ABSTRACT
Acute coxsackievirus B3 (CVB3) infection is one of the most prevalent causes of acute myocarditis, a disease that frequently is identified only after the sudden death of apparently healthy individuals. CVB3 infects cardiomyocytes, but the infection is highly focal, even in the absence of a strong adaptive immune response, suggesting that virus spread within the heart may be tightly constrained by the innate immune system. Type I interferons (T1IFNs) are an obvious candidate, and T1IFN receptor (T1IFNR) knockout mice are highly susceptible to CVB3 infection, succumbing within a few days of challenge. Here, we investigated the role of T1IFNs in the heart using a mouse model in which the T1IFNR gene can be ablated in vivo, specifically in cardiomyocytes. We found that T1IFN signaling into cardiomyocytes contributed substantially to the suppression of viral replication and infectious virus yield in the heart; in the absence of such signaling, virus titers were markedly elevated by day 3 postinfection (p.i.) and remained high at day 12 p.i., a time point at which virus was absent from genetically intact littermates, suggesting that the T1IFN-unresponsive cardiomyocytes may act as a safe haven for the virus. Nevertheless, in these mice the myocardial infection remained highly focal, despite the cardiomyocytes' inability to respond to T1IFN, indicating that other factors, as yet unidentified, are sufficient to prevent the more widespread dissemination of the infection throughout the heart. The absence of T1IFN signaling into cardiomyocytes also was accompanied by a profound acceleration and exacerbation of myocarditis and by a significant increase in mortality.
IMPORTANCE Acute coxsackievirus B3 (CVB3) infection is one of the most common causes of acute myocarditis, a serious and sometimes fatal disease. To optimize treatment, it is vital that we identify the immune factors that limit virus spread in the heart and other organs. Type I interferons play a key role in controlling many virus infections, but it has been suggested that they may not directly impact CVB3 infection within the heart. Here, using a novel line of transgenic mice, we show that these cytokines signal directly into cardiomyocytes, limiting viral replication, myocarditis, and death.
INTRODUCTION
Myocarditis is a potentially serious and sometimes fatal disease, with several infectious and noninfectious causes. In developed countries, it most commonly results from a virus infection, often by type B coxsackieviruses (CVB), and in particular by serotype 3 (CVB3) (1–8). It is found at routine necropsy at a prevalence that greatly exceeds its rate of clinical diagnosis (9, 10), a discrepancy that may be explained by the fact that only a subset of individuals with acute myocarditis develop marked symptoms such as chest pains, palpitations, or signs of heart failure. Consistent with this, acute myocarditis was identified as the cause of death in 39 of 2,560 serial autopsies (∼1.5%), but it had been clinically suspected in only one of the cases (11); thus, in this study >97% of people with lethal myocarditis were free of classical symptoms. Such symptomless myocarditis can cause catastrophic dysfunction of the electrical pathways in the heart, particularly during exertion, and often explains the collapse and death of young and vigorous individuals (12, 13). For example, a study of military recruits found that 86% of sudden deaths during basic training occurred during exercise, and 20% were attributable to unsuspected myocarditis (14); overall, it has been estimated that ∼12% of sudden deaths in individuals of <40 years of age can be attributed to this disease (6). Furthermore, the disease can have long-term sequelae, including dilated cardiomyopathy (DCM) (15, 16), in which one or both ventricles dilate and decompensate, with resulting cardiac failure. DCM develops in ∼10 to 20% of patients clinically diagnosed with acute myocarditis, while its frequency in the general population is approximately 0.005% (15). Moreover, a strong correlation (P < 0.001) between prior coxsackievirus infection and DCM has been reported elsewhere (17); thus, it is reasonable to argue a cause-and-effect relationship between coxsackieviral myocarditis and many cases of DCM. In addition, CVB RNA can persist in vivo; ∼40 to 66% of heart biopsy specimens from patients with healed myocarditis or DCM were reported positive for CVB RNA signal (18, 19). Therefore, CVB myocarditis is a relatively common and potentially very serious disease, and it is important that we understand the underlying pathogenesis.
CVB3, which is a member of the picornavirus family and human enterovirus B genus, has a positive-sense single-stranded RNA (ssRNA) genome of ∼7,500 bases. The virus infects mice and replicates to high titers, causing diseases—including acute myocarditis—that faithfully recapitulate those observed in humans. As is common for many pathogenic virus infections, two general mechanisms contribute to CVB-driven myocarditis: direct virus-mediated lysis of infected cells and immune-mediated tissue damage. The virus infects cardiomyocytes, both in vitro and in vivo, and infected cells are rapidly lysed (20–25). Indeed, virus replication in cardiomyocytes is a prerequisite for myocarditis: mice whose cardiomyocytes lack the viral receptor, coxsackievirus adenovirus receptor (CAR), are largely protected against cardiac infection and disease (26, 27). Both αβ and γδ CD8+ T cells are present in the myocardial infiltrate and add to CVB pathogenesis (28–36); antibodies, too, have been implicated (37, 38). However, the inflammatory lesions also contain innate immune cells, including macrophages, natural killer cells, and neutrophils, and profound myocarditis is seen following infection of SCID mice (39), indicating that the adaptive immune response is not absolutely required for disease. CVB distribution in the heart is extremely focal, and this remains true in both SCID mice (39) and B cell knockout (KO) mice (40), suggesting that the innate immune system may play a key role in constraining CVB spread in the myocardium. Type I interferons (T1IFNs) are obvious candidates as effectors of this innate control, consistent with the observation that mice lacking the T1IFN receptor (T1IFNR) show dramatically increased morbidity and mortality (41). T1IFN receptor knockout (T1IFNRKO) mice succumb within days of challenge (41), long before overt myocarditis can develop, and this early mortality has prevented a detailed assessment of how T1IFN signaling may contribute to CVB3 control in the heart and to myocarditis. The exogenous administration of T1IFNs can reduce CVB titers in several organs, including the heart (42, 43), and recent data indicate that beta interferon (IFN-β) may be an effective treatment of enteroviral myocarditis in humans (44, 45). However, one cannot conclude, from those data, that T1IFN must act directly within the heart to suppress viral replication/dissemination; alternatively, T1IFN may decrease virus production in other tissues, thereby limiting the quantity of infectious particles being delivered to the heart, and this, in turn, could reduce both the cardiac virus titer and viral myocarditis. Indeed, others have suggested that, during CVB3 infection, T1IFNs may not act directly on infected cardiomyocytes (41, 46, 47), and this contention is supported by the finding that CVB titers in the livers of T1IFNRKO mice were markedly higher than those of wild-type (wt) mice, but there was little difference in CVB RNA levels in the hearts of the two strains (41). Moreover, following CVB3 infection of mice lacking the IFN-β gene, viral titers at day 4 postinfection (p.i.) showed statistically significant increases in liver and spleen but not in the heart (42). As further indication that innate responses other than T1IFNs may regulate CVB3 in the heart, transgenic expression in cardiomyocytes of the cytokine signaling suppressor SOCS3, which does not inhibit T1IFN signaling, nevertheless markedly increased the cells' susceptibility to CVB3 infection (47). Therefore, the present work was undertaken to answer two questions regarding the role of T1IFN during CVB3 infection. First, do these cytokines act directly upon virus-infected cardiomyocytes in vivo, to limit virus replication in the heart? Second, does T1IFN signaling into cardiomyocytes affect virus-induced myocarditis? In order to address these questions in vivo, we chose to abrogate T1IFN signaling specifically in cardiomyocytes, while retaining it in all other cell types. We hoped that this approach would prolong mouse survival beyond the 2- to 3-day period observed in standard T1IFNRKO animals (in which T1IFN signaling is defective in all organs), allowing us to assess the effects of T1IFN signaling on myocarditis. We achieved this goal by crossing two mouse lines: one in which an exon of the T1IFN receptor is floxed (48) and another in which Cre recombinase activity can be induced specifically in cardiomyocytes (49).
MATERIALS AND METHODS
Ethics statement.
All animal experiments were approved by The Scripps Research Institute (TSRI) Institutional Animal Care and Use Committee and were carried out in accordance with the NIH Guide for the Care and Use of Laboratory Animals.
Mice.
Standard KO mice lacking the T1IFNR (50) or the IFN-γR (51) were crossed and backcrossed, with appropriate genotyping, to generate mice lacking both receptors (double-receptor KO [DRKO] mice). B6.Cg-Tg(Myh6-cre/Esr1)1Jmk/J mice were purchased from the Jackson Laboratory (JAX; stock number 005657). In these mice, the murine alpha-myosin heavy-chain (Myh6) promoter regulates transcription of an open reading frame encoding MerCreMer (MCM); MCM protein is thereby expressed specifically in cardiomyocytes (49), so we term these animals cardiomyocyte-MCM (CMMCM) mice. The MCM protein comprises Cre recombinase flanked by two copies of a mutant murine estrogen receptor (Mer), which retain the fusion protein in the cytosol. The receptor mutation renders the protein insensitive to normal estradiol, but nuclear translocation and loxP cleavage can be induced by the prodrug tamoxifen (Tam) (52–54) via its major active metabolite, the synthetic estrogen receptor ligand 4-hydroxytamoxifen. IFNARflox/flox mice (48), here referred to as T1IFNRf/f mice, were generously provided by Ulrich Kalinke, Paul Ehrlich Institute, Langen, Germany. The gene for T1IFNR contains 11 exons, and Cre-mediated DNA cleavage of the floxed T1IFN allele deletes exon 10, a sequence that includes the transmembrane region of the protein; the predicted resulting mRNA not only lacks this vital sequence but also contains a subsequent early frameshift that terminates protein synthesis, truncating the C terminus of the protein by 115 amino acids (aa). To determine the extent of MCM activity, the CMMCM mice were crossed with Cre reporter mice (55) which were purchased from JAX (stock number 007576); in these mice, cleavage of a floxed transcriptional stop signal allows expression of membrane-targeted green fluorescent protein (mGFP).
Characterization of interferon receptor status on PBMC by flow cytometry.
Peripheral blood mononuclear cells (PBMC) were isolated as described previously (56). In brief, ∼100 μl of whole blood was mixed with 2 ml red cell lysis buffer (0.15 M NH4Cl, 1 mM KHCO3, 0.1 mM Na2EDTA), and after a 5-min incubation, 2 ml phosphate-buffered saline (PBS) containing 2% fetal bovine serum (FBS) and 0.1% sodium azide (fluorescence-activated cell sorting [FACS] buffer) was added and cells were recovered by centrifugation (1,500 rpm for 7 min). This red cell lysis was repeated twice. Cells were then incubated with Fc receptor antibody (FcBlock; BD Biosciences) for 10 min on ice, washed twice in FACS buffer, and surface stained with antibody in FACS buffer for 30 min. T1IFNR was detected using allophycocyanin (APC)–anti-mouse IFNAR-1 (clone MAR1-5A3; BioLegend); IFN-γR was identified using biotin-labeled rat anti-mouse IFN-γR-1 (clone GR20; BD Biosciences) followed by APC-conjugated streptavidin (Molecular Probes); isotype controls used were APC–anti-mouse IgG1 (clone MOPC-21; BioLegend) and biotin–anti-rat IgG2a with streptavidin-APC (clone R35-95; BD Biosciences). Stained cells were washed twice in FACS buffer, fixed in PBS containing 1% paraformaldehyde, and acquired on a FACSCalibur or LSR-II cytometer. Data were analyzed with FlowJo software (TreeStar).
Administration of tamoxifen and evaluation of deletion of the T1IFNRf/f sequence.
Tamoxifen (Tam; Sigma T5648) was dissolved, with sonication, in corn oil at 20 mg/ml and was administered by a single intraperitoneal (i.p.) injection of 50 μl. Studies of several Tam doses and administration frequencies (not shown) revealed that efficient gene deletion was obtained within 24 h following a single dose of 40 mg/kg of body weight (i.e., approximately 1 mg per adult mouse). Additional preparatory experiments (not shown) indicated that, at this dose, Tam had no impact on CVB3 replication in C57BL/6 mice. Nevertheless, two approaches were used to control for unanticipated “side effects” of Tam, i.e., unrelated to MCM. First, all experiments included Tam-treated MCM− T1IFNRf/f mice (i.e., floxed mice that lack the CMMCM cassette). Second, the in vivo half-life of the drug is ∼5 days (57), so at least 14 days were allowed to elapse between Tam administration and the initiation of any viral experiment. To evaluate the extent and tissue specificity of Tam-induced genetic deletion by PCR, genomic DNA was isolated using the DNeasy Blood and Tissue kit (Qiagen) and was used as a PCR template; the primer sequences are provided in the legend to Fig. 2.
FIG 2.
Generation and characterization of mice with inducible, cardiomyocyte-specific, interruption of the T1IFNR gene. (A) The locations of the loxP sites and the primers used for PCR, and the predicted amplicon sizes, are shown for both intact floxed DNA and for DNA that has been subjected to Cre recombinase action. Primer 1 sequence, 5′GAATGTAGTCTGTAATACGC3′; primer 2 sequence, 5′CTTTTTGGATCGATCCATAACTTCG3′. (B) T1IFNRf/f mice, with or without the CMMCM cassette as indicated, received a single inoculation of either Tam (+) or vehicle alone (corn oil; −). Four days later, the mice were sacrificed and the indicated tissues, as well as kidney, spleen, brain, and lung (not shown), were harvested. DNA was isolated, and PCR was carried out using the above primers. Sk., skeletal.
Determining the extent and cell specificity of Tam-induced deletion.
To determine the extent and cell specificity of in vivo Tam-induced Cre recombinase activity, CMMCM/reporter+ and MCM− control mice (also reporter+) were inoculated with Tam. To ensure that any observed effect was caused by the drug, some of the mice were inoculated with vehicle alone. Four to 14 days later, the mice were sacrificed with perfusion, and their hearts and livers were harvested and fixed in zinc formalin buffer (Z-Fix; Anatech) at room temperature (RT) for 24 h and then at 4°C for 24 to 48 h. Approximately 60-μm coronal sections of liver and heart were cut using a vibratome, fixed, and stained with Hoechst 33342 (to identify nuclei) and phalloidin-Alexa Fluor 647 dye (which binds to F-actin). Fluorescence data were acquired using an LSM 710 laser scanning confocal microscope, and serial optical images were imported and spatially reassembled using Imaris software (Bitplane).
Virus used and its titration in tissues.
The wtCVB3 used in these studies is a plaque-purified isolate (designated H3) of the myocarditic Woodruff variant of CVB3 (58) and was generated from plasmid pH3, encoding a full-length infectious clone of this virus (59). wtCVB3 was grown in HeLa cells, and virus stocks were generated as described previously (60). Mice (8 to 20 weeks old) were inoculated intraperitoneally with the indicated doses of virus. At the indicated times p.i., mice were sacrificed and their hearts and livers were isolated, weighed, and homogenized in 1 ml Dulbecco modified Eagle medium (DMEM). The titer of infectious virus in the lysate was determined by standard plaque assays, performed on subconfluent HeLa cell monolayers as previously described (61).
Serum T1IFN measurement.
Serum IFN-α levels were measured using an enzyme-linked immunosorbent assay (ELISA) kit from eBioscience (mouse IFN-α platinum ELISA; catalog no. BMS 6027). For serum isolation, whole blood was transferred to gold-capped MiniCollect serum gel tubes (Greiner Bio-One catalog no. 450473; Monroe, NC, USA) and centrifuged for 30 min at 3,000 rpm (4°C). Undiluted serum was used for ELISA.
Quantitative real-time PCR to detect positive-sense (genomic) CVB3 RNA.
RNA was isolated from the heart and liver using the appropriate RNeasy minikit (Qiagen) according to the manufacturer's instructions. An 0.5-μg amount of total RNA per sample was reverse transcribed using SuperScript III reverse transcriptase (Invitrogen): a CVB-specific reverse primer (5′GAACGCTTTCTCCTTCAACC3′) was used for the reverse transcription reaction, which was carried out in a thermocycler as follows: 65°C for 5 min, 55°C for 45 min, and 70°C for 15 min. Samples were then treated with 1 μl RNase H (Invitrogen) for 20 min at 37°C to remove RNA complementary to the cDNA. Subsequently, TaqMan quantitative real-time PCR was performed using CVB3-specific primers (forward primer 5′CACACTCCGATCAACAGTCA3′; reverse primer 5′GAACGCTTTCTCCTTCAACC3′) and a 6-carboxyfluorescein (FAM)/6-carboxytetramethylrhodamine (TAMRA)-labeled probe (5′CGTGGCACACCAGCCATGTTT3′) as previously described (62). PCR amplification was done using Platinum Quantitative PCR SuperMix-UDG cocktail (Invitrogen) as described by the manufacturer. A control reaction mixture lacking reverse transcriptase was included. Quantitative analysis was carried out using a Bio-Rad iQ5 real-time PCR system in 96-well optical reaction plates heated to 50°C for 2 min to digest dUTP-containing contaminants and to 95°C for 2 min to deactivate uracil-N-glycosylase and activate Platinum Taq DNA polymerase, followed by 40 cycles of denaturation at 95°C for 15 s and annealing and extension at 60°C for 30 s followed by fluorescence data capture. All samples were evaluated in 2 parallel amplification reactions. In order to assign a genome copy number to the cycle threshold value, a standard curve was generated: a known quantity of in vitro-transcribed CVB genomic RNA was serially diluted, and all dilutions were subjected to the above reverse transcriptase and quantitative PCRs (qPCRs).
RNA-RNA in situ hybridization.
Single-stranded RNA (ssRNA) probes were prepared using a plasmid that contains an ∼400-bp wtCVB3 fragment that represents a portion of the VP4/VP2 coding sequence. The fragment is flanked by T7 and T3 RNA polymerase promoters, permitting the generation of strand-specific ssRNA probes; these were prepared by in vitro transcription on linearized plasmid template, using a digoxigenin (DIG) RNA labeling kit (Roche) to incorporate DIG-labeled uridine. DIG probes were quantitated by comparison to a DIG-labeled control RNA (Roche) on a dot blot. Organs were isolated and fixed in buffered Z-Fix overnight at room temperature (RT) and embedded in paraffin, and 3-μm sections were cut. Sections were subjected to xylene to remove paraffin and then rehydrated with a series of descending ethanol concentration solutions. Sections were washed in PBS, PBS with 100 mM glycine, and then PBS with 0.3% Triton X-100, prior to proteinase K treatment (20 μg/ml in Tris-EDTA [TE], 30 min at 37°C) to increase target accessibility. Following a PBS wash, sections were incubated in prehybridization buffer (4× SSC [1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate], 50% formamide) for 1 h at 37°C. Hybridization buffer (40% formamide, 10% dextran sulfate, 1× Denhardt's medium, 4× SSC, 0.01 M dithiothreitol [DTT], 1 mg/ml yeast tRNA, 1 mg/ml salmon sperm DNA) containing 0.1 ng/μl of DIG probe was applied to sections; incubation was carried out overnight at 42°C in a humidity chamber. Posthybridization wash in 2× SSC (37°C) and then 1× SSC (37°C) was followed by RNase treatment (20 μg/ml in NaCl–Tris-HCl–EDTA, 30 min at 37°C) to remove ssRNA. A final wash in 0.1× SSC (37°C) preceded immunodetection. Solutions from the DIG Wash and Buffer set (Roche) were applied to wash and block the sections. Anti-DIG Fab fragment conjugated to alkaline phosphatase (Roche) was diluted 1:500 and applied for an overnight incubation at 4°C. Sections were washed in MABT (maleic acid, NaCl, Tween 20), and then in developing buffer (pH 9.8) before being added to a chamber containing the color substrate reagents (nitroblue tetrazolium/5-bromo-4-chloro-3-indolylphosphate [NBT/BCIP] [0.1 mg/ml and 0.05 mg/ml, respectively] and 5% polyvinyl alcohol in developing buffer [pH 9.8]). Sections were evaluated at 30-min intervals, and when color development was appropriate, all sections were simultaneously washed in water to stop further development, mounted, and photographed using an Axiovert 200 inverted microscope (Carl Zeiss) with Axio Vision software (version 4.8.1; Carl Zeiss).
Histological images.
CVB-induced myocarditis was identified using standard histological procedures. Hearts were isolated, fixed in Z-Fix at room temperature overnight, and then embedded in paraffin. Sections (3 μm) were prepared and stained using Masson's trichrome. Images were captured using an Axiovert 200 inverted microscope (Carl Zeiss) with Axio Vision software (version 4.8.1; Carl Zeiss).
RESULTS
Hepatic and cardiac CVB titers in interferon single- and double-receptor knockout mice.
As noted above, from studies in 129SvJ mice it has been proposed that T1IFNs may have very little effect on CVB3 replication within the heart. This conclusion was drawn largely from in situ hybridization data demonstrating similar amounts of viral RNA in the hearts of wt and T1IFNRKO mice. However, cardiac titers of infectious virus were not reported. We began by carrying out similar experiments, i.e., comparing wt mice with standard T1IFNRKO animals, for two reasons. First, our studies employ C57BL/6 mice, and we wished to determine if the reported effects of T1IFN on CVB3 in vivo were reproducible on this host genetic background. Second, we considered it important to determine the impact of IFN receptor deficiency on infectious virus titers in the heart. Therefore, four groups of mice on the C57BL/6 background—wt, T1IFNRKO, IFN-γRKO, and double-receptor knockout (DRKO)—were used. Phenotypic characterization of peripheral blood mononuclear cells confirmed the appropriate expression patterns of the IFN receptors (Fig. 1A). The mice were challenged with wtCVB3 (103 PFU, i.p.), and virus titers were determined in the liver and heart at days 2 and 3 p.i.; later time points were not assessed because very few T1IFNRKO mice survive beyond day 3 p.i. As shown in Fig. 1B, hepatic CVB3 titers were ∼130-fold higher in T1IFNRKO mice (green bar) than in wt mice (green/red hatched bar), very similar to the difference observed in the 129SvJ strain following a similar viral challenge (41). Furthermore, and again confirming the results of Wessely et al. (41), liver titers between wt and IFN-γRKO mice (red bar) were similar, while the titers in DRKO mice (white bars) were almost identical to those of the mice lacking T1IFNR alone, showing that signaling by T1IFN, but not by IFN-γ, appears to be important in controlling CVB3 titer in the liver. However, and contrary to expectations from published data (41), we observed similar effects in the heart, albeit at a reduced magnitude (Fig. 1C). When infectious CVB3 levels in the hearts of three standard KO strains were compared to those in wt mice, titers were increased by ∼10-fold in T1IFNRKO mice and DRKO mice and were minimally affected by IFN-γ signaling. Interestingly, this 10-fold difference was similar to that reported for other mice carrying T1IFN-related signaling mutations (TRIFKO or TLR3KO mice) when measured at 2 to 3 days following CVB3 infection (63). Thus, our data show that, when the impact of T1IFN is evaluated by the criterion of infectious virus, these cytokines do play a part in regulating CVB3 in the heart. However, we could not conclude that these cytokines act directly on cardiac cells; it remained possible that, as proposed by others, endogenous T1IFNs exert no direct intracardiac effects and that the increased cardiac virus titer in the hearts of T1IFNRKO mice resulted from the hearts being seeded with virus from other organs (e.g., liver) in which viral replication was even more markedly elevated in the absence of T1IFN signaling. To discriminate between the direct (intracardiac) and indirect (extracardiac) effects of T1IFN in vivo, we developed a mouse line in which T1IFN receptor is expressed normally in all tissues, including the heart, but can be ablated specifically in cardiomyocytes. We reasoned that such mice might yield an additional benefit: T1IFN responses should be normal in all tissues except the heart, so the mice might survive CVB3 infection for a longer time than standard T1IFNRKO mice, permitting us to better assess the impact of T1IFN on both the infection and the consequent disease.
FIG 1.
Hepatic and cardiac CVB titers in interferon single- and double-receptor knockout mice. (A) PBMC were isolated from the four indicated strains of mice—wt, T1IFNRKO, IFN-γRKO, and double-receptor knockout (DRKO)—and their expression of IFN-α receptor 1 and IFN-γ receptor 1 was confirmed by flow cytometry. (B and C) The mice then were challenged with 103 PFU of wtCVB3 i.p. Two to 3 days later, the mice were sacrificed and perfused, and virus titers were determined in the liver (B) and heart (C). Means + standard errors are shown.
Generation and characterization of mice with inducible, cardiomyocyte-specific interruption of the T1IFNR gene.
Two existing mouse strains were obtained. For strain 1, IFNARflox/flox mice (here called T1IFNRf/f mice) were generated by the Kalinke group (48). For strain 2, B6.Cg-Tg(Myh6-cre/Esr1)1Jmk/J mice express the MerCreMer (MCM) protein under the transcriptional regulation of the cardiomyocyte-specific murine alpha-myosin heavy-chain promoter. MCM expression is cardiomyocyte specific, and enzymatic activity is tamoxifen inducible yet estrogen insensitive. These two mouse strains were crossed, and T1IFNRf/f homozygous mice expressing the MCM transgene in cardiomyocytes (CMMCM T1IFNRf/f mice) were obtained by appropriate backcrossing. Next, we evaluated Tam-induced deletion of the floxed sequence. Tam, or vehicle alone, was administered to CMMCM T1IFNRf/f mice, or to T1IFNRf/f littermate controls lacking the CMMCM cassette (termed MCM− mice). Four days later, all 4 groups of mice were sacrificed and multiple organs were harvested. Genomic DNA was prepared and was analyzed using primers adjacent to the two loxP sites that flank exon 10 of the T1IFNR (Fig. 2A). Using these primers, PCR of intact floxed DNA generates a band of 1,188 bp; following Tam-induced Cre activation and DNA cleavage, the PCR band size is reduced to 352 bp. PCR analyses of DNA extracted from the hearts of representative mice from each group (Fig. 2B) showed that, in the absence of Tam, there was no detectable Cre activity in any organs; thus, constitutive activity of the MCM protein is very low. Tam administration had no effect in MCM− mice, as expected; however, following Tam administration to mice containing the CMMCM cassette, a 352-bp band was detected in the hearts but in no other tissues, demonstrating MCM activity in, and limited to, this organ; the exquisite specificity of the Myh6 promoter for cardiac muscle cells is shown by the complete absence of Tam-induced cleavage in skeletal muscle cells. DNA deletion also was undetectable in liver and pancreas (Fig. 2B), as well as in kidney, spleen, brain, and lung (not shown). The presence of an 1,188-bp band in the hearts of Tam-treated CMMCM T1IFNRf/f mice is expected, because deletion of the floxed fragment will occur only in cardiomyocytes, which represent only ∼15% (64) to ∼50% (65) of cells in the adult murine heart; the lack of MCM protein expression in the remaining cardiac cells (fibroblasts, vascular smooth muscle cells, and endothelial cells) ensures that there will be abundant template to generate the 1,188-bp PCR band. In summary, DNA cleavage is Tam inducible and cardiomyocyte specific.
Reporter mice reveal the extent and cell specificity of Tam-induced Cre activity.
To identify the extent of Tam-induced Cre recombinase activity in vivo, the CMMCM mice were crossed with Cre reporter mice (55) in which Cre recombinase activity removes a strong transcriptional terminator (tpA), permitting the transcription of an mRNA encoding mGFP. Thus, following Tam treatment of double-transgenic (CMMCM/reporter+) mice, membranes of cardiomyocytes (but no other cells) should become indelibly green. After breeding of CMMCM mice with the reporter mice, the offspring were genotyped to identify animals containing both the CMMCM and reporter cassettes. These double-transgenic (CMMCM/reporter+) mice were inoculated with Tam dissolved in vehicle (corn oil) and were sacrificed 4 days later for analysis. To ensure that any observed effect was caused by the drug, some double-transgenic mice were inoculated with vehicle alone. Finally, to ensure that any observed effect required the MCM transgene, a group of MCM−/reporter+ mice also received Tam in corn oil. The hearts and livers were extracted, sectioned, stained, and analyzed by confocal microscopy as described in Materials and Methods. Three color channels are shown in Fig. 3. Images in the upper row show a merge of blue and green channels (nuclei and mGFP); the lower row shows, in addition, the far red channel (F-actin). Sections in Fig. 3A to C display cardiomyocytes in both longitudinal and transverse orientations (left and right columns, respectively). Green signal was undetectable in the hearts of Tam-treated MCM−/reporter+ mice (Fig. 3A), and vehicle alone did not induce MCM activity in the hearts of CMMCM reporter+ animals (Fig. 3B). In contrast, following Tam treatment of CMMCM reporter+ mice, almost all cardiomyocytes showed membrane-localized green fluorescence (Fig. 3C), demonstrating the effectiveness of the system. Thus, confirming the PCR data, the system is not leaky, and Tam-driven effects require CMMCM, and extending the PCR data, these data show that MCM-mediated cleavage has occurred in the vast majority of cardiomyocytes. The exquisite cell specificity of the CMMCM/Tam system is shown in Fig. 3D; mGFP signal is present in all cardiomyocytes but is absent from the endothelial cells of a blood vessel at the lower right of the panels (red arrowheads, upper panel). Finally, in the same mouse, the effect is organ specific; no mGFP expression was observed in the liver (Fig. 3E).
FIG 3.
Reporter mice reveal the extent and cell specificity of Tam-induced Cre activity. CMMCM mice were crossed with mice that were homozygous for a Cre reporter cassette in which the open reading frame encoding mGFP is preceded by a strong transcriptional termination signal. As confirmed by PCR screening, all F1 offspring carried the reporter cassette, and ∼50% were double-transgenic, i.e., they also carried the CMMCM cassette. Groups of F1 mice (CMMCM and MCM− littermates, all reporter+) were inoculated with Tam and were sacrificed 4 days later. One group of double-transgenic animals received vehicle alone (corn oil). The expression of mGFP (reflecting MCM enzymatic activity) was determined in heart and liver using confocal microscopy of vibratome sections. Blue, nuclei (Hoechst 33342 dye); ochre, F-actin (phalloidin-Alexa Fluor 647 dye; phalloidin binds to F-actin, thereby revealing the cytoskeleton). In all panels, the upper row shows blue and green color channels, and the lower row shows the identical fields, this time with all three channels. (A to C) Heart sections (longitudinal and transverse sections in left and right columns, respectively). (D) Transverse heart section, showing absence of mGFP on vascular endothelial cells (lower right corner of images; indicated by red arrowheads in upper image). (E) Organ specificity, shown by absence of mGFP on hepatocytes.
Ablation of T1IFN receptor from cardiomyocytes results in early loss of viral control in the heart but not in the liver.
Next, we determined the impact of cardiomyocyte-specific T1IFN receptor ablation on the outcome of wtCVB3 infection. Groups of CMMCM T1IFNRf/f mice, or MCM− littermate controls, were inoculated with Tam. Fourteen days later, all mice were infected with wtCVB3. In contrast to standard T1IFNRKO mice, many Tam-treated CMMCM T1IFNRf/f animals survived beyond day 3 p.i., validating one of our reasons for generating this mouse strain and allowing us to evaluate the kinetics of virus replication over a 12-day time course. The titers observed throughout the course of infection in Tam-treated MCM− mice were very similar to those that we have previously reported for wt C57BL/6 animals (66), consistent with the mice being on the same genetic background, and also indicating that viral replication was not appreciably altered by Tam inoculation at 14 days prior to infection. As shown in Fig. 4A, cardiac titers were similar in the CMMCM and MCM− groups at day 2 p.i., but a marked difference had developed 24 h later; mice in which cardiomyocytes were unable to respond to T1IFN had ∼20-fold-higher viral mean titers. Similar or greater differences (up to ∼100-fold) were observed at days 4, 6, and 8 p.i., and at day 12 p.i., wtCVB3 cardiac titers were ∼2,000-fold higher in the hearts of surviving CMMCM mice than in MCM− animals. In contrast, hepatic titers of wtCVB3 (Fig. 4B) were closely comparable in the two groups across the entire span of the experiment, except at the day 12 time point, when low virus titers remained detectable in a number of the surviving CMMCM mice; since there is no detectable MCM activity in the liver (Fig. 2B and 3E), we consider it probable that this reflects ongoing hepatic seeding from the heart, in which virus is abundant in these animals. Taken together, these data demonstrate that T1IFN does act directly within the heart, signaling into cardiomyocytes and helping to suppress the production of infectious CVB3.
FIG 4.
Ablation of T1IFN receptor from cardiomyocytes results in early loss of viral control in the heart but not in the liver. Eight- to 20-week-old CMMCM T1IFNRf/f mice (red bars) and littermate MCM− controls (green bars) were treated with Tam as described, and at least 2 weeks were allowed to elapse. The mice then were infected with wtCVB3 (500 PFU i.p.). (A and B) Mice were sacrificed at the indicated time points p.i., and viral titers were determined in the heart (A) and liver (B). The number of mice evaluated at each time point is indicated by white numerals near the base of each bar and represents the cumulative data derived from several separate experiments, in all of which the groups were age and sex matched. The lower limit of virus detection was 100 PFU per gram of tissue. ND, not detected. (C) Blood samples were drawn either prior to infection (day 0) or at day 3, 6, or 10 p.i., and serum IFN-α levels were determined by ELISA.
We have previously shown that, following CVB3 infection of C57BL/6 mice, serum T1IFN (IFN-α) levels are unaltered at day 1 p.i. but are markedly raised on days 2 and 3 before declining on day 4 p.i. (67). This elevation of serum T1IFN is temporally coincident with the observed divergence of viral titer in the hearts of the two mouse groups, suggesting that the cardiomyocytes in MCM− mice may be responding to this brief early burst of T1IFN. Therefore, we considered it important to determine the kinetics of T1IFN production in MCM− and CMMCM mice. Mice were infected with wtCVB3, and blood was drawn at days 0, 3, 6, and 10 p.i. As shown in Fig. 4C, in both mouse groups we observed a spike of serum T1IFN on day 3 that returned to background by day 6 (the difference in serum levels at day 3 was not statistically significant). These data are in line with the notion that the loss of viral control in the hearts of CMMCM mice at day 3 p.i. (Fig. 4A) reflects the inability of their cardiomyocytes to respond to blood-borne T1IFN. Moreover, the data show that the persistent elevation of intracardiac titers in CMMCM animals (Fig. 4A) is not accompanied by chronic elevation of serum T1IFN (Fig. 4C).
Effects of cardiomyocyte-specific deletion of type I IFN signaling on viral RNA.
We next evaluated the impact of T1IFN signaling on CVB3 RNA in the heart. RNA isolated from the hearts of Tam-treated CMMCM T1IFNRf/f mice and MCM− littermates was subjected to quantitative PCR. Genomic RNA levels in the two mouse groups were similar at day 2 p.i. but diverged substantially on subsequent days (Fig. 5A), paralleling the observations for viral titers (Fig. 4A). Thus, T1IFN signaling into cardiomyocytes (i.e., in the MCM− littermate controls) plays an important part in controlling infectious virus production (Fig. 4A) and genome RNA content (Fig. 5A); the magnitude of these effects is relatively small at day 2 p.i. but increases thereafter. A comparison of genome copy number with infectious virus titer (both measured per gram of heart) showed a very strong correlation (Fig. 5B, P < 0.0001), and the ratio of genome number to infectious virus titer in the heart was essentially linear (∼1,000:1) across the entire range of titers. Hence, in the absence of T1IFN signaling in vivo, there is an increase in viral RNA replication that is reflected by an equivalent rise in packaging/egress, to generate infectious particles. Finally, we used in situ hybridization to identify the location, and to gauge the respective quantities, of viral genomic and antigenomic materials. As shown in Fig. 5C, at day 8 p.i. genomic CVB3 RNA was readily detected in the hearts of both CMMCM T1IFNRf/f and MCM− mice. In both cases, genomic material was in far greater abundance than antigenomic material, consistent with active enteroviral replication in which the ratio of genomic to antigenomic RNA is frequently ∼100:1. Furthermore, although we cannot exclude differences in low-level viral RNA loads, in the two cases the distributions of CVB3 genomic RNA appeared similarly focal. In summary, ablation of T1IFN signaling into cardiomyocytes increases the load of genomic RNA and of infectious virus but does not lead to unconstrained infection of all cardiomyocytes.
FIG 5.
Effects of cardiomyocyte-specific deletion of type I IFN signaling on viral RNA. (A) Viral genomic RNA content was determined by reverse transcription-qPCR as described in Materials and Methods. All mice were T1IFNRf/f and had been treated with Tam at least 2 weeks prior to infection. Means + standard errors are shown. (B) The correlations between infectious virus titer (data in Fig. 4A) and genome copy number (this figure, panel A) between days 2 and 8 p.i. are shown, together with a best-fit linear regression line. (C) In situ hybridization was carried out on hearts at day 8 p.i. Mice are identified by their designated number (#), and for each mouse, the copy number of genomic RNA per gram of heart (c/g), measured by qPCR (A), is shown. Top row, probe detecting genomic RNA; bottom row, probe detecting antigenomic RNA.
CVB-induced pathology is accelerated and exacerbated in the absence of T1IFN signaling into cardiomyocytes.
The above observations of increased virus titers (Fig. 4) and viral genomic RNA load (Fig. 5) in the hearts of Tam-treated CMMCM T1IFNRf/f mice suggested that virus-related pathology, too, might be exacerbated. This proved to be the case, judging by two criteria. First, as noted in the introduction, CVB3 is an established, and common, cause of acute infectious myocarditis. In contrast to chronic myocarditis, which is rather strain dependent, most mouse strains are susceptible to the acute disease, although the kinetics with which overt inflammatory responses develop differ somewhat; in C57BL/6 mice, acute myocarditis generally first becomes readily detectable by approximately day 8 p.i. and more florid by approximately day 12. As shown in Fig. 6A (top row), the hearts of MCM− mice appeared histologically normal at day 6, despite carrying ∼2 × 106 PFU/g of wtCVB3 (Fig. 4). By day 8, both large and small lesions were visible (white and yellow arrows, respectively). In contrast, the CMMCM T1IFNRf/f animals developed a profound myocarditis as early as 6 days p.i., and this was maintained at day 8 (Fig. 6A, bottom row). Furthermore, there was a marked increase in mortality. Ninety-five percent of CMMCM T1IFNRf/f mice succumbed to wtCVB3 by day 12 p.i., compared to only 30% of their MCM− littermates (Fig. 6B). Mortality was not only increased but also accelerated; deaths in the CMMCM group began as early as day 4 and continued throughout the course of the experiment; deaths in the control group clustered at days 6 to 7.
FIG 6.
CVB-induced pathology is accelerated and exacerbated in the absence of T1IFN signaling into cardiomyocytes. T1IFNRf/f mice (MCM− or CMMCM) were treated with Tam and then infected with 500 PFU of wtCVB3. (A) Paraffin-embedded sections from hearts of representative mice are shown (day 6 or day 8 p.i., stained with Masson's trichrome). For the day 8 MCM− image, yellow arrows indicate two small inflammatory lesions, and the white arrow shows a larger lesion. (B) In a separate experiment, survival of both Tam-treated mouse strains was assessed over a 12-day period. Kaplan-Meier survival curves, and statistical comparisons thereof (log-rank, Mantel-Cox), were generated using GraphPad Prism v6.04.
DISCUSSION
Most acute virus infections induce both humoral and cellular adaptive immune responses that combine to control the infection and, ultimately, to eradicate the agent. Infection by CVB and other enteroviruses triggers a rapid and effective neutralizing antibody response that is central to controlling virus dissemination and clearance (40, 68–70); these viruses do not trigger a strong virus-specific CD8+ T cell response, presumably because certain viral proteins can strongly inhibit antigen presentation by major histocompatibility complex (MHC) class I (56, 71–73). However, adaptive immunity—be it humoral or cellular—does not develop for several days p.i., so the initial responsibility for enteroviral suppression falls upon innate responses, including the type I interferons (T1IFNs), production of which is triggered by the interaction of viral nucleic acids and/or proteins with cellular sensors, including endosomal Toll-like receptors (TLRs; in particular, TLR3 and TLR7/8) and RNA helicases (in particular, MDA5). There is little doubt that T1IFN is important in combatting enteroviral infection. Genetic analysis of patients with enteroviral myocarditis revealed a rare variant of one sensor, TLR3, at amino acid (aa) 554, as well as a TLR3 polymorphism (L/F at aa 412) in which the F/F genotype was twice as common in patients as in controls; both TLR3 proteins (aa 554 and F412) showed reduced T1IFN signaling in tissue culture (74, 75). TLR3-deficient mice are more susceptible to CVB3 infection (63, 76, 77), as are mice deficient in other molecules that are involved in T1IFN production, such as TLR7 (78), MDA5 (79, 80), MAVS (79), TRIF (76, 81, 82), and MyD88 (83, 84). Furthermore, clinical studies have demonstrated the utility of IFN-β in treating enteroviral myocarditis (44, 45). However, none of the above data prove that T1IFN acts directly on infected cells in the heart, and as outlined in the introduction, others have proposed that the impact of these cytokines on CVB may be extracardiac and that the cardiac infection may be controlled by other innate responses. The suggestion that antiviral innate immune responses may vary depending on cell type is plausible. The various subtypes of IFN-α induce subtly different responses, and for any one subtype, the exact response that is induced often is target cell specific (85). IFN-β, too, induces cell-type-specific responses; cardiac fibroblasts and cardiac myocytes differ in the expression of, and responsiveness to, IFN-β in vitro (86, 87). Finally, a recent in vivo study showed that different populations of neurons varied in their innate responses to virus infection (88). Hence, we considered it reasonable to test the hypothesis that T1IFN might modulate CVB infection in some organs/cell types but not in cardiomyocytes.
The data presented here demonstrate clearly that T1IFN signaling into cardiomyocytes does play a key role in constraining virus replication in the heart. This is suggested by the observation that standard KO mice lacking the T1IFNR have elevated viral titers in the heart (Fig. 1C) and is confirmed by the subsequent studies in Tam-treated CMMCM T1IFNRf/f mice which showed that, in the absence of such signaling, virus titers (Fig. 4A), and genome copy numbers (Fig. 5A), are substantially increased. However, widespread dissemination of virus within the heart was not observed (Fig. 5C), even in hearts in which there was a demonstrable increase in viral RNA content and infectious virus load. This is congruent with the suggestion that other innate responses, unrelated to T1IFN, may be important in limiting CVB3 spread in the heart. Nevertheless, in the absence of T1IFN signaling, cardiac virus titers were not only markedly higher, they also were prolonged, suggesting that T1IFN-unresponsive cardiomyocytes may provide a safe haven in which the viruses can maintain a productive infection. This may explain why virus was readily detected (∼4 × 104 PFU/g) in the livers of Tam-treated CMMCM T1IFNRf/f mice as late as day 12 p.i. (Fig. 4B); this is unlikely to have resulted from unintended deletion of the floxed locus in hepatocytes, because neither relevant PCR products (Fig. 2B) nor mGFP-expressing cells in Cre reporter mice (Fig. 3E) were detectable in that organ following Tam treatment of CMMCM mice.
Despite the fact that viral infection remained focal, we observed a dramatic acceleration, and exacerbation, of acute myocarditis, which was present as early as day 6 in Tam-treated CMMCM T1IFNRf/f mice (Fig. 6A). Several factors may contribute to this phenomenon. The ∼20- to ∼100-fold-higher cardiac virus titers from day 3 p.i. onward (Fig. 4A) would be expected to increase the number of cardiomyocytes that are killed directly by the virus infection. In addition, the higher virus titer would increase the influx of inflammatory cells which can, themselves, damage the heart. This amplified inflammatory response would be triggered, at least in part, by the increased copy number of viral RNAs which, by activating cytosolic sensors, may cause the virus-infected cardiomyocytes to produce T1IFN. This raises a key question: what is the source of the T1IFN that, as we show here, signals into normal cardiomyocytes and mitigates both infection and disease? Are these cytokines synthesized within the infected heart, or elsewhere? For reasons explained below, we propose that the T1IFNs that act on cardiomyocytes may have both extracardiac and local origins.
The effects of T1IFNR ablation (increased cardiac viral titer and genome content in Tam-treated CMMCM T1IFNRf/f mice) did not become obvious until day 3 p.i. (Fig. 4A and B and 5A). Hence, the antiviral effects of T1IFN in the heart were not as rapid as might have been expected had the cytokines been immediately produced within the heart itself. Although this ∼72-h delay by no means excludes the possibility that the T1IFN is produced locally, it is arguably more consistent with an extracardiac source. Serum IFN-α levels do not rise until ∼48 h p.i. (Fig. 4C) (67), and the antiviral benefit of T1IFN in the hearts of T1IFNR-intact (i.e., MCM−) mice is seen soon thereafter; therefore, we favor the explanation that, under normal circumstances, the initial effects of T1IFN signaling into cardiomyocytes are mediated by cytokines that are delivered by the hematogenous route, perhaps being released into the blood by extracardiac plasmacytoid dendritic cells. However, and intriguingly, the difference in virus titers between the two groups appeared to increase over time (Fig. 4), indicating that T1IFN continues to act in the hearts of the MCM− mice until the virus is eradicated. However, serum T1IFN levels had returned to background level at days 6 and 10 p.i. (Fig. 4C), so we speculate that the antiviral effects of T1IFNs at these later stages are mediated by cytokines that are locally released from infected cardiomyocytes. Consequently, we propose that the actions of T1IFNs within the genetically intact heart are biphasic and reflect two different sources of the cytokine: (i) there is a short burst of systemic T1IFN at day 2 to 3 p.i., which suppresses the virus and also activates interferon-stimulated gene (ISG) expression in cardiomyocytes (infected and uninfected); this short burst of systemic T1IFN should dramatically upregulate the production of T1IFNs by infected cardiomyocytes; and (ii) these locally produced cytokines maintain the antiviral state in neighboring uninfected cells, facilitating eventual clearance by the adaptive immune response. In contrast, in the absence of T1IFN receptor, cardiomyocytes can respond to neither of these sources of T1IFN; the inability to respond to serum T1IFN results in the observed early loss of viral control, and the failure to respond to locally produced T1IFN may explain the prolongation of the infection and the increasingly divergent cardiac viral titer that is observed between days 3 and 12 p.i. These proposals are consistent with our current understanding of T1IFN production by cardiomyocytes. Cardiac cells express several of the IFN-α subtypes, and the expression pattern varies in a cell-specific manner (89). IRF7, too, is expressed, at a low level, in resting cardiomyocytes, along with additional interferon-stimulated genes (ISGs) and even a low level of IFN-β (86); indeed, it has been proposed that the constitutive expression of these proteins renders the cardiomyocytes poised to respond to virus infection, perhaps to protect against the death of these hard-to-replace cells (86). Furthermore, T1IFN expression is upregulated in neonatal cardiomyocytes within 8 h of in vitro reovirus infection (89). In addition, elegant work from the Vallejo group has shown that cardiomyocyte-specific in vivo overexpression of TRIF and MDA5, which are important for triggering T1IFN synthesis, confers a substantial degree of protection against the picornavirus encephalomyocarditis virus, limiting both cardiac titers and myocarditis (90, 91). Thus, normal cardiomyocytes can produce T1IFNs and related proteins, they can very rapidly upregulate them after virus infection, and the enhancement of T1IFN-related signaling pathways in cardiomyocytes can confer protection in vivo. Taken together, these data strongly implicate locally produced T1IFNs in control of virus infection.
We suggest, above, that higher virus titers may explain the accelerated myocarditis in the CMMCM T1IFNRf/f mice. However, we speculate that the local production of T1IFNs also may contribute to exacerbated disease in these receptor-deficient hearts. Several lines of evidence support the idea that local synthesis of T1IFNs can be harmful to the tissue in which the cells reside. First, Aicardi-Goutieres syndrome, a recessive genetic central nervous system (CNS) disease (92), is driven by the increased production of IFN-α with the central nervous system (93), and T1IFN-mediated neurodegeneration can be exacerbated by CNS virus infection (94). Additional data are directly relevant to the cardiac studies reported here. Second, the hearts of “cardiomyocyte signaling-enhanced” transgenic mice generated by Vallejo and colleagues (90, 91) have higher baseline expression of several T1IFN-related antiviral cytokines and of ISGs. Although no cardiac dysfunction was reported, some cellular infiltration was present in these uninfected hearts. Arguably, this inflammation reveals why evolution has not selected a higher baseline for T1IFN responsiveness: the potential benefit of a faster/higher T1IFN response (improved resistance to cardiac viral infection and disease) is more than offset by the likely cost (immunopathological damage). Third, recent data have shown that the inappropriate local expression of T1IFN in the heart, in the absence of any infection, is sufficient to initiate a profound myocarditis. The underlying genetic defect in Aicardi-Goutieres syndrome, which causes the overproduction of T1IFN, is a mutation in one of two nucleases, Trex1 or RNase H2 (95, 96). These mutations result in the accumulation of unwanted endogenous (i.e., host-derived) nucleic acids, which activate intracellular pattern recognition receptors; these, in turn, drive the synthesis of T1IFN by the affected cells. Trex1KO mice have been generated, and interestingly, the mice develop an acute myocarditis (97). Subsequent studies showed that this myocarditis is triggered by local production of T1IFN, which recruits hematopoietic cells (including macrophages, NK cells, and T cells) to the heart (98, 99). Thus, in relation to our own findings, we propose that the inability of the Tam-treated CMMCM T1IFNRf/f cardiomyocytes to respond to extracardiac T1IFN, and the resulting increase in virus/RNA load in the hearts, may lead to increased local synthesis of T1IFN by infected cardiomyocytes and that this, in turn, may contribute to the very rapid influx of inflammatory cells that we have observed.
In conclusion, we have demonstrated here that mice lacking T1IFN signaling into cardiomyocytes are less able to control acute CVB3 infection and show increased susceptibility to disease. This mouse model will be valuable for at least two future studies. First, the mice will allow the evaluation of cardiomyocyte-specific patterns of ISG synthesis in response to infection, by comparison of intracardiac ISGs in MCM− mice with those in CMMCM T1IFNRf/f animals. Second, in the experiments reported here, Tam invariably was administered to mice prior to virus infection, an approach that does not fully exploit the inducible nature of the MCM system, one signal advantage of which is that it allows the deletion to be induced during or after an acute infection and during a chronic (persistent) infection. The latter may be of particular interest because, as noted in the introduction, CVB RNA can persist in the heart and has been correlated with the development of DCM. In that light, the CMMCM T1IFNRf/f model provides an opportunity to determine, for example, whether or not T1IFN signaling into cardiomyocytes facilitates the establishment and/or maintenance of the persistent state.
ACKNOWLEDGMENTS
We thank Ulrich Kalinke for providing the T1IFNRf/f mice, which were made under the sponsorship of the Paul Ehrlich Institute, Langen, Germany. We are grateful to Sheila Silverstein for excellent secretarial support.
This work was supported by NIH grants AI042314 and HL093177 (to J.L.W.).
Footnotes
Published ahead of print 26 February 2014
This is manuscript number 25059 from the Scripps Research Institute.
REFERENCES
- 1.Magnani JW, Dec GW. 2006. Myocarditis: current trends in diagnosis and treatment. Circulation 113:876–890. 10.1161/CIRCULATIONAHA.105.584532 [DOI] [PubMed] [Google Scholar]
- 2.Esfandiarei M, McManus BM. 2008. Molecular biology and pathogenesis of viral myocarditis. Annu. Rev. Pathol. 3:127–155. 10.1146/annurev.pathmechdis.3.121806.151534 [DOI] [PubMed] [Google Scholar]
- 3.Marchant D, Si X, Luo H, McManus B, Yang D. 2008. The impact of CVB3 infection on host cell biology. Curr. Top. Microbiol. Immunol. 323:177–198. 10.1007/978-3-540-75546-3_8 [DOI] [PubMed] [Google Scholar]
- 4.Andreoletti L, Leveque N, Boulagnon C, Brasselet C, Fornes P. 2009. Viral causes of human myocarditis. Arch. Cardiovasc. Dis. 102:559–568. 10.1016/j.acvd.2009.04.010 [DOI] [PubMed] [Google Scholar]
- 5.Mahfoud F, Gartner B, Kindermann M, Ukena C, Gadomski K, Klingel K, Kandolf R, Bohm M, Kindermann I. 2011. Virus serology in patients with suspected myocarditis: utility or futility? Eur. Heart J. 32:897–903. 10.1093/eurheartj/ehq493 [DOI] [PubMed] [Google Scholar]
- 6.Blauwet LA, Cooper LT. 2010. Myocarditis. Prog. Cardiovasc. Dis. 52:274–288. 10.1016/j.pcad.2009.11.006 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Sagar S, Liu PP, Cooper LT., Jr 2012. Myocarditis. Lancet 379:738–747. 10.1016/S0140-6736(11)60648-X [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Corsten MF, Schroen B, Heymans S. 2012. Inflammation in viral myocarditis: friend or foe? Trends Mol. Med. 18:426–437. 10.1016/j.molmed.2012.05.005 [DOI] [PubMed] [Google Scholar]
- 9.Wakafuji S, Okada R. 1986. Twenty year autopsy statistics of myocarditis incidence in Japan. Jpn. Circ. J. 50:1288–1293. 10.1253/jcj.50.1288 [DOI] [PubMed] [Google Scholar]
- 10.Gravanis MB, Sternby NH. 1991. Incidence of myocarditis. A 10-year autopsy study from Malmo, Sweden. Arch. Pathol. Lab. Med. 115:390–392 [PubMed] [Google Scholar]
- 11.Carniel E, Sinagra G, Bussani R, Di Lenarda A, Pinamonti B, Lardieri G, Silvestri F. 2004. Fatal myocarditis: morphologic and clinical features. Ital. Heart J. 5:702–706 [PubMed] [Google Scholar]
- 12.Ward C. 1978. Severe arrhythmias in coxsackievirus B3 myopericarditis. Arch. Dis. Child. 53:174–176. 10.1136/adc.53.2.174 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Bendig JWA, O'Brien PS, Muir P, Porter HJ, Caul EO. 2001. Enterovirus sequences resembling coxsackievirus A2 detected in stool and spleen from a girl with fatal myocarditis. J. Med. Virol. 64:482–486. 10.1002/jmv.1075 [DOI] [PubMed] [Google Scholar]
- 14.Eckart RE, Scoville SL, Campbell CL, Shry EA, Stajduhar KC, Potter RN, Pearse LA, Virmani R. 2004. Sudden death in young adults: a 25-year review of autopsies in military recruits. Ann. Intern. Med. 141:829–834. 10.7326/0003-4819-141-11-200412070-00005 [DOI] [PubMed] [Google Scholar]
- 15.O'Connell JB. 1987. The role of myocarditis in end-stage dilated cardiomyopathy. Tex. Heart Inst. J. 14:268–275 [PMC free article] [PubMed] [Google Scholar]
- 16.Sole MJ, Liu P. 1993. Viral myocarditis: a paradigm for understanding the pathogenesis and treatment of dilated cardiomyopathy. J. Am. Coll. Cardiol. 22:99A–105A. 10.1016/0735-1097(93)90470-L [DOI] [PubMed] [Google Scholar]
- 17.Riecansky I, Schreinerova Z, Egnerova A, Petrovicova A, Bzduchova O. 1989. Incidence of coxsackie virus infection in patients with dilated cardiomyopathy. Cor Vasa 31:225–230 [PubMed] [Google Scholar]
- 18.Kuhl U, Pauschinger M, Noutsias M, Seeberg B, Bock T, Lassner D, Poller W, Kandolf R, Schultheiss HP. 2005. High prevalence of viral genomes and multiple viral infections in the myocardium of adults with “idiopathic” left ventricular dysfunction. Circulation 111:887–893. 10.1161/01.CIR.0000155616.07901.35 [DOI] [PubMed] [Google Scholar]
- 19.Archard LC, Bowles NE, Cunningham L, Freeke CA, Olsen EG, Rose ML, Meany B, Why HJ, Richardson PJ. 1991. Molecular probes for detection of persisting enterovirus infection of human heart and their prognostic value. Eur. Heart J. 12(Suppl D):56–59. 10.1093/eurheartj/12.suppl_D.56 [DOI] [PubMed] [Google Scholar]
- 20.Heim A, Canu A, Kirschner P, Simon T, Mall G, Hofschneider PH, Kandolf R. 1992. Synergistic interaction of interferon-β and interferon-γ in coxsackievirus B3-infected carrier cultures of human myocardial fibroblasts. J. Infect. Dis. 166:958–965. 10.1093/infdis/166.5.985 [DOI] [PubMed] [Google Scholar]
- 21.Kandolf R, Canu A, Hofschneider PH. 1985. Coxsackie B3 virus can replicate in cultured human foetal heart cells and is inhibited by interferon. J. Mol. Cell. Cardiol. 17:167–181. 10.1016/S0022-2828(85)80019-5 [DOI] [PubMed] [Google Scholar]
- 22.Hofschneider PH, Klingel K, Kandolf R. 1990. Toward understanding the pathogenesis of enterovirus-induced cardiomyopathy: molecular and ultrastructural approaches. J. Struct. Biol. 104:32–37. 10.1016/1047-8477(90)90054-G [DOI] [PubMed] [Google Scholar]
- 23.Klingel K, Kandolf R. 1993. The role of enterovirus replication in the development of acute and chronic heart muscle disease in different immunocompetent mouse strains. Scand. J. Infect. Dis. Suppl. 88:79–85 [PubMed] [Google Scholar]
- 24.Gomez RM, Lopez Costa JJ, Pecci Saavedra G, Berria MI. 1993. Ultrastructural study of cell injury induced by coxsackievirus B3 in pancreatic and cardiac tissues. Medicina (B. Aires) 53:300–306 [PubMed] [Google Scholar]
- 25.Herzum M, Ruppert V, Kuytz B, Jomaa H, Nakamura I, Maisch B. 1994. Coxsackievirus B3 infection leads to cell death of cardiac myocytes. J. Mol. Cell. Cardiol. 26:907–913. 10.1006/jmcc.1994.1108 [DOI] [PubMed] [Google Scholar]
- 26.Kallewaard NL, Zhang L, Chen JW, Guttenberg M, Sanchez MD, Bergelson JM. 2009. Tissue-specific deletion of the coxsackievirus and adenovirus receptor protects mice from virus-induced pancreatitis and myocarditis. Cell Host Microbe 6:91–98. 10.1016/j.chom.2009.05.018 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Shi Y, Chen C, Lisewski U, Wrackmeyer U, Radke M, Westermann D, Sauter M, Tschope C, Poller W, Klingel K, Gotthardt M. 2009. Cardiac deletion of the coxsackievirus-adenovirus receptor abolishes coxsackievirus B3 infection and prevents myocarditis in vivo. J. Am. Coll. Cardiol. 53:1219–1226. 10.1016/j.jacc.2008.10.064 [DOI] [PubMed] [Google Scholar]
- 28.Huber S, Sartini D. 2005. T cells expressing the Vγ1 T-cell receptor enhance virus-neutralizing antibody response during coxsackievirus B3 infection of BALB/c mice: differences in male and female mice. Viral Immunol. 18:730–739. 10.1089/vim.2005.18.730 [DOI] [PubMed] [Google Scholar]
- 29.Woodruff JF, Woodruff JJ. 1974. Involvement of T lymphocytes in the pathogenesis of coxsackie virus B3 heart disease. J. Immunol. 113:1726–1734 [PubMed] [Google Scholar]
- 30.Hashimoto I, Tatsumi M, Nakagawa M. 1983. The role of T lymphocytes in the pathogenesis of coxsackie virus B3 heart disease. Br. J. Exp. Pathol. 64:497–504 [PMC free article] [PubMed] [Google Scholar]
- 31.Ytterberg SR, Mahowald ML, Messner RP. 1988. T cells are required for coxsackievirus B1 induced murine polymyositis. J. Rheumatol. 15:475–478 [PubMed] [Google Scholar]
- 32.Kishimoto C, Abelmann WH. 1990. In vivo significance of T cells in the development of coxsackievirus B3 myocarditis in mice. Immature but antigen-specific T cells aggravate cardiac injury. Circ. Res. 67:589–598 [DOI] [PubMed] [Google Scholar]
- 33.Henke A, Huber SA, Stelzner A, Whitton JL. 1995. The role of CD8+ T lymphocytes in coxsackievirus B3-induced myocarditis. J. Virol. 69:6720–6728 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Huber SA. 2006. Autoimmunity in coxsackievirus B3 induced myocarditis. Autoimmunity 39:55–61. 10.1080/08916930500484906 [DOI] [PubMed] [Google Scholar]
- 35.Huber S, Song WC, Sartini D. 2006. Decay-accelerating factor (CD55) promotes CD1d expression and Vγ4+ T-cell activation in coxsackievirus B3-induced myocarditis. Viral Immunol. 19:156–166. 10.1089/vim.2006.19.156 [DOI] [PubMed] [Google Scholar]
- 36.Huber SA, Born W, O'Brien R. 2005. Dual functions of murine γδ cells in inflammation and autoimmunity in coxsackievirus B3-induced myocarditis: role of Vγ1+ and Vγ4+ cells. Microbes Infect. 7:537–543. 10.1016/j.micinf.2004.12.011 [DOI] [PubMed] [Google Scholar]
- 37.Gauntt CJ, Higdon AL, Arizpe HM, Tamayo MR, Crawley R, Henkel RD, Pereira ME, Tracy SM, Cunningham MW. 1993. Epitopes shared between coxsackievirus B3 (CVB3) and normal heart tissue contribute to CVB3-induced murine myocarditis. Clin. Immunol. Immunopathol. 68:129–134. 10.1006/clin.1993.1108 [DOI] [PubMed] [Google Scholar]
- 38.Gauntt CJ, Arizpe HM, Higdon AL, Wood HJ, Bowers DF, Rozek MM, Crawley R. 1995. Molecular mimicry, anti-coxsackievirus B3 neutralizing monoclonal antibodies, and myocarditis. J. Immunol. 154:2983–2995 [PubMed] [Google Scholar]
- 39.Chow LH, Beisel KW, McManus BM. 1992. Enteroviral infection of mice with severe combined immunodeficiency. Evidence for direct viral pathogenesis of myocardial injury. Lab. Invest. 66:24–31 [PubMed] [Google Scholar]
- 40.Mena I, Perry CM, Harkins S, Rodriguez F, Gebhard JR, Whitton JL. 1999. The role of B lymphocytes in coxsackievirus B3 infection. Am. J. Pathol. 155:1205–1215. 10.1016/S0002-9440(10)65223-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Wessely R, Klingel K, Knowlton KU, Kandolf R. 2001. Cardioselective infection with coxsackievirus B3 requires intact type I interferon signaling: implications for mortality and early viral replication. Circulation 103:756–761. 10.1161/01.CIR.103.5.756 [DOI] [PubMed] [Google Scholar]
- 42.Deonarain R, Cerullo D, Fuse K, Liu PP, Fish EN. 2004. Protective role for interferon-β in coxsackievirus B3 infection. Circulation 110:3540–3543. 10.1161/01.CIR.0000136824.73458.20 [DOI] [PubMed] [Google Scholar]
- 43.Wang YX, da Cunha V, Vincelette J, White K, Velichko S, Xu Y, Gross C, Fitch RM, Halks-Miller M, Larsen BR, Yajima T, Knowlton KU, Vergona R, Sullivan ME, Croze E. 2007. Antiviral and myocyte protective effects of murine interferon-β and -α2 in coxsackievirus B3-induced myocarditis and epicarditis in Balb/c mice. Am. J. Physiol. Heart Circ. Physiol. 293:H69–H76. 10.1152/ajpheart.00154.2007 [DOI] [PubMed] [Google Scholar]
- 44.Kuhl U, Pauschinger M, Schwimmbeck PL, Seeberg B, Lober C, Noutsias M, Poller W, Schultheiss HP. 2003. Interferon-β treatment eliminates cardiotropic viruses and improves left ventricular function in patients with myocardial persistence of viral genomes and left ventricular dysfunction. Circulation 107:2793–2798. 10.1161/01.CIR.0000072766.67150.51 [DOI] [PubMed] [Google Scholar]
- 45.Kuhl U, Lassner D, von Schlippenbach J, Poller W, Schultheiss HP. 2012. Interferon-β improves survival in enterovirus-associated cardiomyopathy. J. Am. Coll. Cardiol. 60:1295–1296. 10.1016/j.jacc.2012.06.026 [DOI] [PubMed] [Google Scholar]
- 46.Yasukawa H, Yajima T, Duplain H, Iwatate M, Kido M, Hoshijima M, Weitzman MD, Nakamura T, Woodard S, Xiong D, Yoshimura A, Chien KR, Knowlton KU. 2003. The suppressor of cytokine signaling-1 (SOCS1) is a novel therapeutic target for enterovirus-induced cardiac injury. J. Clin. Invest. 111:469–478. 10.1172/JCI16491 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Yajima T, Yasukawa H, Jeon ES, Xiong D, Dorner A, Iwatate M, Nara M, Zhou H, Summers-Torres D, Hoshijima M, Chien KR, Yoshimura A, Knowlton KU. 2006. Innate defense mechanism against virus infection within the cardiac myocyte requiring gp130-STAT3 signaling. Circulation 114:2364–2373. 10.1161/CIRCULATIONAHA.106.642454 [DOI] [PubMed] [Google Scholar]
- 48.Kamphuis E, Junt T, Waibler Z, Forster R, Kalinke U. 2006. Type I interferons directly regulate lymphocyte recirculation and cause transient blood lymphopenia. Blood 108:3253–3261. 10.1182/blood-2006-06-027599 [DOI] [PubMed] [Google Scholar]
- 49.Sohal DS, Nghiem M, Crackower MA, Witt SA, Kimball TR, Tymitz KM, Penninger JM, Molkentin JD. 2001. Temporally regulated and tissue-specific gene manipulations in the adult and embryonic heart using a tamoxifen-inducible Cre protein. Circ. Res. 89:20–25. 10.1161/hh1301.092687 [DOI] [PubMed] [Google Scholar]
- 50.Muller U, Steinhoff U, Reis LFL, Hemmi S, Pavlovic J, Zinkernagel RM, Aguet M. 1994. Functional role of type I and type II interferons in antiviral defense. Science 264:1918–1921. 10.1126/science.8009221 [DOI] [PubMed] [Google Scholar]
- 51.Huang S, Hendriks W, Althage A, Hemmi S, Bluethmann H, Kamijo R, Vilcek J, Zinkernagel RM, Aguet M. 1993. Immune response in mice that lack the interferon-γ receptor. Science 259:1742–1745. 10.1126/science.8456301 [DOI] [PubMed] [Google Scholar]
- 52.Danielian PS, White R, Hoare SA, Fawell SE, Parker MG. 1993. Identification of residues in the estrogen receptor that confer differential sensitivity to estrogen and hydroxytamoxifen. Mol. Endocrinol. 7:232–240. 10.1210/mend.7.2.8469236 [DOI] [PubMed] [Google Scholar]
- 53.Littlewood TD, Hancock DC, Danielian PS, Parker MG, Evan GI. 1995. A modified oestrogen receptor ligand-binding domain as an improved switch for the regulation of heterologous proteins. Nucleic Acids Res. 23:1686–1690. 10.1093/nar/23.10.1686 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Zhang Y, Riesterer C, Ayrall AM, Sablitzky F, Littlewood TD, Reth M. 1996. Inducible site-directed recombination in mouse embryonic stem cells. Nucleic Acids Res. 24:543–548. 10.1093/nar/24.4.543 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Muzumdar MD, Tasic B, Miyamichi K, Li L, Luo L. 2007. A global double-fluorescent Cre reporter mouse. Genesis 45:593–605. 10.1002/dvg.20335 [DOI] [PubMed] [Google Scholar]
- 56.Kemball CC, Harkins S, Whitmire JK, Flynn CT, Feuer R, Whitton JL. 2009. Coxsackievirus B3 inhibits antigen presentation in vivo, exerting a profound and selective effect on the MHC class I pathway. PLoS Pathog. 5:e1000618. 10.1371/journal.ppat.1000618 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Furr BJ, Jordan VC. 1984. The pharmacology and clinical uses of tamoxifen. Pharmacol. Ther. 25:127–205. 10.1016/0163-7258(84)90043-3 [DOI] [PubMed] [Google Scholar]
- 58.van Houten N, Bouchard PE, Moraska A, Huber SA. 1991. Selection of an attenuated coxsackievirus B3 variant, using a monoclonal antibody reactive to myocyte antigen. J. Virol. 65:1286–1290 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Knowlton KU, Jeon ES, Berkley N, Wessely R, Huber SA. 1996. A mutation in the puff region of VP2 attenuates the myocarditic phenotype of an infectious cDNA of the Woodruff variant of coxsackievirus B3. J. Virol. 70:7811–7818 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Harkins S, Cornell CT, Whitton JL. 2005. Analysis of translational initiation in coxsackievirus B3 suggests an alternative explanation for the high frequency of R+4 in the eukaryotic consensus motif. J. Virol. 79:987–996. 10.1128/JVI.79.2.987-996.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Hunziker IP, Cornell CT, Whitton JL. 2007. Deletions within the 5′UTR of coxsackievirus B3: consequences for virus translation and replication. Virology 360:120–128. 10.1016/j.virol.2006.09.041 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62.Tabor-Godwin JM, Ruller CM, Bagalso N, An N, Pagarigan RR, Harkins S, Gilbert PE, Kiosses WB, Gude NA, Cornell CT, Doran KS, Sussman MA, Whitton JL, Feuer R. 2010. A novel population of myeloid cells responding to coxsackievirus infection assists in the dissemination of virus within the neonatal CNS. J. Neurosci. 30:8676–8691. 10.1523/JNEUROSCI.1860-10.2010 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63.Negishi H, Osawa T, Ogami K, Ouyang X, Sakaguchi S, Koshiba R, Yanai H, Seko Y, Shitara H, Bishop K, Yonekawa H, Tamura T, Kaisho T, Taya C, Taniguchi T, Honda K. 2008. A critical link between Toll-like receptor 3 and type II interferon signaling pathways in antiviral innate immunity. Proc. Natl. Acad. Sci. U. S. A. 105:20446–20451. 10.1073/pnas.0810372105 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 64.Soonpaa MH, Kim KK, Pajak L, Franklin M, Field LJ. 1996. Cardiomyocyte DNA synthesis and binucleation during murine development. Am. J. Physiol. 271:H2183–H2189 [DOI] [PubMed] [Google Scholar]
- 65.Banerjee I, Fuseler JW, Price RL, Borg TK, Baudino TA. 2007. Determination of cell types and numbers during cardiac development in the neonatal and adult rat and mouse. Am. J. Physiol. Heart Circ. Physiol. 293:H1883–H1891. 10.1152/ajpheart.00514.2007 [DOI] [PubMed] [Google Scholar]
- 66.Gebhard JR, Perry CM, Harkins S, Lane T, Mena I, Asensio VC, Campbell IL, Whitton JL. 1998. Coxsackievirus B3-induced myocarditis: perforin exacerbates disease, but plays no detectable role in virus clearance. Am. J. Pathol. 153:417–428. 10.1016/S0002-9440(10)65585-X [DOI] [PMC free article] [PubMed] [Google Scholar]
- 67.Althof N, Whitton JL. 2013. Coxsackievirus B3 infects the bone marrow and diminishes the restorative capacity of erythroid and lymphoid progenitors. J. Virol. 87:2823–2834. 10.1128/JVI.03004-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 68.Misbah SA, Spickett GP, Ryba PC, Hockaday JM, Kroll JS, Sherwood C, Kurtz JB, Moxon ER, Chapel HM. 1992. Chronic enteroviral meningoencephalitis in agammaglobulinemia: case report and literature review. J. Clin. Immunol. 12:266–270. 10.1007/BF00918150 [DOI] [PubMed] [Google Scholar]
- 69.Kew OM, Sutter RW, Nottay BK, McDonough MJ, Prevots DR, Quick L, Pallansch MA. 1998. Prolonged replication of a type 1 vaccine-derived poliovirus in an immunodeficient patient. J. Clin. Microbiol. 36:2893–2899 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 70.Martin J, Odoom K, Tuite G, Dunn G, Hopewell N, Cooper G, Fitzharris C, Butler K, Hall WW, Minor PD. 2004. Long-term excretion of vaccine-derived poliovirus by a healthy child. J. Virol. 78:13839–13847. 10.1128/JVI.78.24.13839-13847.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 71.Kemball CC, Harkins S, Whitton JL. 2008. Enumeration and functional evaluation of virus-specific CD4+ and CD8+ T cells in lymphoid and peripheral sites of coxsackievirus B3 infection. J. Virol. 82:4331–4342. 10.1128/JVI.02639-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 72.Cornell CT, Kiosses WB, Harkins S, Whitton JL. 2006. Inhibition of protein trafficking by coxsackievirus B3: multiple viral proteins target a single organelle. J. Virol. 80:6637–6647. 10.1128/JVI.02572-05 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 73.Cornell CT, Kiosses WB, Harkins S, Whitton JL. 2007. Coxsackievirus B3 proteins directionally complement each other to downregulate surface major histocompatibility complex class I. J. Virol. 81:6785–6797. 10.1128/JVI.00198-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 74.Gorbea C, Makar KA, Pauschinger M, Pratt G, Bersola JL, Varela J, David RM, Banks L, Huang CH, Li H, Schultheiss HP, Towbin JA, Vallejo JG, Bowles NE. 2010. A role for Toll-like receptor 3 variants in host susceptibility to enteroviral myocarditis and dilated cardiomyopathy. J. Biol. Chem. 285:23208–23223. 10.1074/jbc.M109.047464 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 75.Hardarson HS, Baker JS, Yang Z, Purevjav E, Huang CH, Alexopoulou L, Li N, Flavell RA, Bowles NE, Vallejo JG. 2007. Toll-like receptor 3 is an essential component of the innate stress response in virus-induced cardiac injury. Am. J. Physiol. Heart Circ. Physiol. 292:H251–H258 [DOI] [PubMed] [Google Scholar]
- 76.Abston ED, Coronado MJ, Bucek A, Bedja D, Shin J, Kim JB, Kim E, Gabrielson KL, Georgakopoulos D, Mitzner W, Fairweather D. 2012. Th2 regulation of viral myocarditis in mice: different roles for TLR3 versus TRIF in progression to chronic disease. Clin. Dev. Immunol. 2012:129486. 10.1155/2012/129486 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 77.Abston ED, Coronado MJ, Bucek A, Onyimba JA, Brandt JE, Frisancho JA, Kim E, Bedja D, Sung YK, Radtke AJ, Gabrielson KL, Mitzner W, Fairweather D. 2013. TLR3 deficiency induces chronic inflammatory cardiomyopathy in resistant mice following coxsackievirus B3 infection: role for IL-4. Am. J. Physiol. Regul. Integr. Comp. Physiol. 304:R267–R277. 10.1152/ajpregu.00516.2011 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 78.Wang JP, Asher DR, Chan M, Kurt-Jones EA, Finberg RW. 2007. Cutting edge: antibody-mediated TLR7-dependent recognition of viral RNA. J. Immunol. 178:3363–3367 [DOI] [PubMed] [Google Scholar]
- 79.Wang JP, Cerny A, Asher DR, Kurt-Jones EA, Bronson RT, Finberg RW. 2010. MDA5 and MAVS mediate type I interferon responses to coxsackie B virus. J. Virol. 84:254–260. 10.1128/JVI.00631-09 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 80.Huhn MH, McCartney SA, Lind K, Svedin E, Colonna M, Flodstrom-Tullberg M. 2010. Melanoma differentiation-associated protein-5 (MDA-5) limits early viral replication but is not essential for the induction of type 1 interferons after coxsackievirus infection. Virology 401:42–48. 10.1016/j.virol.2010.02.010 [DOI] [PubMed] [Google Scholar]
- 81.Mukherjee A, Morosky SA, Delorme-Axford E, Dybdahl-Sissoko N, Oberste MS, Wang T, Coyne CB. 2011. The coxsackievirus B 3C protease cleaves MAVS and TRIF to attenuate host type I interferon and apoptotic signaling. PLoS Pathog. 7:e1001311. 10.1371/journal.ppat.1001311 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 82.Riad A, Westermann D, Zietsch C, Savvatis K, Becher PM, Bereswill S, Heimesaat MM, Lettau O, Lassner D, Dorner A, Poller W, Busch M, Felix SB, Schultheiss HP, Tschope C. 2011. TRIF is a critical survival factor in viral cardiomyopathy. J. Immunol. 186:2561–2570. 10.4049/jimmunol.1002029 [DOI] [PubMed] [Google Scholar]
- 83.Fuse K, Chan G, Liu Y, Gudgeon P, Husain M, Chen M, Yeh WC, Akira S, Liu PP. 2005. Myeloid differentiation factor-88 plays a crucial role in the pathogenesis of coxsackievirus B3-induced myocarditis and influences type I interferon production. Circulation 112:2276–2285. 10.1161/CIRCULATIONAHA.105.536433 [DOI] [PubMed] [Google Scholar]
- 84.So EY, Kang MH, Kim BS. 2006. Induction of chemokine and cytokine genes in astrocytes following infection with Theiler's murine encephalomyelitis virus is mediated by the Toll-like receptor 3. Glia 53:858–867. 10.1002/glia.20346 [DOI] [PubMed] [Google Scholar]
- 85.van Boxel-Dezaire AH, Rani MR, Stark GR. 2006. Complex modulation of cell type-specific signaling in response to type I interferons. Immunity 25:361–372. 10.1016/j.immuni.2006.08.014 [DOI] [PubMed] [Google Scholar]
- 86.Stewart MJ, Smoak K, Blum MA, Sherry B. 2005. Basal and reovirus-induced β interferon (IFN-β) and IFN-β-stimulated gene expression are cell type specific in the cardiac protective response. J. Virol. 79:2979–2987. 10.1128/JVI.79.5.2979-2987.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 87.Zurney J, Howard KE, Sherry B. 2007. Basal expression levels of IFNAR and Jak-STAT components are determinants of cell-type-specific differences in cardiac antiviral responses. J. Virol. 81:13668–13680. 10.1128/JVI.01172-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 88.Cho H, Proll SC, Szretter KJ, Katze MG, Gale M, Jr, Diamond MS. 2013. Differential innate immune response programs in neuronal subtypes determine susceptibility to infection in the brain by positive-stranded RNA viruses. Nat. Med. 19:458–464. 10.1038/nm.3108 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 89.Li L, Sherry B. 2010. IFN-α expression and antiviral effects are subtype- and cell type-specific in the cardiac response to viral infection. Virology 396:59–68. 10.1016/j.virol.2009.10.013 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 90.Philip J, Xu Z, Bowles NE, Vallejo JG. 2013. Cardiac-specific overexpression of melanoma differentiation associated gene-5 protects mice from lethal viral myocarditis. Circ. Heart Fail. 6:326–334. 10.1161/CIRCHEARTFAILURE.112.969402 [DOI] [PubMed] [Google Scholar]
- 91.Xu Z, Desai M, Philip J, Sivsubramanian N, Bowles NE, Vallejo JG. 2011. Conditional transgenic expression of TIR-domain-containing adaptor-inducing interferon-β (TRIF) in the adult mouse heart is protective in acute viral myocarditis. Basic Res. Cardiol. 106:1159–1171. 10.1007/s00395-011-0226-4 [DOI] [PubMed] [Google Scholar]
- 92.Aicardi J, Goutieres F. 1984. A progressive familial encephalopathy in infancy with calcifications of the basal ganglia and chronic cerebrospinal fluid lymphocytosis. Ann. Neurol. 15:49–54. 10.1002/ana.410150109 [DOI] [PubMed] [Google Scholar]
- 93.Lebon P, Badoual J, Ponsot G, Goutieres F, Hemeury-Cukier F, Aicardi J. 1988. Intrathecal synthesis of interferon-α in infants with progressive familial encephalopathy. J. Neurol. Sci. 84:201–208. 10.1016/0022-510X(88)90125-6 [DOI] [PubMed] [Google Scholar]
- 94.Akwa Y, Hassett DE, Eloranta M-L, Sandberg K, Masliah E, Powell H, Whitton JL, Bloom FE, Campbell IL. 1998. Transgenic expression of interferon-α in the central nervous system of mice protects against lethal neurotropic viral infection but induces inflammation and neurodegeneration. J. Immunol. 161:5016–5026 [PubMed] [Google Scholar]
- 95.Crow YJ, Leitch A, Hayward BE, Garner A, Parmar R, Griffith E, Ali M, Semple C, Aicardi J, Babul-Hirji R, Baumann C, Baxter P, Bertini E, Chandler KE, Chitayat D, Cau D, Dery C, Fazzi E, Goizet C, King MD, Klepper J, Lacombe D, Lanzi G, Lyall H, Martinez-Frias ML, Mathieu M, McKeown C, Monier A, Oade Y, Quarrell OW, Rittey CD, Rogers RC, Sanchis A, Stephenson JB, Tacke U, Till M, Tolmie JL, Tomlin P, Voit T, Weschke B, Woods CG, Lebon P, Bonthron DT, Ponting CP, Jackson AP. 2006. Mutations in genes encoding ribonuclease H2 subunits cause Aicardi-Goutieres syndrome and mimic congenital viral brain infection. Nat. Genet. 38:910–916. 10.1038/ng1842 [DOI] [PubMed] [Google Scholar]
- 96.Crow YJ, Hayward BE, Parmar R, Robins P, Leitch A, Ali M, Black DN, van Bokhoven H, Brunner HG, Hamel BC, Corry PC, Cowan FM, Frints SG, Klepper J, Livingston JH, Lynch SA, Massey RF, Meritet JF, Michaud JL, Ponsot G, Voit T, Lebon P, Bonthron DT, Jackson AP, Barnes DE, Lindahl T. 2006. Mutations in the gene encoding the 3′-5′ DNA exonuclease TREX1 cause Aicardi-Goutieres syndrome at the AGS1 locus. Nat. Genet. 38:917–920. 10.1038/ng1845 [DOI] [PubMed] [Google Scholar]
- 97.Morita M, Stamp G, Robins P, Dulic A, Rosewell I, Hrivnak G, Daly G, Lindahl T, Barnes DE. 2004. Gene-targeted mice lacking the Trex1 (DNase III) 3′→5′ DNA exonuclease develop inflammatory myocarditis. Mol. Cell. Biol. 24:6719–6727. 10.1128/MCB.24.15.6719-6727.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 98.Gall A, Treuting P, Elkon KB, Loo YM, Gale M, Jr, Barber GN, Stetson DB. 2012. Autoimmunity initiates in nonhematopoietic cells and progresses via lymphocytes in an interferon-dependent autoimmune disease. Immunity 36:120–131. 10.1016/j.immuni.2011.11.018 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 99.Stetson DB, Ko JS, Heidmann T, Medzhitov R. 2008. Trex1 prevents cell-intrinsic initiation of autoimmunity. Cell 134:587–598. 10.1016/j.cell.2008.06.032 [DOI] [PMC free article] [PubMed] [Google Scholar]






