Abstract
Purpose
Intracytoplasmic sperm injection (ICSI) is widely used to achieve fertilization in the presence of severe male factor, resulting in high fertilization rates. Nevertheless, 1–3 % of couples experience complete fertilization failure after ICSI. When a male factor is identified, assisted oocyte activation (AOA) can help overcome fertilization failures. The objective of this study is to describe a case of repeated complete fertilization failures after ICSI with donor oocytes, and to investigate the molecular and functional aspects of phospholipase C zeta (PLCζ) protein in the patient semen.
Methods
The patient was a normozoospermic male who had previously fathered, through natural conception, four children by a different partner. Molecular and functional analysis of sperm-specific PLCζ in the patient and control samples by means of gene sequencing, immunocytochemistry, Western blot, mouse oocyte activation test (MOAT), and mouse oocyte calcium analysis (MOCA) were used.
Results
PLCζ expression levels and distribution were significantly disrupted, although MOAT and MOCA did not indicate a decrease in activation ability.
Conclusions
Normozoospermic males can have disrupted expression and distribution of PLCζ, and reduced activation ability after ICSI in human oocytes, despite their normal activation potential in functional testing using mouse oocytes. Discrepancy among molecular and functional data might exist, as mutations in the gene sequence may not be the only cause of alteration in PLCζ protein related to activation failures.
Electronic supplementary material
The online version of this article (doi:10.1007/s10815-015-0496-0) contains supplementary material, which is available to authorized users.
Keywords: ICSI, Normozoospermia, PLCζ, Assisted oocyte activation, Fertilization failure
Introduction
Following gamete fusion, oocytes are activated by an initial rise (trigger) and subsequent oscillations of intracellular calcium (Ca2+) [1]. Intracytoplasmic sperm injection (ICSI) is widely used to achieve fertilization in the presence of severe male factor, resulting in high fertilization rates. Nevertheless, 1–3 % of couples experience complete fertilization failure after ICSI [2], mostly caused by an activation failure [3–5]. Assisted oocyte activation (AOA) with a Ca2+ ionophore (A213187 or ionomycin), or strontium chloride (SrCl2), direct microinjection of calcium, or electrical stimuli, have been shown to overcome fertilization failure after ICSI [6]. Ca2+ ionophore is most widely used for AOA [7], whose most common indication is globozoospermia, with only seven cases of AOA reported with normozoospermic patients worldwide [8–13].
During natural fertilization, oocyte activation is driven by sperm-specific phospholipase C zeta (PLCζ) released by the spermatozoon when it fuses with the oolemma. In the oocyte, PLCζ hydrolyzes phosphatidylinositol 4,5-bisphosphate (PIP2) into inositol triphosphate (IP3) and diacylglycerol (DAG), eliciting a downstream response, which ultimately leads to the release in the cytoplasm of Ca2+ sequestered in the endoplasmic reticulum. A few functional tests are available in order to identify the cause of fertilization failure after ICSI, such as the injection of a spermatozoon in the oocyte of either mice (mouse oocyte activation test, MOAT) or cow (bovine oocyte activation test, BOAT) to check for pronuclei formation, or the tracking of Ca2+ oscillation elicited in mouse oocytes (mouse oocyte calcium analysis, MOCA). We present here a case of a normozoospermic man with recurrent complete fertilization failure after ICSI with oocytes from fertile donors, and a functional and genetic analysis of his sperm activation capacity.
Materials and methods
Patient characteristics
A 50-year-old man and his 45-year-old wife, of black and mulatto phenotype respectively, presented to the clinic reporting a voluntary pregnancy termination 12 years before and a gestational desire of several years. The man had previously fathered, through natural conception, four children (22, 18, 16 and 12 years old at the first medical visit) by a different partner. The woman presented with ovarian failure. Five unrelated semen samples were collected at different stages of the Assisted Reproductive Technique procedure, and were analyzed according to World Health Organization (WHO) recommendations [14]. Sperm count and motility were assessed by Sperm Class Analyzer ® (Microptic, Spain).
Donor stimulation
Donors underwent a Gonadotropin-releasing hormone (GnRH) antagonist stimulation protocol (Cetrotide® 0.25 mg, Merck Serono Europe Limited, U.K.) with either recombinant follicle-stimulating hormone FSH (GONAL-f®, Merck Serono Europe Limited, U.K.) or highly purified human menopausal gonadotropin HMG (Menopur®, Ferring S.A.U., Spain). Ovulation was triggered with 0.2 mg GnRH agonist (Decapeptyl® 0.2 mg, Ipsen Pharma S.A., Spain). Transdermal estradiol (Vivelledot®, France) was used for endometrial preparation of the recipient (two 75 μg patches/3 days plus 2 mg of estradiol valerate vaginally). From the day of the oocyte retrieval, 800 mg/day of micronized vaginal progesterone (Utrogestan®, Laboratorio Seid, Spain) were also provided. Oocyte donors were different in each of the 5 cycles performed, all with proven fertility.
AOA technique
AOA was performed according to Heindryckx et al. [12]. Briefly, Ca2+ is introduced into the oocyte at ICSI, followed by a double Ionomycin (10 μmol/l MP Biomedical, USA) treatment. The semen sample was prepared by swim up and 10 μl of washed spermatozoa were placed in the ICSI™ droplet. In three of the cycles, spermatozoa were selected by intracytoplasmic morphologically selected sperm injection (IMSI; Nikon Instruments). The ICSI pipette, with the selected spermatozoon, was moved to a drop containing 10 % PVP/0.1 mol/l CaCl2. The spermatozoon was aspirated into the injection needle together with the solution, and ICSI was performed. Injected oocytes were allowed to recover for 30 min and then incubated for 7 min in freshly prepared solution of Ionomycin. Oocytes were washed in culture medium (G1™ PLUS, Vitrolife) and incubated for 30 min. Finally, injected oocytes were exposed for a second time to the activation solution for 7 min and after thorough washing, and oocytes were incubated under 37 °C, 6%CO2, 5%O2 for embryo culture.
Genomic analysis of PLCζ
After thawing, sperm was washed and at least 3 × 106 spermatozoa were collected and centrifuged at 15.000 g for 2 min at room temperature. Genomic DNA (gDNA) was isolated with QIAMP DNA Blood Mini Kit (QIAGEN, Hilden, Germany) in accordance with the manufacturer instructions. Amplicons of PLCζ were amplified by polymerase chain reaction (PCR) with Phusion High-Fidelity DNA polymerase (NEB, Ipswich, MA, USA) and primer pairs previously described [15, 16] (Suppl. Table 1).
PCR fragments were purified with Gel Extraction Kit (QIAGEN) and the sequence was determined by using BigDye Terminator v3.1 at Sanger ABI 3730xl (GATC Biotechnologies AG, Germany), and analyzed with Chromas Software (Technelysium Ltd., Australia). BLAST analysis was performed against the published sequence of the genomic PLCζ locus (Homo sapiens 12 BAC RP11-361I14 (Roswell Park Cancer Institute Human BAC Library) complete sequence.
Expression and localization of PLCζ
Protein expression and localization of PLCζ were analyzed following previously described protocols [17]. At least 107 spermatozoa were centrifuged at 15.000 g for 2 min. The cell pellet was re-suspended in 100 μl of complete Laemmli Buffer [18] and lysed by three freeze/boil cycles (−20, 98 °C). Two different amounts of protein extract (50 and 100 μg) were applied to a 10 % sodium dodecyl sulphate polyacrylamide gel (SDS-PAGE); separated proteins were transferred onto PVDF membranes (Millipore, USA).
For immunoblotting, membranes were treated with 10 μg/ml of an anti-human-PLCζ antibody (pab0367P, Covalab, Villeurbanne, France) in blocking buffer and incubated at 4 °C overnight, followed by a secondary antibody (NA934, Amersham, USA) diluted at 1:10,000. An anti-tubulin antibody (T6199, Sigma, USA) was used to normalize the signal.
For immunofluorescence, we followed a previously reported protocol [17]. Briefly, at least 106 spermatozoa were washed and fixed in 4 % paraformaldehyde (PFA)/PBS (Sigma). Fixed sperm cells were incubated overnight at 4 °C with 25 μg/ml of anti-human-PLCζ antibody (pab0367-P, Covalab, France). Samples were subsequently incubated with 5 μg/ml of secondary antibody (Alexa Fluor 568 F [Ab’]2 fragment goat anti-rabbit IgG; Invitrogen, Paisley, UK). Slides were stained with 20 μg/ml FITC-PNA and 2 μg/ml Hoechst-33342 (Sigma) for 15 min at 37 °C in the dark. The localization of PLCζ in relation to acrosomal status and the position of the nucleus were determined by confocal laser scanning microscopy (DM 5000B Leica, Germany).
Mouse oocyte activation test (MOAT)
Seven to 10-week-old B6D2 F1 hybrid females were stimulated using 5–7.5 IU of Folligon® (Intervet, Boxmeer, The Netherlands) and ovulation was induced 46–48 h later by 5–7.5 IU of Chorulon® (Intervet, Boxmeer, The Netherlands). Mice were sacrificed 13–14 h after human chorionic gonadotropin hCG administration to collect MII oocytes. Protein-free potassium simplex optimized medium (KSOM) and HEPES-buffered KSOM (KSOM-HEPES) supplemented with 0.4 % bovine serum albumin (MP Biochemicals, Belgium) were used for culture and manipulation, respectively. Sperm was thawed at room temperature for 15 min. Gamete Buffer® (Cook Medical, USA) was added for washing and the sample was centrifuged at 1.800 g for 10 min. After preparation, mouse oocytes were injected by Piezo-driven ICSI [12], which when carried out resulted in four groups: (i) test sperm: injection of patients’ sperm, (ii) positive control (oocytes injected with sperm with proven activation potential), (iii) negative control—sham (oocytes injected with media only), and (iv) medium control (non-manipulated oocytes to exclude spontaneous activation). Activation rate is defined as the number of oocytes showing signs of activation 24 h after ICSI over the number of oocytes that survived injection.
Mouse oocyte calcium analysis (MOCA)
Before ICSI, oocytes were incubated with 7.5 mM fura-2 acetoxymethyl ester (fura-2 AM, Invitrogen, Belgium) for 20 min under standard culture conditions (37 °C, 6 % CO2, 5 % O2). Sperm cells were treated with Lysolecithin (0.02 %) before injection [19]. Intracytoplasmic calcium oscillations were read out via radiometric measurements applying FURA-2AM excitation ratio (lambda 340 and 380 nm). Imaging was performed over a period of 2 h starting within 10 min after ICSI. Only intact oocytes were included for diagnosis. Outcome was analysed according to Vanden Meerschaut [19] and scoring of the following parameters was performed: total number of oocytes showing oscillations, number of calcium peaks per oocyte within 2 h (frequency), relative amplitude (change in the fluorescence ratio divided by the baseline ratio (ΔR/R)). Calcium patterns were classified as score 0 (no calcium spikes), score + (1–2 spikes), score ++ (3–10 spikes) and score +++ (>10 spikes) within 2 h immediately subsequent to ICSI. The product of frequency and amplitude represents the summed relative amplitude of the calcium changes in 2 h (Suppl. Fig. 1).
Statistical analyses
Immunolocalization pattern quantification was statistically analyzed by Fisher’s test. A p-value lower than 0.05 was considered statistically significant.
Results
Semen characteristics and clinical parameters of ICSI cycles with and without AOA
The patient was normozoospermic in all five samples analyzed. Sperm characteristics are presented in Suppl. Table 2. During the first cycle, a frozen sample was used; in all subsequent cycles, fresh semen was employed (Table 1). Moreover, a summary of ICSI cycles, including donor characteristics, is presented in Suppl. Table 3.
Table 1.
Overview of ICSI cycles included in this study
| Cycle | Donor | MII | Semen | IMSI | AOA | ET day | embryos |
|---|---|---|---|---|---|---|---|
| 1 | A | Fresh | Frozen | No | No | na | na |
| 2 | B | Fresh | Fresh | No | No | na | na |
| 3 | C | Fresh | Fresh | Yes | Yes | 3 | 2 |
| 4 | D | Fresh/vitrified | Fresh | Yes | Yes | 2 | 2 |
| 5 | E | Fresh/vitrified | Fresh | Yes | Yes | 5 | 2 |
na not applicable
In the first ICSI cycle, there was total fertilization failure (0/5) of fresh MII donor oocytes inseminated using a frozen semen sample. Oocytes were examined for evidence of fertilization 16–18 h after ICSI. In the second ICSI cycle, 0/6 fresh MII donor oocytes were fertilized using a fresh semen sample. All oocytes in both cycles showed one polar body and no pronuclei. In the three subsequent cycles, we applied IMSI [20] combined with AOA using fresh semen (Table 1). In the third cycle, 7/8 fresh MII donor oocytes were fertilized, and five developing embryos were obtained; two embryos were transferred at Day 3 (one with nine cells of unequal size, <10 % fragmentation; and one with six cells of unequal size, 0 % fragmentation); one non-compacted embryo was vitrified at Day 4 (eight cells of equal size, 0 % fragmentation). No pregnancy was achieved in either the fresh transfer, or the following cryotransfer.
In the fourth cycle, a combination of fresh and vitrified/warmed oocytes from the same donor was used. A total of 15 oocytes (five fresh and ten vitrified) were injected using fresh sperm sample combined with IMSI/AOA. With vitrified/warmed oocytes, we located the MII spindle with polarized light microscopy (Oosight™ Imaging System-Researchs Intruments Inc.) to avoid damaging the metaphase plate with the injection needle. In this cycle, none of the five fresh oocytes were fertilized and 2/10 vitrified/warmed oocytes were fertilized. Embryos were observed 43 h post-insemination, and two embryos were transferred on Day 2 (both with five cells of unequal size, 10 % fragmentation); no pregnancy was achieved.
In the fifth cycle, a total of 12 oocytes (seven fresh and five vitrified/warmed) were inseminated by IMSI combined by AOA, also using fresh sperm sample. Seven oocytes were fertilized (4/7 and 3/5, respectively). Additionally, we opted to let the embryos develop to the blastocyst stage. Two blastocysts (4BA and 3BB) [21] were transferred on Day 5 and four embryos were vitrified (one blastocyst 3DB, two early blastocyts and one morula). A pregnancy was established with a positive beta hCG result 14 days after transfer and confirmed by ultrasonography at 12 weeks of pregnancy. A healthy girl was born by cesarean section at week 37 of pregnancy; the baby was 46 cm long and weighed 2.550 kg.
Gene sequence, expression and localization of PLCζ in the patient semen
Alterations in protein expression and/or functionality of PLCζ could be associated with the presence of polymorphisms in the PLCζ gene (SNP) [15, 16]. Thus, we focused on exons and intronic regions surrounding them. The sequencing of PCR products revealed three polymorphisms (Table 2). One of them, located at intron 1 (rs5796766), was also observed in samples with proven fertility [15], however, the additional SNPs variants have neither been detected in previous PLCζ reports nor associated with a disease (SNP database; http://www.ncbi.nlm.nih.gov/SNP/).
Table 2.
Overview of polymorphisms detected in this case report
| Genome coordinates | Position | 10 bp 5′ and 3′ | SNP | Alleles affected | Known SNP | 1000G MAF |
|---|---|---|---|---|---|---|
| 12:18738145 | Intron 1 | ATGTCTATCCATGAAAGCAGG | A/G | 2 | rs1075421 | G = 0.3751 |
| 12:18737539 | Intron 1 | AAGAACAGGCAAAAAAAACCA | A/- | 1 | rs5796766 | nd |
| 12:18694664 | Intron 13 | TTCTCCTCTCAAAGTTCTACT | A/G | 1 | rs11044253 | G = 0.3623 |
nd not determined
The amount of PLCζ protein in sperm was decreased in comparison with a normozoospermic sample of proven fertility (Fig. 1a and Suppl. Fig. 2). Immunohistochemistry analysis for PLCζ localization on sperm head was performed on sperm samples from four fertile men and the patient. Cell count was performed in four fertile men (cells analyzed: n = 247, 272, 274, and 282 respectively) and patient (n = 215) (Suppl. Table 4) showing an alteration of the localization of PLCζ across the spermatozoa heads from the patient when compared to fertile controls (Fig. 1b, c and d and Suppl. Fig. 3). Three different localizations were observed: acrosomal (A), equatorial (Eq) and midpiece (Mp) (Fig. 1d). The percentage of spermatozoa with a reacted acrosome was higher in the case vs controls (p = 0.0015). When an acrosome could be detected by PNA staining, predominant PLCζ distribution patterns were different in the patient vs. controls both acrosomally (A; 10.8 vs. 77.1 %, p < 0.0001) and midpiece (Mp; 75.4 vs. 12.2 %, p < 0.0001). Once the PNA signal in the acrosome is lost, differences in the localization of PLCζ among samples tends to disappear (Fig. 1, b and c)
Fig. 1.
Expression and localization of PLCζ protein: a Western immunoblotting for PLCζ (upper panel) and tubulin (lower panel). Relative intensity of PLCz to tubulin in fertile (white bar) and patient sperm (black bar) is presented; b PLCζ localization patterns in a representative fertile (white bar) vs patient (black bar) in spermatozoa presenting intact acrosome; c PLCζ localization patterns in a representative fertile (white bar) vs patient (black bar) in spermatozoa presenting reacted acrosome; % of acrosomal (A), equatorial (Eq) and midpiece (MP) signal are presented. * = p < 0.05; ** = p < 0.01 and *** = p < 0.0001. d immunolocalization of PLCζ in fertile (upper panels) and patient (lower panels) spermatozoa. Arrows indicate PLCζ localization: acrosomal (A), equatorial (Eq) and/or midpiece (MP). PLCζ (red), acrosome (FITC-PNA; green), and DNA (Hoechst33342; blue). Scale bars, 10 μm
Functional analysis of patient semen by [Ca2+]i oscillation induction in mouse oocytes
The MOAT revealed a normal activation capacity of the patients’ sperm compared to a positive control. Survival and activation rates were evaluated 24 h after ICSI and are shown in Table 3. A total of 24 dye-loaded MII mouse oocytes were injected for calcium analysis (MOCA), 17 of which were intact after imaging. Ten out of 17 oocytes (58.82 %) were scored as +++, 2 out 17 (11.76 %) as ++, 2 out of 17 (11.76 %) as + and 3 out 17 (17.65 %) as 0. The amplitude-frequency product result was 12.95, which is above the optimal-threshold of 9, for normal activation capacity of human sperm using mouse oocytes [13].
Table 3.
Results from the Mouse Oocyte Activation Test (MOAT). Activated oocytes: oocytes which cleave to two cells 24 h after injection. For sham injection or negative control the oocytes are injected without sperm. For media control the oocytes are left in culture media without further manipulation
| MOAT | Injected oocytes | Survived oocytes | Activated oocytes | Activation rate |
|---|---|---|---|---|
| Patient | 40 | 32 | 29 | 91 % |
| Control | 41 | 35 | 30 | 86 % |
| Sham | 20 | 6 | 0 | 0 |
| Media control | 10 | 10 | 0 | 0 |
Discussion
We report here a case of secondary infertility in a normozoospermic patient who fathered four children 2 decades ago, now presenting recurrent complete fertilization failures with oocytes from donors of proven fertility after ICSI. The patient ultimately conceived by AOA, and a healthy baby girl was born. One of the most agreed upon factors related to fertilization failure of male origin is PLCζ [22, 23]. PLCζ alterations can be due to gene mutations, altered protein expression or cellular localization, absence (globozoospermia), and functionality [16, 15, 17, 24]. The molecular analysis of PLCζ revealed significantly lowered amount and altered distribution of the protein, with no mutations detected. MOAT and MOCA analysis revealed overall normal [Ca2+]i response induction, although about 40 % of sperm did not elicit strong Ca2+ oscillations. Alteration in PLCζ abundance and distribution, even in the absence of morphological alteration in the sperm and mutations in the gene, can be related to failures to elicit [Ca2+]i oscillations in human oocytes.
ICSI failures in normozoospermia
Complete fertilization failure due to male factor has been mostly related to severe teratozoospermia, and specifically to globozoospermia [25, 26], while it is very rare in normozoospermia. There are seven cases reported of AOA after complete fertilization failure in normozoospermia [8–12, 19]; in some the cause was not clearly identified [8, 10], or was due to an oocyte factor [9]. Among those, six cases were treated using Ca2+ ionophore [8, 10, 19].
In a case report of a normozoospermic patient [10], most sperm heads that appeared normal under light microscopy, exhibited abnormal nuclear vacuolization when analyzed by transmission electron microscopy (TEM). For this reason, after two fertilization failures, we proposed IMSI to select sperms without vacuoles and with an intact acrosome. We did not find any evidence of alternations at 6000× magnifications; moreover, the proportion of spermatozoa with an intact acrosome was similar in both case and controls. Although TEM analysis would clarify further the presence of alterations in the sperm head, which in turn might affect the localization of PLCζ, it is unlikely that such alterations were present in our case.
ICSI failure and PLCζ presence/distribution
Two point mutations in the PLCζ gene have been described so far, located at exon 6 and 11, coding for active domains, both producing a non-functional, albeit full-length, protein [16], however, no mutations were detected in our patient. Another study reported single nucleotide polymorphisms (SNPs) in intronic regions that correlate with low fertilization rates even though the patient was normozoospermic [15]. We found three SNPs (rs1075421, rs5796766, and rs11044253), one previously described [15] in one man with normal fertilization rates and in two patients presenting activation failure after ICSI.
We found, however, a significantly lower expression of the PLCζ protein compared to fertile controls. This finding is consistent with a recent report where PLCζ was significantly reduced in patients with previous fertilization failures, even taking into account the variability in PLCζ levels among controls [24]. The source of lower expression of PLCζ remains to be established; altered transcription, translation, or turnover are all possible mechanisms, which so far have not been addressed. Together with its abundance, PLCζ localization can also be related to fertilization failures [17, 24]. In consistence with these reports, we found altered localization of PLCζ in the patient sperm. Specifically, a high proportion of spermatozoa presented midpiece PLCζ localization in acrosome-intact sperm in our patient, in contrast to controls.
We cannot exclude the presence and relevance for the phenotype observed of alteration in other candidate activation molecules, such as PAWP [27, 28], however, due to the limited amount of patient sample available for study, we elected to focus on PLCζ.
ICSI failure and MOAT/MOCA tests
The MOAT evaluates the capacity of human spermatozoa to activate mouse oocytes [29], and MOCA the specific pattern of [Ca2+]i oscillations, allowing for the categorization of spermatozoa in low, intermediate or high oocyte activation capability [12]; in our case, a normal activation capacity was found in MOAT and MOCA, which was probably due to the fact that human PLCζ has greater activation strength than mouse PLCζ, as recently reported [23].
A recent report compares three normozoospermic patients that failed ICSI with the partner’s oocytes [30]; 1/8, 2/10 and 0/24 of injected sperms for MOAT in the three men, respectively, were capable of initiating robust [Ca2+]i responses, another 3/8, 5/10, and 13/24 were able to initiate moderate to low [Ca2+]i responses, whereas 4/8, 3/10, and 11/24 of the sperm were unable to initiate [Ca2+]i responses. In our case, we found 10/17 robust [Ca2+]I, 4/17 medium-low [Ca2+]I and 3/17 absence of responses, which is lower than those produced in normozoospermic fertile samples.
Although there are differences in the degree of activation that is elicited by normozoospermic but infertile patients in both the cited work and our case, a common feature among the two sets of patients and controls is that normozoospermic infertile patients consistently show some degree of failure to activate mouse oocytes, whereas fertile patients invariably activate mouse oocytes [30]. This can be explained by the fact that human PLCζ has a greater activation capacity than mouse PLCζ, so that a diminished amount of functional protein, which are unable to elicit [Ca2+]i oscillations in a human oocyte, might still activate mouse oocytes. Consistently, we postulate that the MOAT/MOCA test is probably more suited to identifying structural alterations in human PLCζ such as protein truncation or point mutations affecting the protein activity, than to evaluating the ability of a small amount of active PLCζ to activate human oocytes.
Secondary activation failure
A puzzling aspect of our case is the fact that the patient fathered four children (12 to 22 years old) at the time of treatment, and that the anamnesis revealed no significant change in medical or environmental conditions. To the best of our knowledge, there have been no reports in the literature so far of an acquired, apparently idiopathic, activation failure in normozoospermia. Two alternative explanations for this finding could be hypothesized: on the one hand, this event could originate in the clonal expansion, in time, of a subset of spermatogonia and/or spermatogonia stem cells that have acquired alterations giving them a competitive advantage during spermatogenesis; although such alterations have so far been demonstrated in cases of point mutations in the human species [31, 32], other selective mechanisms cannot be excluded. On the other hand, a diminished amount or altered distribution of PLCζ could be the result of ageing, with an attending dysregulation of transcription, translation and/or turnover of the protein. The patient in the presented case was 50 at the time of fertilization failure; however, no such data on other cases is reported in the available literature. In our own facility, complete fertilization after ICSI with donor oocytes has occurred in 15 men in the last year, with an average age of 43.5 ± 6.5 years; however, it remains to be determined if this age is significantly related to the phenotype observed.
In conclusion, we identify changes in PLCζ presence and distribution, which are associated with, though not necessarily the cause of, severely diminished activation ability in normozoospermic sperm. We suggest that the presence and distribution of PLCζ should be investigated in cases of unexpected male-related fertilization failure in normozoospermia, and that MOAT/MOCA tests might be of limited diagnostic and prognostic value in cases of unaltered genetic sequence of the protein. Further work should be aimed at identifying other molecules involved in the activation trigger and cascade, in order to improve our understanding of oocyte activation, and develop clinically relevant diagnostic tests.
Electronic supplementary material
(DOCX 15 kb)
(DOCX 14 kb)
(DOCX 13 kb)
(DOCX 19 kb)
Representative patterns for the Ca2+ frequency scores (0, +, ++, +++). The frequency score is given by the number of calcium spikes recorded during 2 h post ICSI: a) +++ = >10; b) ++ = 3–10; c) + = 1–2; d) 0 = no spikes recorded (AU, arbitrary units). (GIF 15 kb)
Western Blot results from both blots. Immunoblotting was applied to determine protein expression of endogenous PLCζ (left panel), using tubulin as a loading control (right panel). The relative intensity of PLCζ bands (bar graph) were determined by densitometry referred to tubulin in fertile (white bar) and patient sperm (black bar). Different amounts of protein extracts, 50 (a) and 100 (b) μg, were applied and figures show the whole exposed blot. Arrows indicate bands for PLCζ (apparent MW of ≈70 kDa), * indicates unspecific bands. (GIF 158 kb)
Cellular localization of PLCζ protein in normozoospermic fertile human sperm. Representative image of PLCζ localization patterns by immunolocalization in fertile (a) and patient sperm (b). Squares represent corresponding upper (i) and lower (ii) panels in Fig. 1. Scale bars, 10 μm. (GIF 234 kb)
Acknowledgments
The authors wish to thank Dr. Anna Ferrer, Dr. Elena Rebollo and Sara Casadesús for technical support.
Compliance with ethical standards
ᅟ
Informed consent
Informed consent was obtained from the couple involved in the study in order to analyze the semen samples and to report the case.
Ethical approval
All procedures performed were in accordance with the ethical standards of the institutional research committees and with the 1964 Helsinki declaration and its subsequent amendments.
Financial support
Financial support for this study was provided in part by a fundamental clinical research mandate and a university grant.
Conflict of interest
The authors declare that they have no conflict of interest.
Funding
This study was funded in part by Fundació Privada EUGIN, a fundamental clinical research mandate from the FWO-Vlaanderen to PDS, and a Ghent University grant to BH.
Footnotes
Capsule Normozoospermic males can have disrupted expression and distribution of PLCζ, and reduced activation ability after ICSI in human oocytes, despite their normal activation potential in functional testing using mouse oocytes.
Mercè Durban and Montserrat Barragán contributed equally to this work.
References
- 1.Tesarik J, Sousa M. Mechanism of calcium oscillations in human oocytes: a two-store model. Mol Hum Reprod. 1996;2(6):383–6. doi: 10.1093/molehr/2.6.383. [DOI] [PubMed] [Google Scholar]
- 2.Mahutte NG, Arici A. Failed fertilization: is it predictable? Curr Opin Obstet Gynecol. 2003;15(3):211–8. doi: 10.1097/00001703-200306000-00001. [DOI] [PubMed] [Google Scholar]
- 3.Sousa M, Tesarik J. Ultrastructural analysis of fertilization failure after intracytoplasmic sperm injection. Hum Reprod. 1994;9(12):2374–80. doi: 10.1093/oxfordjournals.humrep.a138455. [DOI] [PubMed] [Google Scholar]
- 4.Tesarik J, Mendoza C. In vitro fertilization by intracytoplasmic sperm injection. Bioessays. 1999;21(9):791–801. doi: 10.1002/(SICI)1521-1878(199909)21:9<791::AID-BIES11>3.0.CO;2-Z. [DOI] [PubMed] [Google Scholar]
- 5.Rawe VY, Olmedo SB, Nodar FN, Doncel GD, Acosta AA, Vitullo AD. Cytoskeletal organization defects and abortive activation in human oocytes after IVF and ICSI failure. Mol Hum Reprod. 2000;6(6):510–6. doi: 10.1093/molehr/6.6.510. [DOI] [PubMed] [Google Scholar]
- 6.Nasr-Esfahani MH, Deemeh MR, Tavalaee M. Artificial oocyte activation and intracytoplasmic sperm injection. Fertil Steril. 2010;94(2):520–6. doi: 10.1016/j.fertnstert.2009.03.061. [DOI] [PubMed] [Google Scholar]
- 7.Vanden Meerschaut F, Nikiforaki D, Heindryckx B, De Sutter P. Assisted oocyte activation following ICSI fertilization failure. Reprod BioMed Online. 2014;28(5):560–71. doi: 10.1016/j.rbmo.2014.01.008. [DOI] [PubMed] [Google Scholar]
- 8.Eldar-Geva T, Brooks B, Margalioth EJ, Zylber-Haran E, Gal M, Silber SJ. Successful pregnancy and delivery after calcium ionophore oocyte activation in a normozoospermic patient with previous repeated failed fertilization after intracytoplasmic sperm injection. Fertil Steril. 2003;79(Suppl 3):1656–8. doi: 10.1016/S0015-0282(03)00369-8. [DOI] [PubMed] [Google Scholar]
- 9.Murase Y, Araki Y, Mizuno S, Kawaguchi C, Naito M, Yoshizawa M, et al. Pregnancy following chemical activation of oocytes in a couple with repeated failure of fertilization using ICSI: case report. Hum Reprod. 2004;19(7):1604–7. doi: 10.1093/humrep/deh294. [DOI] [PubMed] [Google Scholar]
- 10.Chi HJ, Koo JJ, Song SJ, Lee JY, Chang SS. Successful fertilization and pregnancy after intracytoplasmic sperm injection and oocyte activation with calcium ionophore in a normozoospermic patient with extremely low fertilization rates in intracytoplasmic sperm injection cycles. Fertil Steril. 2004;82(2):475–7. doi: 10.1016/j.fertnstert.2004.01.038. [DOI] [PubMed] [Google Scholar]
- 11.Chen J, Qian Y, Tan Y, Mima H. Successful pregnancy following oocyte activation by strontium in normozoospermic patients of unexplained infertility with fertilisation failures during previous intracytoplasmic sperm injection treatment. Reprod Fertil Dev. 2010;22(5):852–5. doi: 10.1071/RD09268. [DOI] [PubMed] [Google Scholar]
- 12.Heindryckx B, De Gheselle S, Gerris J, Dhont M, De Sutter P. Efficiency of assisted oocyte activation as a solution for failed intracytoplasmic sperm injection. Reprod BioMed Online. 2008;17(5):662–8. doi: 10.1016/S1472-6483(10)60313-6. [DOI] [PubMed] [Google Scholar]
- 13.Vanden Meerschaut F, Nikiforaki D, De Roo C, Lierman S, Qian C, Schmitt-John T, et al. Comparison of pre- and post-implantation development following the application of three artificial activating stimuli in a mouse model with round-headed sperm cells deficient for oocyte activation. Hum Reprod. 2013;28(5):1190–8. doi: 10.1093/humrep/det038. [DOI] [PubMed] [Google Scholar]
- 14.WHO. WHO laboratory manual for the examination and processing of human semen. 5th Edition, 2010. Chapter 5.6. Preparing HIV-infected semen samples “Prepared samples should be tested by RT-PCR befor use, and only HIV-free samples used for ART”. 2010.
- 15.Yoon SY, Jellerette T, Salicioni AM, Lee HC, Yoo MS, Coward K, et al. Human sperm devoid of PLC, zeta 1 fail to induce Ca(2+) release and are unable to initiate the first step of embryo development. J Clin Invest. 2008;118(11):3671–81. doi: 10.1172/JCI36942. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Heytens E, Parrington J, Coward K, Young C, Lambrecht S, Yoon SY, et al. Reduced amounts and abnormal forms of phospholipase C zeta (PLCzeta) in spermatozoa from infertile men. Hum Reprod. 2009;24(10):2417–28. doi: 10.1093/humrep/dep207. [DOI] [PubMed] [Google Scholar]
- 17.Grasa P, Coward K, Young C, Parrington J. The pattern of localization of the putative oocyte activation factor, phospholipase Czeta, in uncapacitated, capacitated, and ionophore-treated human spermatozoa. Hum Reprod. 2008;23(11):2513–22. doi: 10.1093/humrep/den280. [DOI] [PubMed] [Google Scholar]
- 18.Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 1970;227(5259):680–5. doi: 10.1038/227680a0. [DOI] [PubMed] [Google Scholar]
- 19.Vanden Meerschaut F, Leybaert L, Nikiforaki D, Qian C, Heindryckx B, De Sutter P. Diagnostic and prognostic value of calcium oscillatory pattern analysis for patients with ICSI fertilization failure. Hum Reprod. 2013;28(1):87–98. doi: 10.1093/humrep/des368. [DOI] [PubMed] [Google Scholar]
- 20.Berkovitz A, Eltes F, Yaari S, Katz N, Barr I, Fishman A, et al. The morphological normalcy of the sperm nucleus and pregnancy rate of intracytoplasmic injection with morphologically selected sperm. Hum Reprod. 2005;20(1):185–90. doi: 10.1093/humrep/deh545. [DOI] [PubMed] [Google Scholar]
- 21.Gardner DK, Schoolcraft WB. Culture and transfer of human blastocysts. Curr Opin Obstet Gynecol. 1999;11(3):307–11. doi: 10.1097/00001703-199906000-00013. [DOI] [PubMed] [Google Scholar]
- 22.Amdani SN, Jones C, Coward K. Phospholipase C zeta (PLCzeta): oocyte activation and clinical links to male factor infertility. Adv Biol Regul. 2013;53(3):292–308. doi: 10.1016/j.jbior.2013.07.005. [DOI] [PubMed] [Google Scholar]
- 23.Nomikos M, Yu Y, Elgmati K, Theodoridou M, Campbell K, Vassilakopoulou V, et al. Phospholipase Czeta rescues failed oocyte activation in a prototype of male factor infertility. Fertil Steril. 2013;99(1):76–85. doi: 10.1016/j.fertnstert.2012.08.035. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Kashir J, Jones C, Mounce G, Ramadan WM, Lemmon B, Heindryckx B, et al. Variance in total levels of phospholipase C zeta (PLC-zeta) in human sperm may limit the applicability of quantitative immunofluorescent analysis as a diagnostic indicator of oocyte activation capability. Fertil Steril. 2013;99(1):107–17. doi: 10.1016/j.fertnstert.2012.09.001. [DOI] [PubMed] [Google Scholar]
- 25.Dam AH, Feenstra I, Westphal JR, Ramos L, van Golde RJ, Kremer JA. Globozoospermia revisited. Hum Reprod Update. 2007;13(1):63–75. doi: 10.1093/humupd/dml047. [DOI] [PubMed] [Google Scholar]
- 26.Yanagida K. Complete fertilization failure in ICSI. Hum Cell. 2004;17(4):187–93. doi: 10.1111/j.1749-0774.2004.tb00042.x. [DOI] [PubMed] [Google Scholar]
- 27.Aarabi M, Balakier H, Bashar S, Moskovtsev SI, Sutovsky P, Librach CL, et al. Sperm-derived WW domain-binding protein, PAWP, elicits calcium oscillations and oocyte activation in humans and mice. FASEB J Off Publ Fed Am Soc Exp Biol. 2014;28(10):4434–40. doi: 10.1096/fj.14-256495. [DOI] [PubMed] [Google Scholar]
- 28.Aarabi M, Balakier H, Bashar S, Moskovtsev SI, Sutovsky P, Librach CL, et al. Sperm content of postacrosomal WW binding protein is related to fertilization outcomes in patients undergoing assisted reproductive technology. Fertil Steril. 2014;102(2):440–7. doi: 10.1016/j.fertnstert.2014.05.003. [DOI] [PubMed] [Google Scholar]
- 29.Rybouchkin A, Dozortsev D, de Sutter PD, Dhont M. Factors affecting the role of the spindle during early response of mouse oocytes to ethanol stimulation. J Exp Zool. 1996;275(6):469–75. doi: 10.1002/(SICI)1097-010X(19960815)275:6<469::AID-JEZ9>3.0.CO;2-M. [DOI] [PubMed] [Google Scholar]
- 30.Lee HC, Arny M, Grow D, Dumesic D, Fissore RA, Jellerette-Nolan T. Protein phospholipase C Zeta1 expression in patients with failed ICSI but with normal sperm parameters. J Assist Reprod Genet. 2014;31(6):749–56. doi: 10.1007/s10815-014-0229-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Giannoulatou E, McVean G, Taylor IB, McGowan SJ, Maher GJ, Iqbal Z, et al. Contributions of intrinsic mutation rate and selfish selection to levels of de novo HRAS mutations in the paternal germline. Proc Natl Acad Sci U S A. 2013;110(50):20152–7. doi: 10.1073/pnas.1311381110. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Maher GJ, Goriely A, Wilkie AO. Cellular evidence for selfish spermatogonial selection in aged human testes. Andrology. 2014;2(3):304–14. doi: 10.1111/j.2047-2927.2013.00175.x. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
(DOCX 15 kb)
(DOCX 14 kb)
(DOCX 13 kb)
(DOCX 19 kb)
Representative patterns for the Ca2+ frequency scores (0, +, ++, +++). The frequency score is given by the number of calcium spikes recorded during 2 h post ICSI: a) +++ = >10; b) ++ = 3–10; c) + = 1–2; d) 0 = no spikes recorded (AU, arbitrary units). (GIF 15 kb)
Western Blot results from both blots. Immunoblotting was applied to determine protein expression of endogenous PLCζ (left panel), using tubulin as a loading control (right panel). The relative intensity of PLCζ bands (bar graph) were determined by densitometry referred to tubulin in fertile (white bar) and patient sperm (black bar). Different amounts of protein extracts, 50 (a) and 100 (b) μg, were applied and figures show the whole exposed blot. Arrows indicate bands for PLCζ (apparent MW of ≈70 kDa), * indicates unspecific bands. (GIF 158 kb)
Cellular localization of PLCζ protein in normozoospermic fertile human sperm. Representative image of PLCζ localization patterns by immunolocalization in fertile (a) and patient sperm (b). Squares represent corresponding upper (i) and lower (ii) panels in Fig. 1. Scale bars, 10 μm. (GIF 234 kb)

