Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2016 Aug 1.
Published in final edited form as: Mol Microbiol. 2015 Jul 4;97(4):630–645. doi: 10.1111/mmi.13058

Repression by H-NS of genes required for the biosynthesis of the Vibrio cholerae biofilm matrix is modulated by the second messenger cyclic diguanylic acid

Julio C Ayala 1,2, Hongxia Wang 2,3, Anisia J Silva 2, Jorge A Benitez 2,*
PMCID: PMC4617317  NIHMSID: NIHMS727195  PMID: 25982817

Summary

Expression of Vibrio cholerae genes required for the biosynthesis of exopolysacchide (vps) and protein (rbm) components of the biofilm matrix is enhanced by cyclic diguanylate (c-di-GMP). In a previous study, we reported that the H-NS protein represses the transcription of vpsA, vpsL and vpsT. Here we demonstrate that the regulator VpsT can disrupt repressive H-NS nucleoprotein complexes at the vpsA and vpsL promoters in the presence of c-di-GMP while H-NS could disrupt the VpsT-promoter complexes in the absence of c-di-GMP. ChiP-Seq showed a remarkable trend for H-NS to cluster at loci involved in biofilm development such as the rbmABCDEF genes. We show that the antagonistic relationship between VpsT and H-NS regulates the expression of the rbmABCDEF cluster. Epistasis analysis demonstrated that VpsT functions as an antirepressor at the rbmA/F, vpsU and vpsA/L promoters. Deletion of vpsT increased H-NS occupancy at these promoters while increasing the c-di-GMP pool had the opposite effect and included the vpsT promoter. The negative effect of c-di-GMP on H-NS occupancy at the vpsT promoter required the regulator VpsR. These results demonstrate that c-di-GMP activates the transcription of genes required for the biosynthesis of the biofilm matrix by triggering a coordinated VpsR- and VpsT-dependent H-NS antirepression cascade.

Keywords: Vibrio cholerae, biofilm formation, H-NS, c-di-GMP

Introduction

Vibrio cholerae of serogroups O1 and O139 is the causative agent of the diarrheal disease cholera. A major obstacle to the eradication of cholera is the persistence of V. cholerae in the aquatic environment in the form of biofilm communities attached to chitinous surfaces (Pruzzo et al., 2008). These biofilms are more resistant to multiple environmental stresses and to inactivation by the human gastric acid barrier (Zhu & Mekalanos, 2003). Further, Vibrios can form biofilms during infection (Faruque et al., 2006) and these biofilms are in a stage of transient hyperinfectivity that can facilitate household transmission of cholera (Tamayo et al., 2010).

The development of a mature biofilm requires the biosynthesis of an extracellular matrix consisting of Vibrio exopolysaccharide (VPS) and proteins (Yildiz & Schoolnik, 1999, Absalon et al., 2011). The genes required for VPS biosynthesis are encoded by two operons located in chromosome I, in which vpsA and vpsL are the first genes of operons I and II, respectively (Fong et al., 2010, Yildiz & Schoolnik, 1999). A third gene cluster termed rbmABCDEF encodes protein components of the biofilm matrix and is located between vps operons I and II (Fong & Yildiz, 2007). Transcription of vps and rbm genes is controlled by a complex regulatory network involving quorum sensing (Yang et al., 2010, Rutherford et al., 2011, Jobling & Holmes, 1997, Yildiz et al., 2004) and the second messenger cyclic diguanylic acid (c-di-GMP) (Beyhan et al., 2006, Lim et al., 2007, Lim et al., 2006, Tischler & Camilli, 2004). Quorum sensing controls biofilm formation through two master regulators: AphA and HapR (Rutherford et al., 2011). At low cell density, AphA enhances the expression of the biofilm activator VpsT (Yang et al., 2010). At high cell density, HapR diminishes biofilm formation by lowering the intracellular c-di-GMP pool (Waters et al., 2008, Wang et al., 2011) and repressing the transcription of aphA and vpsT (Srivastava et al., 2011, Waters et al., 2008).

Cyclic-di-GMP is synthesized from GTP by diguanylate cyclases (DGC) containing GGDEF domains. Degradation of c-di-GMP involve phosphodiesterases (PDE) exhibiting EAL or HD-GYP domains (Dow, 2007). The two major regulatory proteins that sense intracellular c-di-GMP levels to promote biofilm formation are the NtrC-like activator VpsR (Yildiz et al., 2001) and the LuxR-type regulator VpsT (Casper-Lindley & Yildiz, 2004). VpsR binds c-di-GMP to activate the expression of aphA and vpsT (Srivastava et al., 2011). VpsT has been shown to bind to the vpsL promoter in the presence of c-di-GMP (Krasteva et al., 2010, Casper-Lindley & Yildiz, 2004). We recently showed that transcription of vpsA, vpsL and vpsT is repressed by the histone-like nucleoid structuring protein (H-NS) (Wang et al., 2012b).

H-NS is a highly abundant protein that functions as a nucleoid organizer and a transcriptional silencer at promoters exhibiting AT-rich and highly curved DNA (Lang et al., 2007). H-NS has been shown to preferentially silence the transcription of virulence factors acquired by horizontal gene transfer (Lucchini et al., 2006, Dorman, 2007). In E. coli, H-NS can be observed associated with the nucleoid in the form of compact clusters that could bring broad regions of the genome into proximity (Dorman, 2013). Progress in this field has led to the emerging view that transcription regulation and nucleoid organization are interrelated functions of H-NS in which regulation of gene expression drives nucleoid architecture (Dorman, 2013). Similar studies have not been conducted in V. cholerae, which distinct from E. coli and Salmonella, contains two circular chromosomes (Heidelberg et al., 2000). E. coli H-NS consists of an N-terminal domain, which promotes oligomerization through hydrophobic coil-coil interactions, connected by a flexible linker to a nucleic acid binding domain (Atlung & Ingmer, 1997). Both domains are required for the biological activities of H-NS (Spurio et al., 1997, Dame et al., 2001). The V. cholerae H-NS protein shares 69 % similarity and 55 % amino acid identity with the E. coli protein and represses gene expression as an oligomeric protein (Nye & Taylor, 2003). However, the presence of an additional oligomerization domain in V. cholerae H-NS suggests that the Vibrio protein uses a different mechanism to self-associate compared to E. coli H-NS (Nye & Taylor, 2003). Repression by H-NS can be relieved in response to environmental cues that activate the expression of other regulators whose binding site overlaps that of H-NS (Dorman & Kane, 2009, Stoebel et al., 2008). In V. cholerae, transcriptional silencing of the tcpA and ctxA promoters by H-NS (Nye et al., 2000) is antagonized by the AraC-like transcriptional regulator ToxT and the integration host factor (IHF) (Yu & DiRita, 2002, Stonehouse et al., 2008, Stonehouse et al., 2011).

A recent genetic analysis suggested a possible antagonistic relationship between H-NS and VpsT at the vpsL promoter (Zamorano-Sanchez et al., 2015). In this study, we determine the mechanism by which H-NS and VpsT concertedly control the transcription of genes involved in the biosynthesis of the biofilm exopolysaccharide and protein matrix. Our data shows that c-di-GMP activation of biofilm formation involves the coordinated antirepression from H-NS of multiple genes that participate in biofilm development. We propose a model in which vps and rbm genes are transcriptionally silenced by H-NS at low cell density and are expressed or reset to silent depending on environmental-induced fluctuations in the c-di-GMP pool.

Results

H-NS and VpsT bind to overlapping DNA sequences at the vpsA and vpsL promoters

The V. cholerae LuxR-type regulator VpsT enhances the expression of vps and rbm genes by directly sensing the intracellular level of c-di-GMP (Shikuma et al., 2012, Krasteva et al., 2010, Beyhan et al., 2006, Casper-Lindley & Yildiz, 2004, Fong & Yildiz, 2007). We hypothesized that VpsT could activate the transcription of both the vpsA-K and vpsL-Q operons by disrupting repressive H-NS nucleoprotein complexes formed at the corresponding promoters. To test this possibility, we determined the vpsA and vpsL transcription start sites (TSS) as well as the H-NS and VpsT binding sites (Fig. 1). The TSS for vpsA and vpsL were located 92 and 37 bp upstream of the vpsA and vpsL start codon, respectively (Fig. 1). These TSS were preceded by -10 and -35 regions separated by 18 and 16 bp spacers in the vpsA and vpsL promoters, respectively. DNase I footprinting showed that H-NS protected specific regions in both DNA strands of each promoter. In Fig. 1 we report the H-NS-protected sequences common to both DNA strands. We propose that these H-NS-protected regions could function as primary binding (nucleation) sites from which H-NS could oligomerize and spread along the vpsA and vpsL promoters. The DNase I protection analysis showed that H-NS occupies long stretches of DNA extending upstream and downstream the vpsA promoter elements, including the -35 and -10 positions (Fig. 1A). At the vpsL promoter H-NS protected a long DNA stretch starting at the -35 element and extending upstream the promoter (Fig. 1B). The VpsT binding pattern at the vpsA (Fig. 1A) and vpsL promoters (Fig. 1B) differed from H-NS by being more sequence-specific and exhibiting minimal differences in protection between DNA strands. The VpsT binding sites overlapped some of the H-NS primary binding sites at both promoters further suggesting a possible antagonistic relationship between these regulators for binding to DNA. The electropherograms supporting the results summarized in Fig. 1AB are shown in supporting information Fig. S1–S5.

Fig. 1. Architecture of the vpsA (A) and vpsL (B) promoters.

Fig. 1

Open in a new tab

The transcription start sites (TSS) of the vpsA and vpsL promoters were determined by primer extension as described in methods. Contact regions between H-NS and VpsT and each promoter were determined by DNase I footprinting. The H-NS contact regions are indicated by a red line above the sequence. The VpsT contact regions are indicated with a green line below the sequence. Promoter -35 and -10 elements, TSS and Shine-Dalgarno (SD) sequences are underlined. A 20 bp inverted repeat within VpsT-protected regions is shown in bold font. (C) VpsT binding motif generated by the MEME server application using VpsT protected regions as input sequences. The electropherograms corresponding to the results summarized in panels A and B are shown in supporting information Fig. S1–S5.

The vpsA and vpsL promoters exhibited a 20 bp inverted repeat sequence located within the VpsT-protected regions. We used the MEME application (multiple EM for motif elicitation) (Bailey & Elkan, 1994) to identify the VpsT binding motif. The resulting motif consisted of a sequence A[AT][AG]TAAACT[AT][AT]AGTTTA[TC][TA]T (Fig. 1C). We confirmed that VpsT binds in vitro to DNA fragments of the vpsA (−183 to −139) and vpsL (−262 to −208) promoters containing the VpsT motif. Binding was abolished when the inverted repeats were truncated (vpsA −160 to −98) or missing (vpsL −187 to −128) (Fig. S6).

VpsT can disrupt H-NS-DNA nucleoprotein complexes formed at the vpsA and vpsL promoters

We conducted competitive electrophoresis mobility shift assays (EMSA) to study the interaction between H-NS and VpsT at the vpsA and vpsL promoters. We incubated PCR fragments containing the overlapping H-NS and VpsT binding sites at the vpsA (Fig. 2A) and vpsL (Fig. 2B) promoters with H-NS protein for 15 min to allow the formation of the initial H-NS-DNA nucleoprotein complex (Fig. 2 A and B, lanes c and k). Then, we added increasing amounts of VpsT protein (Fig. 2 A and B lanes d through h) or VpsT plus c-di-GMP (Fig. 2A lanes l through m; Fig. 2B lanes l through o) and visualized the resulting protein-DNA complexes by polyacrylamide gel electrophoresis. These experiments showed that VpsT can disrupt the H-NS-DNA nucleoprotein complexes formed at the vpsA and vpsL promoters in a dose-dependent manner (Fig. 2AB). Further, a lower concentration of VpsT was required to displace H-NS from both promoters in the presence of c-di-GMP (see Fig. 2A lane l and Fig. 2B lane n). We further show that H-NS could displace VpsT from both promoters in the absence of c-di-GMP (Fig. 2C lanes f and l).

Fig. 2. Disruption of H-NS and VpsT nucleoprotein complexes.

Fig. 2

Open in a new tab

Competitive EMSA were conducted using DIG-labeled DNA fragments containing H-NS and VpsT DNase I protected regions at the vpsA (−223 to −139) (A) and vpsL (−262 to −185) (B) promoters. DNA fragments were pre-incubated with H-NS for 15 min (lanes c and k) and subsequently treated with increasing concentrations of VpsT or VpsT plus 50 μM c-di-GMP for an additional 15 min. The mobility of free DNA (lanes a and i) and each nucleoprotein complex are indicated at the right of each gel. The aberrant V-shaped band is due to dissociation of c-di-GMP from VpsT and release of a faster migrating free DNA from the VpsT nucleoprotein complex during electrophoresis. In panel C, the vpsA (lanes a–f) and vpsL (lane g–l) promoter fragments were pre-incubated with VpsT for 15 min (lanes c and i) and subsequently treated with increasing concentrations of H-NS.

The finding that VpsT can effectively disrupt the interaction between the highly abundant H-NS protein and the vpsA and vpsL promoters predicted that this regulator should bind the above promoters with higher affinities compared to H-NS when c-di-GMP is present. We used the ImageQuant software and densitometry to measure VpsT and H-NS binding affinities for the vpsA and vpsL promoters and adjusted the experimental points to the Hill equation (Hill, 1910) by nonlinear regression. In the absence of c-di-GMP, H-NS and VpsT exhibited similar affinities for the vpsA and vpsL promoters (Fig. 3). In the presence of c-di-GMP, VpsT exhibited a higher affinity for the vpsA promoter (Kd = 42.6 ± 1.3 nM) compared to that of H-NS (Kd = 137.8 ± 17.0 nM) (Fig. 3). Similarly, in the presence of c-di-GMP, VpsT exhibited higher affinity for the vpsL promoter (35.4 ± 0.4 nM) compared to H-NS (Kd = 204.0 ± 9.0 nM) (Fig. 3). We note that the VpsT-DNA complexes exhibited an aberrant V-shape migration pattern in the presence of c-di-GMP (see Fig. 2A and B lanes j). We investigated this phenomenon by conducting binding assays of VpsT to the vpsA promoter in the presence of decreasing concentrations of c-di-GMP. The result of this analysis showed that the aberrant migration pattern is caused by dissociation of c-di-GMP from VpsT during electrophoresis resulting in the release of free and faster migrating DNA (Fig. S7).

Fig. 3. Comparison of H-NS and VpsT binding affinities to the vpsA (A) and vpsL (B) promoters.

Fig. 3

Open in a new tab

Dissociation constants were determined by EMSA and densitometry as described in methods. The promoter fragments used were as indicated in Fig. 2. When indicated, c-di-GMP was added at concentration of 50 μM.

H-NS silences the transcription of multiple genes involved in biofilm development

We conducted a ChIP-Seq experiment to investigate the role of H-NS in the expression of additional genes affecting biofilm development. Fig. 4A shows the H-NS binding and transcriptome profiles for the V. cholerae large and small chromosomes. The transcriptome data was retrieved from RNA-Seq data generated using the same strains and growth conditions (Wang et al., 2015) (GEO accession number GSE62785). The ChIP-Seq analysis showed that H-NS associates with 6.3 % of the genome in clusters with medians of ≈ 2.7 and 2.1 kb in chromosomes I and II, respectively. The complete ChiP-Seq peak dataset and statistics is provided as supporting information in Table S1 and Fig. S8. We found H-NS to predominantly associate with clusters of functionally-related genes and operons. Examples of gene clusters occupied by H-NS are the 41.2 kb Vibrio pathogenicity island (VPI) (Karaolis et al., 1998); the vps and rbm clusters; the cluster encoding LPS biosynthetic enzymes and O-antigen assembly in chromosome I; the mega-integron located on chromosome II, (Mazel et al., 1998), and the vas (virulence-associated secretion) operon (Mueller et al., 2009) (Table S3). We used sequences within H-NS ChIP-Seq peaks as input for motif elicitation with the MEME algorithm. The resulting V. cholerae H-NS binding motif is shown in Fig. 4B.

Fig. 4. Genome-wide H-NS binding and transcriptome profiles during mid-exponential growth phase.

Fig. 4

Open in a new tab

(A) Schematic diagram of V. cholerae chromosome I and II showing the H-NS binding regions determined by ChIP-Seq and H-NS-regulated genes determined by RNA-Seq (GEO accession numbers GSE64249 and GSE62785 respectively). V. cholerae cells were grown in LB medium at 37°C and collected at OD600 0.5 for the ChIP-Seq and RNA-Seq as described in methods. The numbering indicated within the inner circle in both chromosomes represents the positions in kb pairs. (B) V. cholerae H-NS motif. (C) H-NS binding profile and transcription regulation at the vps and rbm loci. BAM files containing the sequence reads for the Wt and Δhns cells transcriptome and the H-NS ChIP-Seq binding profiles were aligned to the reference genome and visualized using IGV software (Thorvaldsdottir et al., 2013). Numbers in parenthesis indicate the maximum read count in the (Y) axis. The complete ChiP-Seq dataset and statistics is provided in supporting information Table S1 and Fig. S8.

ChiP-Seq and RNA-Seq analyses revealed new loci transcriptionally silenced by H-NS that coordinate biofilm development in V. cholerae. These loci include vpsU, encoding a phosphotyrosine protein phosphatase required for VPS production (Fong et al., 2010); the rbm genes (Fig. 4C) encoding proteins present in the extracellular matrix (Fong & Yildiz, 2007); hlyA (hemolysin), a component of the biofilm protein matrix (Absalon et al., 2011); the chitin utilization program (chitoporin ChiP, extracellular chitinase VC1073, the cellobiose PTS transporter CelAB, the chitin-regulated pilus ChiRP) (Meibom et al., 2004)), and the tryptophanase operon (tna) (Mueller et al., 2009) (Table S1 and Fig. 4C).

We examined if VpsT could antagonize H-NS transcriptional silencing at loci affecting biofilm development other than vpsA and vpsL. To this end, we used the FIMO application (Find Individual Motif Occurrences) (Grant et al., 2011) to identify genes exhibiting overlapping VpsT and H-NS motifs. A compilation of genes exhibiting H-NS motif is provided in supportive information Table S2. A list of genes exhibiting overlapping motifs is shown in Table 1. These genes included vpsU (Fong et al., 2010); rbmA, encoding a matrix protein proposed to participate in early cell-to-cell contact (Giglio et al., 2013, Absalon et al., 2011, Fong & Yildiz, 2007, Berk et al., 2012); rbmF, a gene transcribed divergently from vpsL encoding an hypothetical protein, and hlyA (hemolysin).We selected rbmA and vpsU to validate the occurrence of the predicted H-NS and VpsT binding sites. To this end, we amplified fragments of the rbmA and vpsU promoters containing the overlapping H-NS and VpsT motifs by PCR and conducted an EMSA to confirm that both regulators bind to these promoters (Fig. 5). Binding of VpsT to the vpsU and rbmA was enhanced in the presence of c-di-GMP (see Fig. 5CD, lanes c-d).

Table 1.

Genes repressed by H-NS showing overlapping VpsT and H-NS motifs

Gene Function VpsT motif H-NS motif H-NS Log2 Enrichment
VC0176 Transcription regulator AAATTAACTAAGATTTTCTT AAAGGTAAAC 17.40
VC0177 Hypothetical protein AAATTAACTAAGATTTTCTT AACAATAAAC 17.40
VC0490 Conserved hypothetical protein TAATTAAGTTGACTTTATTT AAACATAAAC 18.79
vpsU VPS biosynthesis AAATGAAAGTAGTTTTATTT ATAAATAAAA 17.27
vpsA-K Exopolysaccharide biosynthesis AAATAAACTAAAGTTTATAT GAAAATAAAC 17.27
rbmA Biofilm matrix protein AAATAAACTTTGGTTTATTT AAAAATAAAC 19.14
rbmF-D Hypothetical proteins AAATAAACTTTAGTTTACTT AAAAGTAAAA 18.07
vpsL-Q Exopolysaccharide export AAGTAAACTAAAGTTTATTT GAAAATAAAC 18.07
VC1329 Opacity-related protein TAAATACCTAAAGGTTATTT AAAAATAACC 17.13
VC1448 RTX toxin transporter CATTAAATTAGAGTATATAT AAAAATAAAA 18.05
VC1449 Hypothetical protein CATTAAATTAGAGTATATAT AAAGAGAAAA 18.05
ankB Ankyrin-like protein detoxification ATTTAAACGAAAGTTTTAGA GAGAATGAAG 16.94
katB Hydrogen peroxide- inducible catalase ATTTAAACGAAAGTTTTAGA GAGAATGAAG 16.94
VC1947 LysR-type transcription regulator AAAAAATCGTTTGGTTATAT GAAAATAGAA 17.77
VCA0201 hypothetical protein ACGGAAACTATAGTTTTCAT CAAGTTAAAA 19.99
VCA0218 Thermolabile hemolysin AACTAGACTTGATCTTACTT AAAAATAACA 18.08
hlyA Hemolysin AACTAGACTTGATCTTACTT AAAAATAACA 18.08
VCA0363 Hypothetical protein TTATAAACTTAAGGCTTTCT AAAAATAAGT 17.34
VCA0448 Hypothetical protein CAATACTCTTGATTTTACTT AAAAATAAAG 15.16
VCA0451 Hypothetical protein ATATTAAATACATTTTATTT ATAAATAAAA 17.78
VCA0691 Acetoacetyl-CoA reductase AAATTCAGTTTTGTGTATTT AAAAATACAC 17.13
dsdC D-serine deaminase activator ATATTATCCTTAGTGTACAT AAAGCTGAAA 17.24
VCA0965 DGC GGDEF family protein AAGTTAGCTAAAGTTTAGAT AAAAATAACG 14.98
VCA1065 Conserved hypothetical protein ATATATATTTTAGATTTATT AAATCTAAAA 18.09
Open in a new tab

Fig. 5. Binding of H-NS and VpsT to the rbmA and vpsU promoters.

Fig. 5

Open in a new tab

DIG-labeled DNA fragments spanning nucleotides −237 to −98 of the rbmA promoter (A and C) or nucleotides -199 to −51 of the vpsU promoter (B and D) with reference to the start codons were incubated with increasing concentrations of purified H-NS (panels A and B) or VpsT plus c-di-GMP (panels C and D).

Effect of VpsT and c-di-GMP on H-NS occupancy at vps and rbm promoters in the cell

The above results indicated that H-NS coordinately silences multiple genes involved in biofilm development and that VpsT could antagonize H-NS repression at these loci. We conducted a ChIP assay to examine the role of VpsT in H-NS occupancy at the vps and rbm promoters in the cell. To this end, a vpsT deletion was introduced in strain C7258 H-NS-FLAG and the resulting mutant was transformed with a vector encoding an IPTG-inducible vpsT allele (pVpsT). As shown in Fig. 6A, deletion of vpsT resulted in higher H-NS promoter occupancy at the rbmA, vpsU, vpsA, vpsL/rbmF promoters compared to the wild type background. This effect could be complemented in trans by plasmid pVpsT upon induction of VpsT expression with IPTG (Fig. 6A). We note that, although VpsT has been reported to activate its own transcription (Srivastava et al., 2011, Beyhan et al., 2007), the vpsT mutant did not exhibit enhanced H-NS occupancy at its promoter (Fig. 6A). Deletion of vpsT had no effect on H-NS occupancy at the tcpA promoter that lacks a VpsT binding motif. Western blot analysis revealed that expression of H-NS-FLAG was not affected in the different genetic backgrounds tested (data not shown). These results indicate that the VpsT protein could directly antagonizes H-NS occupancy at the vps and rbm promoters under physiological conditions.

Fig. 6.

Fig. 6

Open in a new tab

(A) Effect of VpsT on H-NS occupancy at vps and rbm promoters. ChIP analysis of H- NS occupancy at vps and rbm promoters in V. cholerae C7258/H-NS-FLAG (Wt) and the isogenic ΔvpsT mutant JCA2 containing pTTQ18cm (empty vector) or plasmid pVpsT encoding vpsT expressed from the IPTG-inducible tac promoter. Strains were grown in LB cultures and cells were collected at OD600 0.4. The tcpA and VC1922 promoters were used as positive and negative controls for H-NS binding, respectively. (B) Effect of increasing the intracellular c-di-GMP pool on H-NS occupancy at vps and rbm promoters. ChIP analysis of H-NS occupancy at the indicated promoters in V. cholerae C7258/H-NS-FLAG (Wt) containing the V. harveyi DGC QrgB or the active site mutant QrgB* expressed from the IPTG-inducible tac promoter. Cells were grown in LB medium to mid-exponential phase (OD600 0.5) with or without IPTG induction. Data are represented as the mean (bars) plus the standard error of the mean (SEM) (error bars). Statistical differences between Wt and mutants or between IPTG-induced and uninduced cultures (* at p<0.01) were determined by an ANOVA test and a Tukey’s Multiple Comparison Posttest (n=4).

Since c-di-GMP enhanced the capacity of VpsT to displace H-NS from the vpsA and vpsL promoters in vitro (Fig. 2), we predicted that H-NS occupancy at the promoters tested in Fig. 6A should diminish under conditions in which the c-di-GMP pool is elevated. To test this prediction, we transformed strain C7258 H-NS-FLAG with vectors pCMW75 encoding V. harveyi diguanylate cyclase QrgB under the control of the tac promoter or pCMW98 encoding a catalytic inactive QrgB protein (QrgB*) as a control (Waters et al., 2008). As expected, the reporter strain expressing the active QrgB enzyme exhibited reduced swarming motility and elevated biofilm when treated with IPTG while no effect could be detected in the strain expressing QrgB* (data not shown). As shown in Fig. 6B, induction of QrgB expression resulted in a significant decrease in H-NS occupancy at the rbmA, vpsU, vpsA, vpsL/rbmF, and vpsT promoters while over expression of the inactive QrgB* protein had no effect. As above, manipulation of the c-di-GMP pool did not affect H-NS occupancy at the tcpA promoter. Western blot analysis of H-NS-FLAG expression showed that manipulation of the c-di-GMP pool did not affect H-NS levels (data not shown).

The above data demonstrated the occurrence of an antagonistic relationship between VpsT and H-NS occupancy at the vps and rbm promoters. The data, however, does not exclude VpsT having additional regulatory functions at these promoters. To determine if VpsT acts at the rbmA, vpsU, vpsA, vpsL and rbmF promoters solely as an antirepressor, we conducted an epistasis analysis. In Table 2 we show that VpsT was not required for the expression of the above promoters in the absence of H-NS.

Table 2.

Epistasis analysis of the expression of vps and rbm genes in Δhns and ΔvpsT mutants.

Relative mRNA abundance*
Strain rbmA vpsU vpsA vpsL rbmF
Wt 0.186 ± 0.087 0.179 ± 0.046 0.085 ± 0.023 0.020 ± 0.013 0.009 ± 0.003
ΔvpsT 0.114 ± 0.024 0.086 ± 0.030 0.037 ± 0.015 0.007 ± 0.004 0.006 ± 0.003
Δhns 2.467 ± 0.120 2.295 ± 0.195 1.480 ± 0.232 0.865 ± 0.041 0.500 ± 0.044
ΔhnsΔvpsT 2.608 ± 0.382 2.787 ± 0.143 1.724 ± 0.294 0.959 ± 0.077 0.484 ± 0.033
Open in a new tab
*

mRNA abundance was determined by qRT-PCR. The data is presented as the mean of three independent experiments ± standard deviation.

VpsR is required for c-di-GMP to diminish H-NS occupancy at the vpsT promoter

The fact that increasing the c-di-GMP pool also diminished H-NS occupancy at the vpsT promoter suggested that another protein capable of sensing c-di-GMP could antagonize H-NS repression of vpsT transcription. The transcription factors AphA and VpsR have been shown to bind to the vpsT promoter and activate its transcription (Yang et al., 2010, Srivastava et al., 2011). Of these factors, VpsR has been shown to bind c-di-GMP (Srivastava et al., 2011). To determine whether any of these transcription factors could antagonize the transcriptional silencing of vpsT by H-NS, we constructed ΔaphA, ΔvpsR and ΔvpsT mutants expressing H-NS-FLAG and conducted ChIP. Consistent with Fig. 6A, deletion of vpsT did not alter H-NS occupancy at its own promoter (Fig. 7A). In contrast, deletion of vpsR and aphA resulted in a significant increase in H-NS occupancy at the vpsT promoter (Fig. 7A). This result suggests that both VpsR and AphA could antagonize H-NS binding to the vpsT promoter when the c-di-GMP pool is elevated. Western blot analysis showed that deletion of vpsR, vpsT, or aphA did not affect the level of H-NS-FLAG expression (data not shown). To determine the signaling pathway responsible for the negative effect of c-di-GMP on H-NS occupancy at the vpsT promoter, we artificially increased the c-di-GMP pool in ΔvpsR and ΔaphA genetic backgrounds. As shown in Fig. 7B, though AphA could contribute to lessen the amount of H-NS associated to DNA sequences upstream vpsT (Fig. 7C), the effect of c-di-GMP on H-NS occupancy required the regulator VpsR. The location of the VpsR motif (Zamorano-Sanchez et al., 2015) at this promoter relative to H-NS motifs is shown in Fig. 7D.

Fig. 7. Effect of VpsR and AphA on H-NS occupancy at the vpsT promoter.

Fig. 7

Open in a new tab

(A) ChIP analysis of H-NS occupancy at the vpsT promoter in V. cholerae C7258 H-NS-FLAG (Wt) and isogenic ΔvpsT (JCA2), ΔvpsR (JCA3) and ΔaphA (JCA4) mutants expressing hns-flag. Cells were grown in LB medium to OD600 0.3. (B) Effect of artificially increasing the c-di-GMP pool by overexpression of DGC QrgB on H-NS occupancy of the vpsT promoter in mutants lacking VpsR or AphA. (C) H-NS occupancy upstream vpsT and transcriptome assay as determined by ChIP-Seq and RNA-Seq. (D) Sequence of vpsT promoter. The H-NS motifs present in the coding strand are underlined; H-NS motifs in the template strand are indicated by a line above the sequence; the VpsR binding motif (Zamorano-Sanchez et al., 2015) is boxed; * indicates the TSS (+1 base) (Srivastava et al., 2011); the Shine-Dalgarno sequence and start codon are shown in bold font. ChIP data are represented as the mean plus the SEM. Statistical differences from the Wt (* at p<0.01) or between IPTG-induced and uninduced cultures (* at p<0.05) were determined by an ANOVA test and a Tukey’s Multiple Comparison Posttest (n=3).

Discussion

In V. cholerae, VpsT and VpsT-activated genes are expressed at low cell density and repressed at high cell density by quorum sensing. This knowledge, however, does not explain how c-di-GMP regulates the transition between alternative lifestyles at low cell density. We previously showed that H-NS directly represses the transcription of exopolysaccharide biosynthetic genes vpsA, vpsL and vpsT at low cell density (Wang et al., 2012b). The present study supports the notion that vps and rbm genes are transcriptionally silenced by H-NS and are expressed as a result of environmentally-induced fluctuations in the c-di-GMP pool that activate VpsR and VpsT to trigger a coordinated and multilocus antirepression cascade. Analysis of the vpsA and vpsL promoters provided a mechanism for H-NS repression and antirepression. The H-NS binding profile at the vpsL promoter indicated that H-NS could hinder the access of RNA polymerase to promoter elements required for transcription initiation as previously observed in other genes (Schlax et al., 1995, Hawley et al., 1985). The H-NS binding pattern identified for the vpsA promoter resembled the one observed in promoters that are repressed through a DNA looping mechanism where H-NS associates with regions extending upstream and downstream from the promoter elements to trap RNA polymerase inside the promoter (Schroder & Wagner, 2000, Dame et al., 2002).

We demonstrate that the c-di-GMP-binding protein VpsT binds to a 20 bp inverted repeat motif at the vpsA and vpsL promoters at positions that overlap H-NS binding sites. The 20 bp VpsT binding site identified in this study was identical to a recently reported 22 bp VpsT motif except for its first and last nucleotides (Zamorano-Sanchez et al., 2015). A competitive EMSA showed that VpsT can efficiently disrupt the H-NS-DNA repressive nucleoprotein complexes formed at the vpsA and vpsL promoters in vitro in the presence of c-di-GMP. Accordingly, VpsT bound to the vpsA and vpsL promoters with higher affinity compared to H-NS in the presence of c-di-GMP. Conversely, in the absence of c-di-GMP VpsT bound these promoters with lower affinity and H-NS could disrupt the VpsT-DNA complexes to potentially reset transcription of vpsA and vpsL back to silent.

We used ChIP-Seq to determine if the antagonistic effect between H-NS and VpsT could regulate the expression of other genes involved in biofilm development in addition to vpsA-K and vpsL-Q. ChiP-Seq identified additional loci repressed by H-NS affecting biofilm development such as vpsU and the rbmBCDEF cluster. The V. cholerae H-NS motif identified through ChIP-Seq was found to be structurally similar to the one previously reported in E. coli (Lang et al., 2007). The similarity in both H-NS binding motifs is consistent with the H-NS C-terminal DNA binding domains of V. cholerae and E. coli K-12 exhibiting 71% of sequence identity. Having identified the VpsT and H-NS binding motifs, we examined if the antagonistic relationship between these regulators at the vpsA and vpsL promoters could occur at other loci. We identified 22 loci that contained overlapping H-NS and VpsT binding motifs. Among these loci, we identified vpsU, rbmA and rbmF. This finding indicates that H-NS and VpsT coordinately regulate the expression of both the exopolysaccharide and protein components of the biofilm matrix.

In the cell, binding of H-NS to DNA could be affected by the presence of proteins other than VpsT and by changes in DNA topology (Stoebel et al., 2008). Thus, we used ChIP to examine the interplay between VpsT and H-NS occupancy under physiological conditions. Although the ChIP assay is less precise with regard to the DNA sequence bound to H-NS, deletion of VpsT increased H-NS occupancy at all vps and rbm promoters examined except vpsT.

We conducted an epistasis analysis to determine if VpsT functions at these promoter solely as an antirepressor or has an additional activating function as recently suggested for the vpsL promoter (Zamorano-Sanchez et al., 2015). Our data showed that VpsT acts solely as an antirepressor. Several features, in addition to strains differences, could explain the slightly distinct results between our study and (Zamorano-Sanchez et al., 2015). We measured vps expression at low cell density based on the knowledge that expression of HapR at high cell density acts to terminate vpsT transcription (Waters et al., 2008). In the preceding study, expression of vpsL was determined in stationary phase (Zamorano-Sanchez et al., 2015). Further, we directly measured the amount of mRNA transcribed from each chromosomal loci while the previous report used a vpsL-luxCDABE promoter fusion on a plasmid (Zamorano-Sanchez et al., 2015).

Artificially increasing the c-di-GMP pool diminished H-NS occupancy at the vpsT promoter. We note that the vpsT promoter is responsive to c-di-GMP and this effect requires the biofilm activator VpsR (Srivastava et al., 2011). A second activator, the PadR-like regulator AphA, also activates the vpsT promoter (Yang et al., 2010). We found that deletion of vpsR or aphA increased H-NS occupancy at the vpsT promoter. Analysis of the effect of artificially increasing the c-di-GMP pool in ΔaphA and ΔvpsR mutants showed that c-di-GMP acts through VpsR to lessen H-NS occupancy at the vpsT promoter. An H-NS binding was site identified by ChiP-Seq located 151 bp upstream the vpsT TSS (Srivastava et al., 2011) and 16 bp upstream from the VpsR binding site (Zamorano-Sanchez et al., 2015). H-NS could spread by oligomerization from this site to contact the polymerase and repress transcription similar to the E. coli LEE5 promoter (Shin et al., 2012). The close proximity of the H-NS and VpsR binding motifs suggests that binding of VpsR could either weaken the interaction between H-NS and the vpsT promoter or prevent H-NS from spreading downstream from its primary binding site.

At the genome level, ChiP-Seq revealed a striking correlation between regions in the genome exhibiting high H-NS occupancy and clusters of genes required for surface attachment and biofilm formation. Recent studies in E. coli have suggested that H-NS organizes the bacterial chromosome in foci to bring into proximity functionally-related regions facilitating communication between a regulatory gene and its target operon(s) (Dorman, 2013). Our study supports such a link between gene regulation and nucleoid organization with the caveat that, distinct from E. coli, V. cholerae contains two circular chromosomes (Heidelberg et al., 2000). One example supporting this principle is the clustering of H-NS at the TCP VPI and the vpsABCDEFGHIJK-rbmABDFEF-vpsLMNOPQ region. The VPI in chromosome I encodes the toxin-coregulated pilus (TCP), a type-4 pilus required for attachment to intestinal cells (Krebs & Taylor, 2011) and chitinous surfaces (Reguera & Kolter, 2005). The cellular processes encoded by the TCP VPI and the vps-rbm cluster are functionally-related and negatively co-regulated by quorum sensing (Skorupski & Taylor, 1999, Yang et al., 2010, Waters et al., 2008, Rutherford et al., 2011). Another example is the clustering of H-NS at the indole-producing tryptophanase operon and the indole-activated vas operon in chromosome II (Mueller et al., 2009). Indole has been reported to act as a signaling molecule that modulates biofilm development in V. cholerae (Mueller et al., 2009). In addition, expression of the type VI secretion system encoded by the vas operon is induced upon bacterial attachment to chitinous surfaces and is co-regulated with the TCP and vps-rbm gene clusters by quorum sensing (Borgeaud et al., 2015). H-NS also silenced the transcription of chiP, chiRP and VC1073, which are required for V. cholerae attachment and growth on chitinous surfaces (Meibom et al., 2004). Clustering of H-NS at sites of the chromatin involved in surface attachment and biofilm development could bring these regions into close proximity rendering their coordinate regulation more effective. H-NS clustering could also function to synchronize the expression of gene clusters involved in biofilm formation in responses to environmental conditions that affect their negative superhelical density (Hatfield & Benham, 2002). To our knowledge, our data provides the first evidence of a link between nucleoid architecture and biofilm development.

In summary, our results suggest a regulatory model in which an increase in the c-di-GMP pool induces a coordinated and multilocus H-NS antirepression cascade. For instance, under conditions in which the c-di-GMP pool is low, the highly abundant H-NS protein silences the transcription vpsT and downstream vps and rbm genes and V. cholerae preferentially adopts the planktonic lifestyle. An environmentally-induced up-shift in the c-di-GMP pool results in release of vpsT from H-NS repression facilitated by VpsR and in allosteric activation of VpsT. Active VpsT acts to diminish H-NS occupancy at downstream vps and rbm promoters resulting in the activation of biofilm exopolysaccharide and protein matrix biosynthesis. Conversely, an environmentally-induced down-shift in the c-di-GMP pool results in cessation of vpsT expression followed by displacement of bound VpsT from promoters by H-NS to reset the system back to silent.

Experimental procedures

Strains and media

V. cholerae mutants used in this study were derived from El Tor biotype strain C7258 and are described in Table S3. Escherichia coli TOP10 (Life Technologies) and S17-1λpir (de Lorenzo et al., 1993) were used for cloning purposes. V. cholerae strains were grown in LB medium at 37°C with agitation (225 rpm). When necessary, culture media were supplemented with ampicillin (Amp) (100 μg/ml), chloramphenicol (Cm) (10 μg/ml), kanamycin (Km) (25 μg/ml), rifampin (Rf) (150 μg/ ml), polymyxin B (PolB) (100 units/ml), isopropyl-β-D-thiogalactopyranoside (IPTG) (0.05 to 1.0 mM as indicated), or 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-gal) (20 μg/ml). Plasmids and oligonucleotide primers used throughout this work are described in Tables S3 and S4, respectively.

Construction of ΔaphA, ΔvpsT, ΔvpsR mutants expressing H-NS tagged with the FLAG epitope

To construct an aphA deletion mutant, the suicide vector pCVDΔAphA (Silva & Benitez, 2004) was transferred by conjugation from E. coli S17-1λpir to strain C7258. V. cholerae exconjugants were selected in LB agar containing Amp and PolB and strain JCA1 (C7258ΔaphA) was isolated by sucrose selection as described previously (Liang et al., 2007). Deletion of the aphA allele was confirmed by PCR with primer pairs AphA1/AphA2 and DNA sequencing. To express the epitope-tagged H-NS-FLAG protein from native hns transcription and translation initiation signals in wild type and mutant backgrounds, the suicide vector pCVDHNS-FLAG (Wang et al., 2012a) was transferred from S17-1λpir to strain HX17 (C7258ΔvpsT) (Wang et al., 2014), HX13 (C7258ΔvpsR) (Wang et al., 2014) and JCA1 (C7258ΔaphA) by conjugation and the corresponding exconjugants were selected on LB plates containing Amp and PolB (Table S3). Integration of the hns-flag allele by homologous recombination within the hns locus was confirmed by PCR using primer VicH567, which anneals to DNA sequences upstream of hns (not present in pCVDHNS-FLAG), and FlagR, which anneals to DNA encoding the FLAG epitope. The resulting PCR products were further confirmed by DNA sequencing and the expression of H-NS-FLAG was established by Western blotting using anti-FLAG M2-peroxidase monoclonal antibody (Sigma-Aldrich) and chemiluminescence detection as described previously (Wang et al., 2012a, Wang et al., 2014). To conduct epistasis analysis a vpsT gene deletion/insertion was introduced in strains C7258ΔlacZ and AJB80 to generate ΔvpsT and ΔhnsΔvpsT mutants, respectively. Briefly, suicide vector pCVDΔVpsT-Km (Wang et al., 2011) was transferred by conjugation from E. coli S17-1λpir to strains C7258ΔlacZ and AJB80 to create strains JCA5 (C7258ΔlacZ ΔvpsT) and JCA6 (C7258ΔlacZΔhnsΔvpsT) as described above.

For genetic complementation of vpsT mutants we modified the vector pTTQ18 (Stark, 1987). A blunt-ended 1129 bp DNA fragment encoding chloramphenicol acetyl transferase expression cassette was ligated into pTTQ18 digested with ScaI to generate pTTQ18cm. The entire vpsT ORF was amplified from the C7258 genome using primer pairs VpsT-1F/VpsT-1R and ligated into pTTQ18cm digested with EcoRI and HindIII to generate pVpsT. VpsT is expressed in this vector from the tac IPTG-inducible promoter.

Primer extension and DNase I footprint analysis

The vpsA and vpsL transcriptional start sites were identified by primer extension using 5’ HEX (6-carboxy-2’,4,4’,5’,7,7’-hexachlorofluorescein)-labeled primers and analysis on an automated capillary electrophoresis instrument as described previously (Wang et al., 2014). Briefly, 17 μg of total RNA from V. cholerae C7258 grown in LB medium to mid-exponential phase was annealed with primers HEX-vpsA or HEX-vpsL, complementary to the 5’ untranslated region (5'UTR) of vpsA and vpsL, respectively. Then, the primers were extended with AMV Reverse Transcriptase (Promega). For DNase I footprinting, DNA fragments encoding the promoter region of vpsA and vpsL were amplified by PCR using 6-carboxyfluorescein (FAM)- and HEX-labeled primers pairs FAM-vpsA-1F/HEX-vpsA-1R and FAM-vpsL-1F/HEX-vpsL-1R, respectively. Protein binding and DNase I digestion was performed as described previously (Wang et al., 2014). Concisely, 200 ng of fluorescently-labeled DNA was incubated with 0.125 to 2.0 μg of purified H-NS protein (Wang et al., 2012a) or 15 μg of purified VpsT protein (Wang et al., 2014) (with or without 100 μM c-di-GMP as indicated) prior to digestion with 0.11 U of RQ1 RNase-Free DNase I (Promega) for 5 min at 26°C. Fluorescently-labeled cDNA primer extension and DNase I digestion products were detected with a 3730 capillary DNA analyzer (Applied Biosystems). To accurately assign a nucleotide base to the peaks detected in the primer extension and DNase I footprint assays, a sequence ladder was generated using the Thermo Sequenase Dye Primer Manual Cycle sequencing kit (USB Corporation). Template DNA fragments encoding the vpsA and vpsL promoters were generated by PCR using primer pairs vpsA-1F/vpsA-1R and vpsL-1F/vpsL-1R, respectively. The fragments were ligated into vector pCR2.1 (Table S3) to generate the vectors pCR-vpsAP and pCR-vpsLP. Sequencing reactions were conducted according to the manufacturer’s instructions with 200 fmol of DNA template and 2 pmol of the corresponding fluorescently-labeled primer as indicated in the legend of supporting figures (Fig. S1–S5). The electropherograms corresponding to the primer extension and DNase I footprint reactions were aligned to the manually-generated nucleotide sequence by using GeneMapper software v. 4.0 (Applied Biosystems).

Electrophoresis mobility shift assays

Electrophoresis mobility shift assays (EMSAs) were conducted using the second-generation digoxigenin (DIG) gel shift kit (Roche Applied Sciences) as previously described (Wang et al., 2012b, Wang et al., 2012a, Wang et al., 2014). DNA fragments encoding the vpsA, vpsL, vpsU and rbmA promoter regions were generated by PCR from V. cholerae C7258 chromosomal DNA with the primer pairs vpsA-2F/VpsA-2R, VpsA-3F/VpsA-2R, vpsA-4F/vpsA-3R for vpsA, vpsL-2F/vpsL-2R, vpsL-3F/vpsL-3R, vpsL-4F/vpsL-4R for vpsL, vpsU-1F/vpsU-1R for vpsU and rbmA-1F/rbmA-1R for rbmA. DNA binding was quantitated by densitometry using the ImageQuant TL software (GE Healthcare). Protein-DNA equilibrium dissociation constants (Kd) were estimated by fitting the data to the Hill equation (Hill, 1910) by nonlinear regression with the aid of GraphPad Prism 5.0 (GraphPad, San Diego, CA).

A competitive EMSA was performed to recreate the interaction of H-NS and VpsT at the vpsA and vpsL promoters in vitro. DIG-labeled promoter DNA fragments were pre-incubated with a fixed amount of H-NS to form the initial nucleoprotein complex. After 15 min at 30°C, increasing amounts of VpsT or VpsT plus c-di-GMP was added and incubation continued for an additional 15 min. The final nucleoprotein complexes were resolved and detected as described above. Similar experiments were carried but incubating first with VpsT and then with H-NS in the absence of c-di-GMP.

Chromatin immunoprecipitation

H-NS promoter occupancy was determined by chromatin immunoprecipitation (ChIP) analysis as described previously (Wang et al., 2012a). Promoter occupancy by H-NS-FLAG was quantitated using the iTaq Universal SYBRR Green Supermix kit and a CFX96 Touch Real-Time PCR Detection System (Bio-Rad). The quantity of immunoprecipitated (IP) DNA was calculated as a percentage of the input DNA (10 μl sample taken prior to IP) using the formula IP = 2(Ct input−Ct IP) where CT is the fractional threshold cycle of the input and IP samples. The relative IP was calculated by normalizing the IP of each sample by the IP of a mock ChIP using the mouse monoclonal antibody G3A1 IgG1 isotype control (Cell Signaling Technology). To study the effect of VpsT on H-NS promoter occupancy, strain C7258H-NS-FLAG (wild type) and JCA2 (ΔvpsT/HNS-FLAG) harboring the empty vector pTTQ18cm (control) or pVpsT were grown in LB medium containing Amp and Cm at 37°C to optical density at 600 nm (OD600) 0.4. Expression of vpsT in strains containing pVpsT was induced with IPTG (1 mM).

To study the effect of artificially increasing the cellular c-di-GMP pool on H-NS promoter occupancies, strains C7258HNS-FLAG, JCA3 (ΔvpsR hns::hns-flag) and JCA4 (ΔaphA hns::hns-flag) were transformed with plasmids pCMW75 or pCMW98 expressing V. harveyi DGC QrgB or the catalytically inactive mutant QrgB* (Waters et al., 2008), respectively. The transformants were grown in LB medium supplemented with Amp and Km or the same medium containing IPTG (1 mM) to increase the c-di-GMP pool. Cultures were incubated at 37°C and collected at OD600 0.5.

Promoter regions containing the H-NS binding sites were amplified and quantitated with primer pairs rbmA-1F/rbmA-1R for rbmA, vpsU-1F/vpsU-1R for vpsU, vpsA-4F/vpsA-3R or vpsA-5F/vpsA-4R for vpsA, vpsL-2F/vpsL-5R for vpsL/rbmF, vpsT-2F/vpsT-2R or vpsT-3F/vpsT-3R for vpsT. The tcpA and VC1922 promoters were used as H-NS occupancy positive and negative controls, respectively (Wang et al., 2012a). The tcpA and VC1922 promoters were amplified with primer pairs tcpA1F/tcpA2R and vc1922-F/vc1922-R, respectively.

ChIP-Seq

For ChIP-Seq, the ChIP part of the protocol was conducted as described previously (Wang et al., 2012a, Wang et al., 2012b) with minor modifications. Briefly, nine cell lysate samples of 100 μl were combined, immunoprecipitated and the final purified IP DNA was resuspended in 30 μl of distilled water. The DNA concentration of the anti-FLAG (7.2 ng/μl) and input (23.0 ng/μl) samples were determined using the Qubit® Fluorometric Quantitation System (Life Technologies). The anti-FLAG IP DNA and input DNA were used for library preparation for Illumina sequencing using the TruSeq ChIP kit (Illumina, San Diego, CA) following manufacturer’s protocol. Briefly, 20 ng of ChIP DNA samples were end repaired-ligated to Illumina adaptors and selected for a fragment size of approximately 300 bp by gel extraction. Multiplex Illumina primers were used to amplify gel-extracted products. The amplified ChIP-Seq libraries were quantitated by qPCR and loaded to a concentration of 2.5 pM per lane in the Illumina HiSeq2000 platform. A standard paired-end sequencing reaction was performed to generate 50 bp of sequence in each direction. The raw data was converted from .bcl file format to .fastq format for downstream analysis. This was done using CASAVA v1.8.2 software from Illumina.

ChIP-Seq bioinformatics analysis

The raw fastq data files were aligned to the V. cholerae El Tor N16961 reference genome (NC_002505.1 and NC_002506.1) using Bowtie, an ultrafast memory-efficient short read aligner (Langmead et al., 2009) available on the Galaxy web-based platform (Blankenberg et al., 2010). The generated sam data files were filtered to remove unmapped reads and converted to bam data files using the Galaxy Next Generation Sequencing (NGS): SAM Tools. SeqMonk v0.27.0 was used for peak calling, quantitation and annotation. The MACS (Model- Based Analysis for ChIP-Seq) algorithm (Zhang et al., 2008) within SeqMonk was used for peak calling with p-value 1.0E-05, a sonicated fragment size of 300 bp and input sample as control. The Read Count Quantitation algorithm within SeqMonk was used for peak quantitation. The ChIP-Seq raw and processed data files have been deposited in NCBI's Gene Expression Omnibus (GEO) (Edgar et al., 2002) and are accessible through the GEO series accession number GSE64249.

qRT-PCR

Total RNA extraction and quantitative real-time reverse-transcription-PCR (qRT-PCR) was conducted using the iScript two-step RT-PCR kit with SYBR green (Bio-Rad Laboratories) as described previously (Liang et al., 2007, Silva et al., 2008). Relative expression values were calculated as 2(CT target - CT reference), where CT is the fractional threshold cycle. The level of recA mRNA was used as an internal reference. The following primer pairs were used: vpsU-2F/vpsU-2R for vpsU mRNA, rbmA-2F/rbmA-2R for rbmA mRNA, rbmF-F/rbmF-R for rbmF mRNA, vpsAqFw/vpsAqRv for vpsA mRNA, vpsLqFw/vpsLqRv for vpsL mRNA and RecA578/RecA863 for recA mRNA.

Supplementary Material

Supporting information

Fig. S1–S5. Supporting primer extension and DNase I footprint electropherograms

Fig. S6. Confirmation of VpsT binding to a 20 bp inverted repeat motif

Fig. S7. Release of free DNA from the VpsT-DNA complex during electrophoresis.

Fig. S8. H-NS ChIP-Seq statistics

Table S1. H-NS ChIP-Seq peak calling report

Table S2. Occurrence of H-NS motif in the V. cholerae genome

Table S3. Strains and plasmids

Tables S4. Oligonucleotide primers

Acknowledgments

This study was supported by awards F31AI106288 (JCA), 5R21AI103693-03 (JAB) and 5SC1AI104993-03 (AJS) from the National Institute of Allergy and Infectious Diseases. We are grateful to Michael Crowley, Mei Han and David Crossman (University of Alabama at Birmingham (UAB) Heflin Center for Genomic Sciences) for assistance in DNase I footprinting and NGS data analysis. We are grateful to Jeffrey Vahrenkamp (UAB) for assistance in primer extension and analysis of ChIP-Seq data. Plasmids pCMW75 and pCMW98 were generously provided by Christopher Waters (Michigan State University). We are grateful to Charles Turnbough (UAB) for critical advice and support throughout the development of this research. The authors declare no conflict of interest.

References

  1. Absalon C, Van Dellen K, Watnick PI. A communal bacterial adhesin anchors biofilm and bystander cells to surfaces. PLoS pathogens. 2011;7:e1002210. doi: 10.1371/journal.ppat.1002210. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Atlung T, Ingmer H. H-NS: a modulator of environmentally regulated gene expression. Molecular microbiology. 1997;24:7–17. doi: 10.1046/j.1365-2958.1997.3151679.x. [DOI] [PubMed] [Google Scholar]
  3. Bailey TL, Elkan C. Fitting a mixture model by expectation maximization to discover motifs in biopolymers. Proceedings / .. International Conference on Intelligent Systems for Molecular Biology ; ISMB International Conference on Intelligent Systems for Molecular Biology; 1994. pp. 28–36. [PubMed] [Google Scholar]
  4. Berk V, Fong JC, Dempsey GT, Develioglu ON, Zhuang X, Liphardt J, Yildiz FH, Chu S. Molecular architecture and assembly principles of Vibrio cholerae biofilms. Science. 2012;337:236–239. doi: 10.1126/science.1222981. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Beyhan S, Bilecen K, Salama SR, Casper-Lindley C, Yildiz FH. Regulation of rugosity and biofilm formation in Vibrio cholerae: comparison of VpsT and VpsR regulons and epistasis analysis of vpsT, vpsR, and hapR. Journal of bacteriology. 2007;189:388–402. doi: 10.1128/JB.00981-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Beyhan S, Tischler AD, Camilli A, Yildiz FH. Transcriptome and phenotypic responses of Vibrio cholerae to increased cyclic di-GMP level. Journal of bacteriology. 2006;188:3600–3613. doi: 10.1128/JB.188.10.3600-3613.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Blankenberg D, Von Kuster G, Coraor N, Ananda G, Lazarus R, Mangan M, Nekrutenko A, Taylor J. Galaxy: a web-based genome analysis tool for experimentalists. In: Ausubel Frederick M, et al., editors. Current protocols in molecular biology. Unit 19 10. Chapter 19. 2010. pp. 11–21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Borgeaud S, Metzger LC, Scrignari T, Blokesch M. Bacterial evolution. The type VI secretion system of Vibrio cholerae fosters horizontal gene transfer. Science. 2015;347:63–67. doi: 10.1126/science.1260064. [DOI] [PubMed] [Google Scholar]
  9. Casper-Lindley C, Yildiz FH. VpsT is a transcriptional regulator required for expression of vps biosynthesis genes and the development of rugose colonial morphology in Vibrio cholerae O1 El Tor. Journal of bacteriology. 2004;186:1574–1578. doi: 10.1128/JB.186.5.1574-1578.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Dame RT, Wyman C, Goosen N. Structural basis for preferential binding of H-NS to curved DNA. Biochimie. 2001;83:231–234. doi: 10.1016/s0300-9084(00)01213-x. [DOI] [PubMed] [Google Scholar]
  11. Dame RT, Wyman C, Wurm R, Wagner R, Goosen N. Structural basis for H-NS-mediated trapping of RNA polymerase in the open initiation complex at the rrnB P1. The Journal of biological chemistry. 2002;277:2146–2150. doi: 10.1074/jbc.C100603200. [DOI] [PubMed] [Google Scholar]
  12. de Lorenzo V, Eltis L, Kessler B, Timmis KN. Analysis of Pseudomonas gene products using lacIq/Ptrp-lac plasmids and transposons that confer conditional phenotypes. Gene. 1993;123:17–24. doi: 10.1016/0378-1119(93)90533-9. [DOI] [PubMed] [Google Scholar]
  13. Dorman CJ. H-NS, the genome sentinel. Nature reviews Microbiology. 2007;5:157–161. doi: 10.1038/nrmicro1598. [DOI] [PubMed] [Google Scholar]
  14. Dorman CJ. Genome architecture and global gene regulation in bacteria: making progress towards a unified model? Nature reviews Microbiology. 2013;11:349–355. doi: 10.1038/nrmicro3007. [DOI] [PubMed] [Google Scholar]
  15. Dorman CJ, Kane KA. DNA bridging and antibridging: a role for bacterial nucleoid-associated proteins in regulating the expression of laterally acquired genes. FEMS microbiology reviews. 2009;33:587–592. doi: 10.1111/j.1574-6976.2008.00155.x. [DOI] [PubMed] [Google Scholar]
  16. Dow JMFYLJaRRP. Cyclic di-GMP as an intracellular signal regulating bacterial bio lm formation. In: Kjelleberg SGM, editor. The Bio lm Mode of Life, Mechanisms and Adaptations. Norfolk, UK: Horizon Bioscience; 2007. pp. 71–94. [Google Scholar]
  17. Edgar R, Domrachev M, Lash AE. Gene Expression Omnibus: NCBI gene expression and hybridization array data repository. Nucleic acids research. 2002;30:207–210. doi: 10.1093/nar/30.1.207. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Faruque SM, Biswas K, Udden SM, Ahmad QS, Sack DA, Nair GB, Mekalanos JJ. Transmissibility of cholera: in vivo-formed biofilms and their relationship to infectivity and persistence in the environment. Proceedings of the National Academy of Sciences of the United States of America. 2006;103:6350–6355. doi: 10.1073/pnas.0601277103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Fong JC, Syed KA, Klose KE, Yildiz FH. Role of Vibrio polysaccharide (vps) genes in VPS production, biofilm formation and Vibrio cholerae pathogenesis. Microbiology. 2010;156:2757–2769. doi: 10.1099/mic.0.040196-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Fong JC, Yildiz FH. The rbmBCDEF gene cluster modulates development of rugose colony morphology and biofilm formation in Vibrio cholerae. Journal of bacteriology. 2007;189:2319–2330. doi: 10.1128/JB.01569-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Giglio KM, Fong JC, Yildiz FH, Sondermann H. Structural basis for biofilm formation via the Vibrio cholerae matrix protein RbmA. Journal of bacteriology. 2013;195:3277–3286. doi: 10.1128/JB.00374-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Grant CE, Bailey TL, Noble WS. FIMO: scanning for occurrences of a given motif. Bioinformatics. 2011;27:1017–1018. doi: 10.1093/bioinformatics/btr064. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Hatfield GW, Benham CJ. DNA topology-mediated control of global gene expression in Escherichia coli. Annual review of genetics. 2002;36:175–203. doi: 10.1146/annurev.genet.36.032902.111815. [DOI] [PubMed] [Google Scholar]
  24. Hawley DK, Johnson AD, McClure WR. Functional and physical characterization of transcription initiation complexes in the bacteriophage lambda OR region. J Biol Chem. 1985;260:8618–8626. [PubMed] [Google Scholar]
  25. Heidelberg JF, Eisen JA, Nelson WC, Clayton RA, Gwinn ML, Dodson RJ, Haft DH, Hickey EK, Peterson JD, Umayam L, Gill SR, Nelson KE, Read TD, Tettelin H, Richardson D, Ermolaeva MD, Vamathevan J, Bass S, Qin H, Dragoi I, Sellers P, McDonald L, Utterback T, Fleishmann RD, Nierman WC, White O, Salzberg SL, Smith HO, Colwell RR, Mekalanos JJ, Venter JC, Fraser CM. DNA sequence of both chromosomes of the cholera pathogen Vibrio cholerae. Nature. 2000;406:477–483. doi: 10.1038/35020000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Hill AV. The possible effects of the aggregation of the molecules of hæmoglobin on its dissociation curves. Journal of Physiology. 1910;40(Suppl):iv–vii. [Google Scholar]
  27. Jobling MG, Holmes RK. Characterization of hapR, a positive regulator of the Vibrio cholerae HA/protease gene hap, and its identification as a functional homologue of the Vibrio harveyi luxR gene. Molecular microbiology. 1997;26:1023–1034. doi: 10.1046/j.1365-2958.1997.6402011.x. [DOI] [PubMed] [Google Scholar]
  28. Karaolis DK, Johnson JA, Bailey CC, Boedeker EC, Kaper JB, Reeves PR. A Vibrio cholerae pathogenicity island associated with epidemic and pandemic strains. Proceedings of the National Academy of Sciences of the United States of America. 1998;95:3134–3139. doi: 10.1073/pnas.95.6.3134. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Krasteva PV, Fong JC, Shikuma NJ, Beyhan S, Navarro MV, Yildiz FH, Sondermann H. Vibrio cholerae VpsT regulates matrix production and motility by directly sensing cyclic di-GMP. Science. 2010;327:866–868. doi: 10.1126/science.1181185. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Krebs SJ, Taylor RK. Protection and attachment of Vibrio cholerae mediated by the toxin-coregulated pilus in the infant mouse model. Journal of bacteriology. 2011;193:5260–5270. doi: 10.1128/JB.00378-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Lang B, Blot N, Bouffartigues E, Buckle M, Geertz M, Gualerzi CO, Mavathur R, Muskhelishvili G, Pon CL, Rimsky S, Stella S, Babu MM, Travers A. High-affinity DNA binding sites for H-NS provide a molecular basis for selective silencing within proteobacterial genomes. Nucleic acids research. 2007;35:6330–6337. doi: 10.1093/nar/gkm712. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Langmead B, Trapnell C, Pop M, Salzberg SL. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome biology. 2009;10:R25. doi: 10.1186/gb-2009-10-3-r25. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Liang W, Pascual-Montano A, Silva AJ, Benitez JA. The cyclic AMP receptor protein modulates quorum sensing, motility and multiple genes that affect intestinal colonization in Vibrio cholerae. Microbiology. 2007;153:2964–2975. doi: 10.1099/mic.0.2007/006668-0. [DOI] [PubMed] [Google Scholar]
  34. Lim B, Beyhan S, Meir J, Yildiz FH. Cyclic-diGMP signal transduction systems in Vibrio cholerae: modulation of rugosity and biofilm formation. Molecular microbiology. 2006;60:331–348. doi: 10.1111/j.1365-2958.2006.05106.x. [DOI] [PubMed] [Google Scholar]
  35. Lim B, Beyhan S, Yildiz FH. Regulation of Vibrio polysaccharide synthesis and virulence factor production by CdgC, a GGDEF-EAL domain protein, in Vibrio cholerae. Journal of bacteriology. 2007;189:717–729. doi: 10.1128/JB.00834-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Lucchini S, Rowley G, Goldberg MD, Hurd D, Harrison M, Hinton JC. H-NS mediates the silencing of laterally acquired genes in bacteria. PLoS pathogens. 2006;2:e81. doi: 10.1371/journal.ppat.0020081. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Mazel D, Dychinco B, Webb VA, Davies J. A distinctive class of integron in the Vibrio cholerae genome. Science. 1998;280:605–608. doi: 10.1126/science.280.5363.605. [DOI] [PubMed] [Google Scholar]
  38. Meibom KL, Li XB, Nielsen AT, Wu CY, Roseman S, Schoolnik GK. The Vibrio cholerae chitin utilization program. Proceedings of the National Academy of Sciences of the United States of America. 2004;101:2524–2529. doi: 10.1073/pnas.0308707101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Mueller RS, Beyhan S, Saini SG, Yildiz FH, Bartlett DH. Indole acts as an extracellular cue regulating gene expression in Vibrio cholerae. Journal of bacteriology. 2009;191:3504–3516. doi: 10.1128/JB.01240-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Nye MB, Pfau JD, Skorupski K, Taylor RK. Vibrio cholerae H-NS silences virulence gene expression at multiple steps in the ToxR regulatory cascade. Journal of bacteriology. 2000;182:4295–4303. doi: 10.1128/jb.182.15.4295-4303.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Nye MB, Taylor RK. Vibrio cholerae H-NS domain structure and function with respect to transcriptional repression of ToxR regulon genes reveals differences among H-NS family members. Molecular microbiology. 2003;50:427–444. doi: 10.1046/j.1365-2958.2003.03701.x. [DOI] [PubMed] [Google Scholar]
  42. Pruzzo C, Vezzulli L, Colwell RR. Global impact of Vibrio cholerae interactions with chitin. Environmental microbiology. 2008;10:1400–1410. doi: 10.1111/j.1462-2920.2007.01559.x. [DOI] [PubMed] [Google Scholar]
  43. Reguera G, Kolter R. Virulence and the environment: a novel role for Vibrio cholerae toxin-coregulated pili in biofilm formation on chitin. Journal of bacteriology. 2005;187:3551–3555. doi: 10.1128/JB.187.10.3551-3555.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Rutherford ST, van Kessel JC, Shao Y, Bassler BL. AphA and LuxR/HapR reciprocally control quorum sensing in vibrios. Genes & development. 2011;25:397–408. doi: 10.1101/gad.2015011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Schlax PJ, Capp MW, Record MT., Jr Inhibition of transcription initiation by lac repressor. Journal of molecular biology. 1995;245:331–350. doi: 10.1006/jmbi.1994.0028. [DOI] [PubMed] [Google Scholar]
  46. Schroder O, Wagner R. The bacterial DNA-binding protein H-NS represses ribosomal RNA transcription by trapping RNA polymerase in the initiation complex. Journal of molecular biology. 2000;298:737–748. doi: 10.1006/jmbi.2000.3708. [DOI] [PubMed] [Google Scholar]
  47. Shikuma NJ, Fong JC, Yildiz FH. Cellular levels and binding of c-di-GMP control subcellular localization and activity of the Vibrio cholerae transcriptional regulator VpsT. PLoS pathogens. 2012;8:e1002719. doi: 10.1371/journal.ppat.1002719. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Shin M, Lagda AC, Lee JW, Bhat A, Rhee JH, Kim JS, Takeyasu K, Choy HE. Gene silencing by H-NS from distal DNA site. Molecular microbiology. 2012;86:707–719. doi: 10.1111/mmi.12012. [DOI] [PubMed] [Google Scholar]
  49. Silva AJ, Benitez JA. Transcriptional regulation of Vibrio cholerae hemagglutinin/protease by the cyclic AMP receptor protein and RpoS. Journal of bacteriology. 2004;186:6374–6382. doi: 10.1128/JB.186.19.6374-6382.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Silva AJ, Sultan SZ, Liang W, Benitez JA. Role of the histone-like nucleoid structuring protein in the regulation of rpoS and RpoS-dependent genes in Vibrio cholerae. Journal of bacteriology. 2008;190:7335–7345. doi: 10.1128/JB.00360-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Skorupski K, Taylor RK. A new level in the Vibrio cholerae ToxR virulence cascade: AphA is required for transcriptional activation of the tcpPH operon. Molecular microbiology. 1999;31:763–771. doi: 10.1046/j.1365-2958.1999.01215.x. [DOI] [PubMed] [Google Scholar]
  52. Spurio R, Falconi M, Brandi A, Pon CL, Gualerzi CO. The oligomeric structure of nucleoid protein H-NS is necessary for recognition of intrinsically curved DNA and for DNA bending. The EMBO journal. 1997;16:1795–1805. doi: 10.1093/emboj/16.7.1795. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Srivastava D, Harris RC, Waters CM. Integration of cyclic di-GMP and quorum sensing in the control of vpsT and aphA in Vibrio cholerae. Journal of bacteriology. 2011;193:6331–6341. doi: 10.1128/JB.05167-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Stark MJ. Multicopy expression vectors carrying the lac repressor gene for regulated high-level expression of genes in Escherichia coli. Gene. 1987;51:255–267. doi: 10.1016/0378-1119(87)90314-3. [DOI] [PubMed] [Google Scholar]
  55. Stoebel DM, Free A, Dorman CJ. Anti-silencing: overcoming H-NS-mediated repression of transcription in Gram-negative enteric bacteria. Microbiology. 2008;154:2533–2545. doi: 10.1099/mic.0.2008/020693-0. [DOI] [PubMed] [Google Scholar]
  56. Stonehouse E, Kovacikova G, Taylor RK, Skorupski K. Integration host factor positively regulates virulence gene expression in Vibrio cholerae. Journal of bacteriology. 2008;190:4736–4748. doi: 10.1128/JB.00089-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Stonehouse EA, Hulbert RR, Nye MB, Skorupski K, Taylor RK. H-NS binding and repression of the ctx promoter in Vibrio cholerae. Journal of bacteriology. 2011;193:979–988. doi: 10.1128/JB.01343-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Tamayo R, Patimalla B, Camilli A. Growth in a biofilm induces a hyperinfectious phenotype in Vibrio cholerae. Infection and immunity. 2010;78:3560–3569. doi: 10.1128/IAI.00048-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Thorvaldsdottir H, Robinson JT, Mesirov JP. Integrative Genomics Viewer (IGV): high-performance genomics data visualization and exploration. Briefings in bioinformatics. 2013;14:178–192. doi: 10.1093/bib/bbs017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Tischler AD, Camilli A. Cyclic diguanylate (c-di-GMP) regulates Vibrio cholerae biofilm formation. Molecular microbiology. 2004;53:857–869. doi: 10.1111/j.1365-2958.2004.04155.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Wang H, Ayala JC, Benitez JA, Silva AJ. Interaction of the histone-like nucleoid structuring protein and the general stress response regulator RpoS at Vibrio cholerae promoters that regulate motility and hemagglutinin/protease expression. Journal of bacteriology. 2012a;194:1205–1215. doi: 10.1128/JB.05900-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Wang H, Ayala JC, Benitez JA, Silva AJ. The LuxR-type regulator VpsT negatively controls the transcription of rpoS, encoding the general stress response regulator, in Vibrio cholerae biofilms. Journal of bacteriology. 2014;196:1020–1030. doi: 10.1128/JB.00993-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Wang H, Ayala JC, Benitez JA, Silva AJ. RNA-Seq Analysis Identifies New Genes Regulated by the Histone-Like Nucleoid Structuring Protein (H-NS) Affecting Vibrio cholerae Virulence, Stress Response and Chemotaxis. PloS one. 2015;10:e0118295. doi: 10.1371/journal.pone.0118295. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Wang H, Ayala JC, Silva AJ, Benitez JA. The histone-like nucleoid structuring protein (H-NS) is a repressor of Vibrio cholerae exopolysaccharide biosynthesis (vps) genes. Applied and environmental microbiology. 2012b;78:2482–2488. doi: 10.1128/AEM.07629-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Wang H, Wu JH, Ayala JC, Benitez JA, Silva AJ. Interplay among cyclic diguanylate, HapR, and the general stress response regulator (RpoS) in the regulation of Vibrio cholerae hemagglutinin/protease. Journal of bacteriology. 2011;193:6529–6538. doi: 10.1128/JB.05166-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Waters CM, Lu W, Rabinowitz JD, Bassler BL. Quorum sensing controls biofilm formation in Vibrio cholerae through modulation of cyclic di-GMP levels and repression of vpsT. Journal of bacteriology. 2008;190:2527–2536. doi: 10.1128/JB.01756-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. Yang M, Frey EM, Liu Z, Bishar R, Zhu J. The virulence transcriptional activator AphA enhances biofilm formation by Vibrio cholerae by activating expression of the biofilm regulator VpsT. Infection and immunity. 2010;78:697–703. doi: 10.1128/IAI.00429-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. Yildiz FH, Dolganov NA, Schoolnik GK. VpsR, a Member of the Response Regulators of the Two-Component Regulatory Systems, Is Required for Expression of vps Biosynthesis Genes and EPS(ETr)-Associated Phenotypes in Vibrio cholerae O1 El Tor. Journal of bacteriology. 2001;183:1716–1726. doi: 10.1128/JB.183.5.1716-1726.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. Yildiz FH, Liu XS, Heydorn A, Schoolnik GK. Molecular analysis of rugosity in a Vibrio cholerae O1 El Tor phase variant. Molecular microbiology. 2004;53:497–515. doi: 10.1111/j.1365-2958.2004.04154.x. [DOI] [PubMed] [Google Scholar]
  70. Yildiz FH, Schoolnik GK. Vibrio cholerae O1 El Tor: identification of a gene cluster required for the rugose colony type, exopolysaccharide production, chlorine resistance, and biofilm formation. Proceedings of the National Academy of Sciences of the United States of America. 1999;96:4028–4033. doi: 10.1073/pnas.96.7.4028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  71. Yu RR, DiRita VJ. Regulation of gene expression in Vibrio cholerae by ToxT involves both antirepression and RNA polymerase stimulation. Molecular microbiology. 2002;43:119–134. doi: 10.1046/j.1365-2958.2002.02721.x. [DOI] [PubMed] [Google Scholar]
  72. Zamorano-Sanchez D, Fong JC, Kilic S, Erill I, Yildiz FH. Identification and Characterization of VpsR and VpsT Binding Sites in Vibrio cholerae. Journal of bacteriology. 2015;197:1221–1235. doi: 10.1128/JB.02439-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  73. Zhang Y, Liu T, Meyer CA, Eeckhoute J, Johnson DS, Bernstein BE, Nusbaum C, Myers RM, Brown M, Li W, Liu XS. Model-based analysis of ChIP-Seq (MACS) Genome biology. 2008;9:R137. doi: 10.1186/gb-2008-9-9-r137. [DOI] [PMC free article] [PubMed] [Google Scholar]
  74. Zhu J, Mekalanos JJ. Quorum sensing-dependent biofilms enhance colonization in Vibrio cholerae. Developmental cell. 2003;5:647–656. doi: 10.1016/s1534-5807(03)00295-8. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supporting information

Fig. S1–S5. Supporting primer extension and DNase I footprint electropherograms

Fig. S6. Confirmation of VpsT binding to a 20 bp inverted repeat motif

Fig. S7. Release of free DNA from the VpsT-DNA complex during electrophoresis.

Fig. S8. H-NS ChIP-Seq statistics

Table S1. H-NS ChIP-Seq peak calling report

Table S2. Occurrence of H-NS motif in the V. cholerae genome

Table S3. Strains and plasmids

Tables S4. Oligonucleotide primers

NIHMS727195-supplement-Supporting_information.pdf (8.8MB, pdf)

RESOURCES