer (1 mg/ml proteinase K, 0.5% SDS, 20 mM Tris-HCl, pH 8.3), after which the DNA was extracted using the bioMérieux easyMAG Nuclisens extractor (bioMérieux, Marcy-l′Étoile, France).
Quantitative PCR
Quantitative PCR (qPCR) was performed as described previously [16]. All qPCR formats were carried out on the LightCycler480 (Roche, Basel, Switzerland), using the LightCycler480 SYBR Green kit (Roche)(for quantification of 16S rDNA) or the LightCycler480 Probes Master kit (for P. aeruginosa). Primers and probes used in this study are listed in Table 2. The 16S rDNA SYBR Green kit contained 5 µl SYBR Green Master Mix, 0.3 µM of each primer and 2 µl of DNA-extract. The final reaction volume was made up to 10 μl by adding HPLC water. For the P. aeruginosa hydrolysis probe assay, the reaction mixture contained 5 µl Probes Master kit, 0.5 µM of each primer, 0.1 µM of hydrolysis probe and 2.5 µl of DNA-extract, and the final reaction volume was made up to 10 µl by adding HPLC water. A standard tenfold dilution series was prepared by DNA-extraction from a dense suspension of log phase P. aeruginosa strain PA14. The P. aeruginosa DNA concentration was measured using the Nanodrop D1000, and the number of P. aeruginosa cells (chromosomes) originally present was calculated. This standard dilution series was used in the qPCR to construct a standard curve, which enabled to relate the number of cells to Cq-values, and to calculate the number of P. aeruginosa cells present in the samples.
Table 2. Primers used in this study.
| Target | Primers/Probes | Sequence (5′→3′) | Annealing Temp (°C) | Reference |
| Universal 16S rDNA | αβNOT (forward) | AGTTTGATCCTGGCTCAG | 50 | [37] |
| Gamma (reversed) | ACTGCTGCCTCCCGTAGGAG | 50 | ||
| P. aeruginosa - oprL | Forward | ACC CGA ACG CAG GCT ATG | 55 | [15], [16] |
| Reversed | CAG GTC GGA GCT GTC GTA CTC | 55 | ||
| Hydrolysis probe | 6FAM-AGAAGGTGGTGATCGCACGCAGA-BBQ |
Statistical analysis
Statistical analysis was performed using the IBM SPSS Statistics 20 software package. Paired non-parametric tests were performed using the Wilcoxon test. P-values below 0.05 were considered as statistically significant. The statistical correlation between different parameters was assessed by means of the Spearman's correlation test.
Results
During 16 months, 18 patients (nine male, median age: 24.5 years) were included for a total of 27 hospitalization episodes (Table 1). For eleven patients, there was only one hospitalization episode, while five patients had two hospitalization episodes and two patients had three. In case of multiple hospitalization episodes, the median time interval between these episodes was 6 months.
Parameters of clinical improvement
Overall, there was a statistically significant improvement of all the parameters during the full hospitalization period (Table 3). For all parameters, the major improvement occurred during the first week of treatment (statistically significant for CRP decrease (p<0.001), WBC decrease (p = 0.007), FEV1 increase (p = 0.001) and FVC increase (p = 0.001)) and CRP, ESR and WBC values approached normal values. During the second week, there were no significant changes in any of these parameters. Considering the total treatment period, all parameters significantly improved.
Table 3. Median values (ranges) for 27 episodes of hospitalization (18 patients) for the clinical parameters obtained at days 1, 8 and 15 of hospitalization.
| Parameters | Median Day 1 | Median Day 8 | Median Day 15 |
| CRP (mg/L) | 22 (1–123) | 4* (1–4.7) | 4* (1–3.1) |
| WBC (103 cells/µl) | 11.61 (6.12–32.83) | 9.42* (4.93–14.80) | 9.41* (4.02–14.45) |
| ESR (mm/h) | 27 (4–62) | 23 (2–70) | 20* (2–62) |
| FVC (%) | 70 (29–99) | 77* (39–117) | 80* (37–113) |
| FEV1 (%) | 44 (0.16–0.82) | 53* (0.19–1.03) | 55* (0.19–1.00) |
Significant change in comparison with day 1, p<0.05 (Wilcoxon).
Total bacterial load and P. aeruginosa load
The change in P. aeruginosa sputum density during the treatment period was determined by three methods, i.e. i) quantitative culture of the bacteria on cetrimide agar, selective for P. aeruginosa, ii) propidium-monoazide qPCR (PMA-qPCR) and iii) qPCR, both specific for P. aeruginosa. Since, theoretically, PMA-qPCR only amplifies DNA of living cells (cultivable and non-cultivable), this approach is considered to provide the most relevant bacterial load estimates in this study, because culture does not detect the dormant cells and qPCR also quantifies DNA from killed cells. The PMA-qPCR median value on day 1 was 4.15×107 cells/ml, whereas it was 1.08×107 cells/ml on day 8 and 5.37×106 cel-ls/ml on day 15 (Figure 1). For PMA-qPCR and for qPCR, the decrease of P. aeruginosa was only statistically significant during the first week of treatment (PMA-qPCR p = 0.002, qPCR p = 0.001) and for the total treatment period (PMA-qPCR p = 0.006, qPCR p = 0.012). According to culture results, there was a statistically significant decrease during the first week of treatment (day 1– day 8) (p = 0.03). However, during the second week of treatment (day 8– day 15) there was an increase of the amount of P. aeruginosa cells detected by culture (p = 0.046). Still, when considering the total treatment period (day 1– day 15), the overall decrease was significant (p = 0.037).
Figure 1. Median density (for 27 samples from 18 patients) of P. aeruginosa cells/ml sputum at hospitalization days 1, 8 and 15, as determined by the three quantification techniques, i.e. culture, qPCR and PMA-qPCR.

* = statistically significant (p<0.05).
In this study, the values obtained with qPCR and PMA-qPCR are on average 0.5 log10 higher than those obtained by culture (culture vs PMA-qPCR p = 0.022, culture vs qPCR p = 0.008) (Figure 1), indicating that a significant part of the P. aeruginosa cells in the sputum is alive but not cultivable. However, it should be noted that part of the cells may be dead but still structurally intact, with as a result that PMA can not invade the cells and as such not inhibit the amplification of DNA of dead cells, leading to an underestimation of the number of dead cells. Moreover, PMA-qPCR values were on average 0.1 log10 lower than those obtained with qPCR, suggesting that part of the bacterial cells were dead/killed.
Also the total bacterial load (by means of a general 16S rRNA gene qPCR) was determined on the PMA-treated samples. Although, there was no significant decrease over the one week intervals (day 1– day 8 and day 8– day 15), the decrease over 15 days was significant (p = 0.048).
Correlation between parameters of clinical improvement and bacterial load
During the first week of treatment, not only the parameters WBC, ESR, CRP and FEV1 (Table 3), but also the P. aeruginosa density, as determined by means of culture, PMA-qPCR and qPCR, decreased significantly (all p<0.05) (Figure 1). During the second week of treatment, no statistically significant improvements of the clinical parameters were observed as well as no statistically significant decreases of the P. aeruginosa load. Grouping the patients based on their FEV1 values at the start of the hospitalization episode (first quartile: 4 patients (for 7 episodes) with FEV1≤39.4%; fourth quartile: 6 patients (for 7 episodes) with FEV1≥73.0%) shows that for the 4th quartile (FEV1≥73.0%), i.e. the patients with the best lung function, the decrease of P. aeruginosa load during the treatment is significant for PMA-qPCR (p = 0.011) and qPCR (p = 0.026), while no statistical significant decrease is established for the patients with a FEV1≤39.4% (PMA-qPCR p = 0.128, qPCR p = 0.209) (Table 4).
Table 4. Median and range of P. aeruginosa loads (cfu/ml for culture, chromosomes/ml for qPCR) of the patients, grouped based on the FEV1 values at the end of the treatment (Q1: FEV1≤39.4%, Q4: FEV1≥73.0%).
| Quantification technique | FEV1 quartile | Day 1 | Day 8 | Day 15 |
| Culture | Q1 | 1.7×107 | 1.8×106 | 6.2×105 |
| 6.3×104–2.1×108 | 5.8×104–3.1×107 | 0–1.4×108 | ||
| Q4 | 2.6×107 | 1.0×104 | 0 | |
| 2.2×105–8.4×107 | 0–6.0×106 | 0–5.0×107 | ||
| PMA-qPCR | Q1 | 7.6×107 | 1.3×107 | 8.9×106 |
| 1.6×104–3.4×108 | 0–5.8×107 | 0–9.4×107 | ||
| Q4 | 5.1×107 | 6.6×104 a | 5.8×104 b | |
| 6.1×104–1.7×108 | 1.9×104–1.7×107 | 1.1×104–3.6×107 | ||
| qPCR | Q1 | 7.2×107 | 3.0×107 | 2.4×107 |
| 1.5×104–2.8×108 | 0–8.3×107 | 0–1.8×108 | ||
| Q4 | 6.6×107 | 2.2×105 a | 9.9×104 b | |
| 9.1×104–1.7×108 | 2.7×104–4.5×107 | 1.7×104–5.8×107 |
a: Statistical significant decrease of P. aeruginosa after the first week of treatment (p<0.05).
b: Statistical significant decrease of P. aeruginosa after two weeks of treatment (p<0.05).
Uncultivable cells
As indicated in Figure 1, the P. aeruginosa values obtained by PMA-qPCR (estimating the load of all living cells) are 0.5 log10 higher compared to those obtained by culture (estimating the load of the cultivable cell fraction), indicating that a part of the P. aeruginosa bacteria is not cultivable. Considering all episodes, 41.7% of all living P. aeruginosa bacterial cells are not cultivable at day 1, 90.2% not at day 8 and 62.6% not at day 15 (Table 5). When comparing the patients with poor lung function (Q1, FEV1 value ≤39.4%) with those with a high FEV1 value (Q4, ≥73.0%), the former have already a high amount of not cultivable cells at the start of the treatment (5.86×107/ml, 77.3%), while for the patients with good lung function only 49.1% (2.51×107/ml) of the cells are not cultivable. At the end of the treatment both groups have a high proportion of dormant cells (FEV1 Q1: 93.1% and FEV1 Q4: 100%). However, the absolute values are 100-fold lower for the patients with good lung function (5.83×104/ml) compared to those with poor lung function (8.32×106/ml) (Table 5).
Table 5. Amount of dormant P. aeruginosa bacterial cells (/ml) in the CF sputum, i.e. number of cells obtained by means of PMA-qPCR minus the number of cells obtained by means of culturing (mean values).
| All episodes (27) | FEV1 Q1 (7) | FEV1 Q4 (7) | |
| Day 1 | 1.93×107 (41.7%) | 5.86×107 (77.3%) | 2.51×107 (49.1%) |
| Day 8 | 9.74×106 (90.2%) | 1.16×107 (86.6%) | 5.64×104 (84.9%) |
| Day 15 | 3.36×106 (62.6%) | 8.32×106 (93.1%) | 5.83×104 (100%) |
The relative amount of dormant P. aeruginosa bacteria against all living P. aeruginosa bacteria is indicated between brackets.
Discussion
Intravenous antibiotic treatment improves clinical parameters
It is common practice to hospitalize CF patients with a pulmonary exacerbation for a 14-day treatment period [17]–[22]. In agreement with other studies [17]–[22], we observed an improvement of the clinical parameters of the treated patients over a 14-day treatment period. In some papers, also a 10-day period of intravenous treatment is found to be sufficient to improve the clinical parameters [23]–[27]. Indeed, our data indicate that inflammation parameters (CRP, WBC, ESR) and lung function (measured as FEV1 and FVC) significantly improve during the first week, with no further significant improvement during the second week. It should be noted that after one week the values had already returned to normal, such that further improvement during the second week is not expected. As stated by Plummer and Wildman [28], a shorter treatment may have several benefits, such as improvement of the life quality of the patient and a lower hospitalization cost, but they also remark that the outcome on the long term of such short treatment periods is unknown and that, for instance, the relapse time to the next exacerbation might be shorter.
Intravenous antibiotic treatment decreases total bacterial load and P. aeruginosa load
In accordance with the change of the clinical parameters and in accordance with the culture-based study of Regelmann et al. [18], the major decrease of total bacterial load and of P. aeruginosa load occurred during the first week of treatment.
The number of bacteria determined by means of PMA-qPCR minus the number of cultivable cells allows us to estimate the number of dormant, non-cultivable cells. The load as determined by microbiological culture was on average 0.5 log10 lower than the load as determined by PMA-qPCR, indicating a high amount of not cultivable bacteria. This high number of dormant cells might be explained by the availability of nutrients and oxygen which decrease with the depth in the biofilm [29], [30] and which lead to a mixture of metabolically active (dividing) and metabolically inactive (dormant, non-dividing) bacteria. Is has been shown that these dormant cells are less susceptible to antibiotics and are difficult to detect by culture [30]–[32]. Taking all 27 episodes of 18 patients in consideration, we notice that after one week of treatment 90% of all P. aeruginosa bacteria were dormant, while at the start of the treatment only 41.7% of all P. aeruginosa bacteria were dormant. Although at day 15 the absolute amount of dormant cells further decreased, relatively, there were only 62.6% dormant cells. However, it should be noted that PMA can not invade dead cells which are structurally still intact, so this is still an estimation.
Taking the two outer patient quartile groups in consideration, i.e. the patients with the worst and the best FEV1 values, the proportion of dormant cells even increase after 15 days of treatment to 93.1% and 100%, respectively. The difference between the relative amounts at day 15 for all patients and for the two FEV1 outer groups might be explained by the large spread of quantities in bacterial load when all patients are included.
However, these findings illustrate that preferentially the metabolic active cells are killed during antibiotic treatment and are indicative for the need of alternative treatments targeting the dormant bacteria.
Because the load of PMA-qPCR was on average 0.1 log10 below that of qPCR, it can be concluded that there is a significant amount of DNA derived from dead cells present in the sputum, i.e. 23% of total P. aeruginosa DNA at day 0, 70% at day 8 and 42% at day 15. In agreement with the suggestion of Rogers and colleagues [33], this comparison of techniques shows that the treatment success should be determined by means of PMA-qPCR, since all viable cells are quantified (unlike culture, which does not quantify dormant cells) and since only viable cells are quantified (unlike qPCR, which also quantifies DNA from dead cells).
Correlation between the improvement of clinical parameters and the decrease of bacterial load
In our study, we observed that clinical improvements and the decreases of P. aeruginosa and of total bacterial load are mainly established during the first week of antibiotic treatment.
Stressmann and colleagues [34] monitored the total number of bacteria and of P. aeruginosa in sputum samples of 12 adult CF patients, 21, 14, 7 and 0 days prior to a pulmonary exacerbation. Interestingly, they did not find significant changes in the bacterial load (total and/or P. aeruginosa) in the period prior to pulmonary exacerbation, suggesting that these exacerbations do not result from an increased bacterial density.
In some studies, the role of other bacterial species and the composition of the microbiome prior to and during pulmonary exacerbations have been identified. Using culture based techniques, Worlitzsch et al. [35] investigated the role of obligate anaerobes during pulmonary exacerbation and found that the number of obligate anaerobes was not reduced during intravenous therapy directed against P. aeruginosa [35]. By means of pyrosequencing, Fodor et al. [36] found that there is only a minimal change in the overall microbial community structure during antibiotic treatment. Moreover, they also found a similar microbiome in patients when clinical stable and during an exacerbation, suggesting that the onset of exacerbations is not correlated with a change in the airway microbiome [36].
A comparable study as ours was carried out by Regelmann et al. [18]. They determined the P. aeruginosa and total bacterial density in the sputum in an antibiotic treated group (n = 7) and in a placebo group (n = 5) and measured the lung function improvement of the patients in both groups (FVC, FEV1 and FEF25–75). In their study, reduction of the P. aeruginosa density was quantitatively correlated with the improvement of the above mentioned parameters (ANOVA). Our data show that both the parameters of clinical improvement and the P. aeruginosa load, the latter determined by means of PMA-qPCR, improve significantly only during the first week. It should be noticed that the parameters of clinical improvement reach already normal values after one week of treatment, such that further improvement during the second week is not possible. Interestingly, we found that for the 6 patients (7 episodes) with a good lung function (FEV1>73.0%), a significant decrease of the P. aeruginosa density, determined by means of PMA-qPCR could be obtained while this was not the case for the 4 patients (7 episodes) with a poor lung function (FEV1<39.4%). This defective clearance of P. aeruginosa in the latter group may be due to enhanced intrinsic resistance of the P. aeruginosa cells, but is probably better explained as being due to an enhanced biofilm network in the airways which makes the bacteria less reachable for the antibiotics in combination with the deterioration of the lung tissue and the immune defense of the patients.
In conclusion, we can state that the improvement of clinical status is accompanied with the decrease of the P. aeruginosa load, and that these decreases occur mainly during the first week of IV antibiotic treatment. Our data also indicate that the antibiotic treatment has a higher impact (regarding the decrease of the P. aeruginosa load) in patients with a good lung function (>73.0%). Finally, comparison of the quantitation of P. aeruginosa by means of culture with quantitation by means of PMA-qPCR illustrates that clearance of the dormant, non-cultivable bacteria present in the sputum is difficult to achieve with the currently applied treatments.
To determine to what extent the decrease in bacterial load could have been caused by the physiotherapy that normally accompanies antibiotic treatment, we checked bacterial loads before and after physiotherapy treatment in patients that received only physiotherapy, but could not establish a diminishment of bacterial concentrations (not sufficient patients for statistical analysis, data not published). It can be assumed that physiotherapy alone, and most certainly when combined with intravenous antibiotics, decreases the sputum in the airways, but it seems unlikely that physiotherapy alone influences the bacterial load, i.e. the number of bacteria per volume of sputum, which is in correspondence with our unpublished data.
Funding Statement
This study was funded by the Belgium Cystic Fibrosis Association (MucoVereniging) (www.muco.be). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1.Belgisch Mucoviscidose Register (2008) Annual Data Report.
- 2. Döring G, Conway SP, HeijermanHG, Hodson ME, Høiby N, et al. (2000) Antibiotic therapy against Pseudomonas aeruginosa in cystic fibrosis: a European consensus. Eur Respir J 16: 749–767. [DOI] [PubMed] [Google Scholar]
- 3. Hansen CR, Pressler T, Høiby N (2008) Early aggressive eradication therapy for intermittent Pseudomonas aeruginosa airway colonization in cystic fibrosis patients: 15 years experience. J Cyst Fibros 7: 523–530. [DOI] [PubMed] [Google Scholar]
- 4. Høiby N, Frederiksen B, Pressler T (2005) Eradication of early Pseudomonas aeruginosa infection. J Cyst Fibros 4 Suppl 249–54. [DOI] [PubMed] [Google Scholar]
- 5. Schelstraete P, Deschaght P, Van Simaey L, Van daele S, Haerynck F, et al. (2010) Genotype based evaluation of Pseudomonas aeruginosa eradication treatment success in cystic fibrosis patients. J Cyst Fibros 9: 99–103. [DOI] [PubMed] [Google Scholar]
- 6. de Boer K, Vandemheen KL, Tullis E, Doucette S, Fergusson D, et al. (2011) Exacerbation frequency and clinical outcomes in adult patients with cystic fibrosis. Thorax 66: 680–685. [DOI] [PubMed] [Google Scholar]
- 7. Kosorok MR, Zeng L, West SE, Rock MJ, Splaingard ML, et al. (2001) Acceleration of lung disease in children with cystic fibrosis after Pseudomonas aeruginosa acquisition. Pediatr Pulmonol 32: 277–287. [DOI] [PubMed] [Google Scholar]
- 8.Parkins MD, Rendall JC, Elborn JS (2012) Incidence and risk factors for pulmonary exacerbation treatment failures in patients with cystic fibrosis chronically infected with Pseudomonas aeruginosa. Chest 141: 485–493. Pulmonary Exacerbation Treatment Failures. [DOI] [PubMed]
- 9. Sanders DB, Bittner RC, Rosenfeld M, Hoffman LR, Redding GJ, et al. (2010) Failure to recover to baseline pulmonary function after cystic fibrosis pulmonary exacerbation. Am J Respir Crit Care Med 1825: 627–632. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Sanders DB, Bittner RC, Rosenfeld M, Redding GJ, Goss CH (2011) Pulmonary exacerbations are associated with subsequent FEV1 decline in both adults and children with cystic fibrosis. Pediatr Pulmonol 46: 393–400. [DOI] [PubMed] [Google Scholar]
- 11. Block JK, Vandemheen KL, Tullis E, Fergusson D, Doucette S, et al. (2006) Predictors of pulmonary exacerbations in patients with cystic fibrosis infected with multi-resistant bacteria. Thorax 61: 969–974. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Wang Y, Cela E, Gagnon S, Sweezey NE (2010) Estrogen aggravates inflammation in Pseudomonas aeruginosa pneumonia in cystic fibrosis mice. Respir Res 11: 166. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Nocker A, Cheung CY, Camper AK (2006) Comparison of propidium monoazide with ethidium monoazide for differentiation of live vs. dead bacteria by selective removal of DNA from dead cells. J Microbiol Methods 67: 310–320. [DOI] [PubMed] [Google Scholar]
- 14. Nocker A, Sossa KE, Camper AK (2007) Molecular monitoring of disinfection efficacy using propidium monoazide in combination with quantitative PCR. J Microbiol Methods 70: 252–260. [DOI] [PubMed] [Google Scholar]
- 15. Deschaght P, De Baere T, Van Simaey L, Van daele S, De Baets F, et al. (2009) Comparison of the sensitivity of culture, PCR and quantitative real-time PCR for the detection of Pseudomonas aeruginosa in sputum of cystic fibrosis patients. BMC Microbiol 9: 244. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Deschaght P, Schelstraete P, Lopes dos Santos Santiago G, Van Simaey L, Haerynck F, et al. (2010) Comparison of culture and qPCR for the detection of Pseudomonas aeruginosa in not chronically infected cystic fibrosis patients. BMC Microbiol 10: 245. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Hyatt AC, Chipps BE, Kumor KM, Mellits ED, Lietman PS, et al. (1981) A double-blind controlled trial of anti-Pseudomonas chemotherapy of acute respiratory exacerbations in patients with cystic fibrosis. J Pediatr 99: 307–314. [DOI] [PubMed] [Google Scholar]
- 18. Regelmann WE, Elliott GR, Warwick WJ, Clawson CC (1990) Reduction of sputum P. aeruginosa density by antibiotics improves lung function in cystic fibrosis more than do bronchodilators and chest physiotherapy alone. Am Rev Respir Dis 141: 914–921. [DOI] [PubMed] [Google Scholar]
- 19. Vic P, Ategbo S, Turck D, Husson MO, Launay V, et al. (1998) Efficacy, tolerance, and pharmacokinetics of once daily tobramycin for Pseudomonas exacerbations in cystic fibrosis. Arch Dis Child 78: 533–539. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Aaron SD, Vandemheen KL, Ferris W, Fergusson D, Tullis E, et al. (2005) Combination antibiotic susceptibility testing to treat exacerbations of cystic fibrosis associated with multiresistant bacteria: a randomised, double-blind, controlled clinical trial. Lancet 366: 463–471. [DOI] [PubMed] [Google Scholar]
- 21. Burkhardt O, Lehmann C, Madabushi R, Kumar V, Derendorf H, et al. (2006) Once-daily tobramycin in cystic fibrosis: better for clinical outcome than thrice-daily tobramycin but more resistance development? J Antimicrob Chemother 58: 822–829. [DOI] [PubMed] [Google Scholar]
- 22.CF Trust (2009) UK Cystic Fibrosis Trust Antibiotic Group. Antibiotic treatment for cystic fibrosis. Report of the UK Cystic Fibrosis Trust Antibiotic Group.
- 23. Beaudry PH, Marks MI, McDougall D, Desmond K, Rangel R (1980) Is anti-Pseudomonas therapy warranted in acute respiratory exacerbations in children with cystic fibrosis? J Pediatr 97: 144–147. [DOI] [PubMed] [Google Scholar]
- 24. McLaughlin FJ, Matthew WJ, Strieder DJ, Goldman DA (1983) Clinical and bacteriological responses to three antibiotic regimens for acute exacerbation of cystic fibrosis: Ticarcillin-tobramycin, azlocillin-tobramycin, and azlocillin-placebo. J Infect Dis 147: 559–567. [DOI] [PubMed] [Google Scholar]
- 25. Penketh AR, Hodson ME, Batten JC (1983) Ticarcillin compared with carbenicillin in the treatment of exacerbations of bronchopulmonary infection in cystic fibrosis. Br J Dis Chest 77: 179–184. [DOI] [PubMed] [Google Scholar]
- 26. Penketh A, Hodson ME, Gaya H, Batten JC (1984) Azlocillin compared with carbenicillin in the treatment of bronchopulmonary infection due to Pseudomonas aeruginosa in cystic fibrosis. Thorax 39: 299–304. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Master V, Roberts GW, Coulthard KP, Baghurst PA, Martin A, et al. (2001) Efficacy of once-daily tobramycin monotherapy for acute pulmonary exacerbations of cystic fibrosis: a preliminary study. Pediatr Pulmonol 31: 367–376. [DOI] [PubMed] [Google Scholar]
- 28. Plummer A, Wildman M (2011) Duration of intravenous antibiotic therapy in people with cystic fibrosis. Cochrane Database Syst Rev 1: CD006682. [DOI] [PubMed] [Google Scholar]
- 29. Worlitzsch D, Tarran R, Ulrich M, Schwab U, Cekici A, et al. (2002) Effects of reduced mucus oxygen concentration in airway Pseudomonas infections of cystic fibrosis patients. J Clin Invest 109: 317–325. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Kim J, Han J, Franklin MJ, Stewart PS, Yoon J (2009) Tolerance of dormant and active cells in Pseudomonas aeruginosa PAO1 biofilm to antimicrobial agents. J Antimicrob Chemother 63: 129–135. [DOI] [PubMed] [Google Scholar]
- 31. Brown MRW, Allison DG, Gilbert P (1988) Resistance of bacterial biofilms to antibiotics: a growth-rate related effect? J Antimicrob Chemother 22: 777–783. [DOI] [PubMed] [Google Scholar]
- 32. Puspita ID, Kamagata Y, Tanaka M, Asano K, Nakatsu CH (2012) Are uncultivated bacteria really uncultivable? Microbes Environ 27: 356–366. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33. Rogers GB, Marsh P, Stressmann AF, Allen CE, Daniels TV, et al. (2010) The exclusion of dead bacterial cells is essential for accurate molecular analysis of clinical samples. Clin Microbiol Infect 16: 1656–1658. [DOI] [PubMed] [Google Scholar]
- 34. Stressmann FA, Rogers GB, Marsh P, Lilley AK, Daniels TWV, et al. (2011) Does bacterial density in cystic fibrosis sputum increase prior to pulmonary exacerbation. J Cyst Fibr 10: 357–365. [DOI] [PubMed] [Google Scholar]
- 35. Worlitzsch D, Rintelien C, Böhm K, Wollschläger B, Merkel N, et al. (2009) Antibiotic-resistant obligate anaerobes during exacerbations of cystic fibrosis patients. Clin Microbiol Infect 5: 454–460. [DOI] [PubMed] [Google Scholar]
- 36. Fodor A, Klem ER, Gilpin DF, Elborn JS, Boucher RC, et al. (2012) The adult cystic fibrosis airway microbiota is stable over time and infection type, and highly resilient to antibiotic treatment of exacerbations. Plos One 7: e45001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37. Baele M, Devriese LA, Vancanneyt M, Vaneechoutte M, Snauwaert C, et al. (2003) Emended description of Streptococcus ferus isolated from pigs and rats. Int J Syst Evol Microbiol 53: 143–146. [DOI] [PubMed] [Google Scholar]
