Structural Characterization of Interaction between Human Ubiquitin-specific Protease 7 and Immediate-Early Protein ICP0 of Herpes Simplex Virus-1

Background: Herpesvirus infection is dependent upon the viral E3 ligase ICP0 and its interaction with the human deubiquitinating enzyme USP7.

Results: The interaction between USP7 and ICP0 was structurally characterized using solution NMR.

Conclusion: ICP0 is recognized by ubiquitin-like domains 1 and 2 (UBL12) of the USP7.

Significance: Details of the USP7/ICP0 interaction provide new insights into function of the USP7 ubiquitin-like domains.

Abstract

Human ubiquitin-specific protease 7 (USP7) is a deubiquitinating enzyme that prevents protein degradation by removing polyubiquitin chains from its substrates. It regulates the stability of a number of human transcription factors and tumor suppressors and plays a critical role in the development of several types of cancer, including prostate and small cell lung cancer. In addition, human USP7 is targeted by several viruses of the Herpesviridae family and is required for effective herpesvirus infection. The USP7 C-terminal region (C-USP7) contains five ubiquitin-like domains (UBL1–5) that interact with several USP7 substrates. Although structures of the USP7 C terminus bound to its substrates could provide vital information for understanding USP7 substrate specificity, no such data has been available to date. In this work we have demonstrated that the USP7 ubiquitin-like domains can be studied in isolation by solution NMR spectroscopy, and we have determined the structure of the UBL1 domain. Furthermore, we have employed NMR and viral plaque assays to probe the interaction between the C-USP7 and HSV-1 immediate-early protein ICP0 (infected cell protein 0), which is essential for efficient lytic infection and virus reactivation from latency. We have shown that depletion of the USP7 in HFF-1 cells negatively affects the efficiency of HSV-1 lytic infection. We have also found that USP7 directly binds ICP0 via its C-terminal UBL1–2 domains and mapped the USP7-binding site for ICP0. Therefore, this study represents a first step toward understanding the molecular mechanism of C-USP7 specificity toward its substrates and may provide the basis for future development of novel antiviral and anticancer therapies.

Introduction

Conjugation of ubiquitin to target proteins is important in multiple cellular processes, including signaling cascades, proteasomal degradation, and protein localization. Mono- and polyubiquitination can be reversed by deubiquitinating enzymes, which cleave the isopeptide bond between ubiquitin and a substrate. Ubiquitin-specific protease 7 (USP7), also known as herpesvirus-associated ubiquitin-specific protease (HAUSP), is a 135-kDa cysteine isopeptidase (1). Misregulation of the USP7 was linked to multiple human pathologies, including prostate and non-small cell lung cancers (2, 3).

A number of USP7 substrates have been identified, and USP7 knockdown was shown to affect cellular levels of at least 36 proteins in LS174T colon carcinoma cells (4). Among a variety of substrates, the USP7 deubiquitinates both p53 tumor suppressor and its main regulator E3 ligase Hdm2 (human double minute 2) and thus plays a central role in maintaining an appropriate p53 level in the cell (5–8). Other important targets of USP7 include several transcription factors such as FOX(O)4, PTEN, NF-κB, and HLTF; DNA replication and repair proteins such as UbE2E1, claspin, and MCM-BP; and proteins involved in epigenetic control of gene expression such as DNMT1 and PRC1 (2, 9–15).

In addition to cellular substrates, USP7 is known to interact with proteins from all three subfamilies of the Herpesviridae family of viruses. Specifically, it interacts with immediate-early protein ICP0 from herpes simplex virus-1 (HSV-1), which is required for efficient lytic infection and reactivation of latent and quiescent viral genomes (16). USP7 also binds two proteins from Kaposi sarcoma-associated herpesvirus (KSHV), LANA and vIRF4 (17, 18). LANA is the major viral protein expressed in all forms of KSHV-associated malignancies, and vlRF4 is the key player in the switch from latency to lytic reactivation (17, 18). USP7 also interacts with the EBNA1 protein from Epstein-Barr virus, which competes with the p53 transcription factor for USP7 binding (19, 20). Thus, USP7 binding to EBNA1 results in p53 destabilization and blockage of the DNA damage response caused by Epstein-Barr virus infection (19, 20). Finally, USP7 binds the UL35 protein from cytomegalovirus essential for viral replication and particle formation (21). In addition to herpesvirus targets, USP7 was recently shown to interact with at least one adenoviral protein, E1B-55K, a component of the E1B-55K·E4-orf6 E3 ligase complex that degrades a wide range of intracellular proteins. Down-regulation or specific inhibition of USP7 destabilizes E1B-55K and negatively affects viral replication (22, 23). Because of the central role USP7 plays in viral infection and cancer development pathways, it represents an attractive target for the design of new antiviral and anticancer therapies. Although knowledge of molecular mechanisms of USP7 specificity toward its diverse substrates is essential for drug development, to date these mechanisms remain poorly understood.

Structurally, USP7 consists of an N-terminal substrate-binding TRAF-like domain followed by a ubiquitin-binding catalytic domain and a large 64-kDa C-terminal region (C-USP7, residues 557–1102) that contains five ubiquitin-like domains (UBL1–5)² shown in Fig. 1A (19, 24, 25). USP7 complexes with several substrates have been previously characterized, including peptides derived from p53, Hdm2, HdmX, UbE2E1, MCM-BP, vlRF4, and EBNA1 (7, 14, 15, 17, 20, 26). Remarkably, all these substrates share a common USP7-binding (P/A)XXS motif and interact with the same site located in the TRAF-like domain. The function of the USP7 C-terminal UBL domains remains largely unknown. Interestingly, UBL domains were found in at least 16 members of the USP family. All of them share a characteristic β-grasp ubiquitin fold, although their sequence similarity to ubiquitin may be very limited. Although a few of these UBLs have been characterized, the functions of others, including UBLs of the USP9, USP24, USP34, USP47 and USP48 remain elusive (27). The ICP0 E3 ligase from HSV-1 is the first USP7 substrate shown to interact exclusively with C-USP7, suggesting that the UBL domains may function as a platform for substrate binding. Recent studies revealed that the USP7 C-terminal region contains additional binding sites for p53 and Hdm2, as well as for the transcription factor FOX(O)4, which interacts exclusively with the C terminus (9, 28). However, at this time no structural data are available for any of these C-USP7 complexes.

FIGURE 1.

Isolated USP7 UBL domains can be studied independently in solution. A, schematic representation of the domain arrangement of the human USP7 protein. B, two-dimensional ¹H-¹⁵N HSQC spectra of the UBL1 (blue), UBL12 (green), UBL3 (black), and UBL45 (red) domains.

Here, we report a structural study of the C-USP7/substrate interaction. With the use of NMR spectroscopy, we have shown that individual USP7 UBL domains and/or two-domain constructs are stable in isolation and can be studied independently in solution. Furthermore, we have determined solution NMR structure of the USP7 UBL1 domain and demonstrated that it is nearly identical to the crystal structure of the UBL1 in the context of the intact C terminus (25). Finally, we have characterized the interaction between C-USP7 and the ICP0 protein from HSV-1 virus and mapped the ICP0 binding interface on the surface of the UBL1-UBL2 domains. Our work represents the first structural study of the USP-substrate recognition mediated by its UBL domains. Because many of the USPs contain multiple UBLs (27), it is likely that substrate recognition by the UBL domains may prove to be a common feature shared among a class of UBL-containing USPs.

Experimental Procedures

In Vitro Studies

Protein Expression and Purification

Sequences encoding UBL1 (residues 537–664), UBL12 (residues 535–775), UBL3 (residues 775–888), and UBL45 (residues 884–1102) domains of the human USP7 were subcloned into pET28a-LIC vector (Structural Genomics Consortium). All proteins were purified following the same protocol. Plasmids containing recombinant proteins with the N-terminal His₆ tag were transformed into Escherichia coli BL21 (DE3) strain. Proteins were expressed in M9 minimal medium containing ¹⁵NH₄Cl (and [¹³C]glucose for production of the ¹⁵N/¹³C-labeled UBL1). ¹⁵N/¹³C-labeled deuterated UBL12 was expressed in 100% D₂O-based M9 medium using [¹³C/²H]glucose as the sole carbon source. Transformed cells were grown at 37 °C to an A₆₀₀ of 0.6–0.8. Protein expression was induced by adding 1 mm isopropyl 1-thio-β-d-galactopyranoside followed by incubation overnight at 20 °C. Cells were harvested, resuspended in buffer containing 20 mm NaH₂PO₄, 250 mm NaCl, 10 mm imidazole, 1 mm PMSF, pH 7.4, lysed by sonication, and centrifuged at 15,000 rpm for 45 min. The supernatant was applied to a nickel-nitrilotriacetic acid column, and proteins were eluted with a buffer containing 20 mm NaH₂PO₄, 250 mm NaCl, 250 mm imidazole, pH 7.4. Following thrombin or Tobacco Etch Virus protease digestion to remove the His₆ tag, proteins were additionally purified using either HiLoad Superdex 75 (for UBL1 and UBL3) or HiLoad Superdex 200 (for UBL12 and UBL45) columns (GE Healthcare). Final samples used for NMR experiments contained 0.8–1.2 mm of purified protein, 20 mm NaH₂PO₄, 250 mm NaCl, 2 mm DTT, pH 7.0. The ¹⁵N/¹³C-labeled UBL1 sample additionally contained 0.5 mm PMSF, 1 mm benzamidine, and 1 mm tris(2-carboxyethyl)phosphine.

NMR Spectroscopy and Structural Calculation

¹H-¹⁵N HSQC spectra for all C-USP7 constructs were recorded on 800 MHz (¹H) Agilent VNMRS spectrometer at 25 °C. All experiments for the UBL1 structural calculation were acquired on 600 and 800 MHz (¹H) Bruker Avance spectrometers at 25 °C. The data were processed with NMRPipe (29) and analyzed with Sparky (30) and CARA (31). The backbone and side-chain resonance assignments of the uniformly ¹⁵N/¹³C-labeled UBL1 domain were performed using standard two-dimensional ¹H-¹⁵N HSQC and ¹H-¹³C HSQC and three-dimensional HNCA, HNCO, HBHA(CO)NH, CBCA(CO)NH, HC(C)H-TOCSY, and (H)CCH-TOCSY experiments (32). Sequence-specific resonance assignment of the UBL1 was done using ABACUS software (33, 34). Nearly complete UBL1 NMR resonance assignment was obtained with 93.3% of all expected chemical shifts assigned. NMR distance restraints were obtained from three-dimensional ¹⁵N- and ¹³C-edited NOESY-HSQC experiments (32). H-bond restraints were added on the basis of NOE analysis. Backbone dihedral ϕ and ψ angle restraints were derived from the analysis of ¹⁵N, ¹HN, ¹Hα, ¹³Cα, ¹³Cβ, and ¹³CO chemical shifts using TALOS+ (35). Structures were calculated using CYANA (36). A total of 200 structures of UBL1 were calculated, and 20 structures with the lowest energy were selected and refined using CNS (37).

The backbone resonance assignments of the ¹⁵N/¹³C-labeled deuterated UBL12 construct in its free and ICP0-bound forms were performed using two-dimensional ¹H-¹⁵N TROSY and TROSY-based three-dimensional HNCA, HNCOCA, HNCO, HNCACO, HNCACB, and ¹⁵N-edited NOESY-HSQC (32) recorded on 800 MHz (¹H) Agilent VNMRS spectrometer at 25 °C. The data were processed with NMRPipe and analyzed with CcpNmr Analysis (38).

NMR Studies of Protein Dynamics

The backbone ¹⁵N relaxation experiments for the ¹⁵N-labeled UBL1 were performed at 25 °C on 500 MHz (¹H) Agilent VNMRS spectrometer as described elsewhere (39, 40). All experiments were performed on a C576S UBL1 mutant generated using the QuikChange kit (Agilent) to avoid slow cysteine-induced dimerization. ¹⁵N R₁ and R_1ρ relaxation rates were measured from a series of eight spectra recorded at different relaxation delays. Relaxation rates were extracted from exponential fits of peak intensities. ¹⁵N R₂ values were obtained from longitudinal R₁ and rotating-frame R_1ρ rates (41) measured at a spin-lock field strength of 1592.4 Hz. ¹⁵N{¹H} NOE experiment was carried out in an interleaved manner by recording two-dimensional ¹⁵N-¹H spectra with and without ¹H saturation period of 2.5 s using inter-scan delay of 8 s. Heteronuclear NOE values were calculated as ratios of peak intensities in corresponding two-dimensional ¹H–¹⁵N correlation spectra. Errors in NOE values were calculated based on peak intensities and the measured spectral noise levels.

NMR Binding Experiments

ICP0 binding to individual USP7 UBL domains was assessed by a series of titration experiments monitored by recording 800 MHz (¹H) ¹H-¹⁵N HSQC spectra of the domains. Peptide GPRKCARKTRH corresponding to ICP0 residues 617–627 was custom-synthesized (GenScript). The titrations were performed by gradual addition of the unlabeled peptide to ∼0.5 mm ¹⁵N-labeled UBL domain samples (up to 1:10 protein to peptide ratio). Both the wild-type UBL1 and C576S mutant constructs were tested, providing identical results. Frequency (chemical shift) perturbations were calculated for each amino acid residue as Δω_i = (Δω_N² + Δω_H²)^1/2, where Δω_N and Δω_H are ¹⁵N and ¹H frequency differences between ICP0-bound and free states, respectively. The obtained Δω_i values were mapped onto the surface of the crystal structure of the UBL12 tandem (PDB code 2YLM) (25).

Isothermal Titration Calorimetry

The affinity of USP7 UBL12/ICP0 interaction was determined by isothermal titration calorimetry (ITC). Measurements were performed with a Nano ITC instrument (TA Instruments) in a buffer containing 20 mm NaH₂PO, 100 mm NaCl, 2 mm β-mercaptoethanol, pH 7, at 25 °C. ICP0 peptide at a concentration of 686 μm was titrated into 85 μm UBL12. A total of 20 injections were made with 300-s time intervals in between. ITC data were analyzed with NanoAnalyze software (TA Instruments). Data fitting was performed using an “independent” model after correcting for the heat produced by ICP0 dilution.

In Vivo Studies

Cell Lines and Viruses

Vero and HFF-1 cells were purchased from the ATCC. HFF-1 cells were maintained in DMEM supplemented with 10% fetal bovine serum and used between passages 5 and 10. Vero cells were maintained in DMEM supplemented with 5% fetal bovine serum. Strain 17+ was used as wild-type HSV-1. Virus in1863 was derived from strain 17+ and was obtained from Chris Preston (MRC Virology Unit, Glasgow, Scotland, UK). This virus contains the lacZ gene under the control of the human cytomegalovirus promoter/enhancer inserted in the tk gene.

Growth Yield of HSV-1 on shUSP7 Cells

Lentivirus generation and virus infection were done as described previously (42). Briefly, the pLKO.1 system was used to package lentiviruses and deliver shRNA into target cells. HFF-1 cells were infected with lentiviruses expressing shRNA against GFP (GCAAGCUGACCCUGAAGUUCA) or USP7 targeting sequence (GGCAACCTTTCAGTTCACT) and selected with 2 μg/ml puromycin. 72 h post-lentiviral infection cells were infected with HSV-1 (in1863) at multiplicities of infection (m.o.i.) of 0.1 pfu/cell. Progeny virus was collected at 24 h post-infection, and titers were determined on Vero cells by staining with crystal violet or X-gal for β-galactosidase-positive plaques as described previously (42).

Western blot analysis was used to visualize USP7 and ICP0. Ku70 was used as a loading control. After lentiviral transfection, cells were infected with HSV-1 at an m.o.i. of 2 pfu/cell. Four hours post-infection, cells in 35-mm dishes were lysed in 2× SDS sample buffer (4% SDS, 20% glycerol, 100 mm Tris, pH 6.8, 100 mm DTT, 10% β-mercaptoethanol, 1× protease inhibitor mixture (Roche Applied Science), and 0.1% bromphenol blue) and boiled for 5 min. Proteins were resolved by SDS-PAGE and transferred to PVDF membranes. Membranes were blocked for 1 h in 5% nonfat dry milk dissolved in TBST. Primary antibodies were diluted in blocking solution and incubated overnight at 4 °C. Primary antibodies used include monoclonal mouse ICP0 (5H7) (1:1,000; Abcam), polyclonal rabbit USP7 (H200) (1:1000; Santa Cruz Biotechnology), and monoclonal mouse Ku70 (Ab-4) (1:5,000; NeoMarker).

Results

Isolated USP7 UBL Domains Can Be Studied Independently in Solution

The full-length USP7 as well as the C-USP7 have long represented a challenge for structural studies because of their rapid degradation during recombinant expression in E. coli (43). As a consequence, difficulties in C-USP7 production hampered investigation of its structure and function. The recent crystal structure of the isolated C-USP7 produced in insect cells (25) revealed the domain organization of the C-USP7 and confirmed that it consists of five ubiquitin-like domains. To produce stable constructs of the C-USP7 suitable for studies in solution, we have tested bacterial expression of all individual UBL domains and their combinations in E. coli. We found that the isolated UBL1 and UBL3 express well and result in stable soluble proteins. In contrast, UBL2, UBL4, and UBL5 are unstable and degrade rapidly when expressed on their own. However, the two-domain combinations UBL12 and UBL45 express well and are stable and soluble. These results are in agreement with the C-USP7 crystal structure, which shows extensive interactions between UBL1 and UBL2 as well as between UBL4 and UBL5. ¹H-¹⁵N HSQC NMR spectra of UBL1, UBL12, UBL3, and UBL45 are shown in Fig. 1B. High quality of spectra and good chemical shift dispersion suggest that isolated UBL domains and/or their combinations described above represent independently folding units that can be used for structural and functional studies.

Solution Structure of the USP7 UBL1 Domain

Fig. 2 shows solution NMR structure of the USP7 UBL1 domain (residues 537–664). According to secondary structure prediction obtained from the backbone ¹H, ¹⁵N, and ¹³C NMR chemical shifts using TALOS+ program (35), UBL1 adopts a characteristic ubiquitin-like β-grasp fold formed by β₁-β₂-α₃-3₁₀-β₃-β₄-α₄-α₅-β₅ elements (Fig. 2A, top panel). The bottom panel on Fig. 2A shows order parameters S² for the backbone amide groups of the domain predicted from NMR chemical shifts using the random coil index approach (44). High S² values of 0.8–0.9, indicative of limited backbone flexibility, were obtained for a majority of the residues. The exceptions are a linker connecting the first two helices with the first β-strand of the β-grasp fold and two large loops, loop I and loop II. The final ensemble of the 20 lowest energy structures (Fig. 2B) displays a root mean square deviation of 1.96 ± 0.44 Å for the backbone and 2.70 ± 0.38 Å for all heavy atoms (see Table 1 for structural statistics). As expected, the overall structure of the domain is well defined in the NMR ensemble with the exception of the two loops (Fig. 2B). The structure consists of a long kinked N-terminal α-helix (helices α₁ and α₂) followed by a β-grasp fold (Fig. 2, C and D). The α₃-helix is packed against an anti-parallel β-sheet (β₂-β₁-β₅-β₃-β₄) that forms a barrel-like structure (Fig. 2D). In this barrel, the β₄-strand is very short and is stabilized by a single hydrogen bond between the backbone amide group of Leu-638 and carboxyl of Leu-622 from the β₃-strand. The N-terminal helix α₁ does not belong to the ubiquitin-like fold and, in the context of the full-length USP7, connects C-USP7 with the catalytic domain of the enzyme.

FIGURE 2.

Solution NMR structure of the USP7 UBL1 (residues 537–664). A, top panel shows TALOS+derived probabilities of α-helix and β-sheet formation, marked as P(α) and P(β), respectively. Bottom panel shows random coil index-based backbone amide order parameters, S². B, backbone representation of the ensemble of 20 NMR lowest energy structures of the USP7 UBL1. C, amino acid sequence of the USP7 UBL1 domain with schematic representation of its secondary structural elements shown at the top. Helices are colored in red, and β-strands are shown in green. D, ribbon representation of the UBL1 structure with secondary structural elements and loops I and II labeled. E, superposition of solution (red) and crystal (blue) (PDB code 2YLM) structures of the UBL1. F, NOE connectivity plot of UBL1. Flexible loops I and II are labeled and shown in gray.

TABLE 1.

NMR structure determination statistics

NOE distance restraints
Short range (|i − j|< = 1)	1358
Medium range (|i − j|<5)	576
Long range (|i − j|> = 5)	1107
Total	3041
Dihedral angles (ϕ and ψ)	187
Hydrogen bonds	32
Deviation from experimental restraints
NOE (Å)	0.022 ± 0.003
Dihedral restraints (degrees)	1.757 ± 0.123
Deviation from idealized geometry
Bonds (Å)	0.019
Angles (°)	1.3
Ramachandran plot statistics
Most favored regions	77.2%
Additionally allowed regions	21.8%
Generously allowed regions	0.8%
Disallowed regions	0.2%
Root mean square deviation from mean structure (Å)
All residues
Backbone atoms	1.96 ± 0.44
Heavy atoms	2.70 ± 0.38
Residues in ordered regionsa
Backbone atoms	0.62 ± 0.09
Heavy atoms	1.25 ± 0.14

^a The following secondary structural elements were included as ordered regions in the root mean square deviation calculation: 539–548, 551–554, 556–570, 592–595, 602–613, 617–619, 621–624, 649–652, 658–663.

Although the sequence similarity of the USP7 UBL1 to ubiquitin is only 21%, it closely resembles a ubiquitin fold (PDB code 1UBQ) with the backbone root mean square deviation between the UBL1 and ubiquitin of 2.4 Å for regular secondary structural elements. Significant differences, however, are observed in the loop regions. Thus, the UBL1 loop I that connects the β₁- and β₂-strands (residues 571–591) as well as loop II between the β₃- and β₄-strands (residues 625–637) are notably longer than those of ubiquitin. The hydrophobic patch equivalent of the ubiquitin Ile-44 patch (45) is also present in UBL1 and is centered around Trp-623 (Fig. 2D).

Fig. 2E shows an overlay of the solution (red) and crystal (blue; PDB code 2YLM) structures of the UBL1 domain. The UBL1 NMR structure is in good agreement with the crystal structures of the entire C-USP7 (PDB code 2YLM) and the UBL12 tandem (PDB code 4PYZ) with the backbone root mean square deviation between NMR and crystal structures of 2.40 and 2.35 Å, respectively. The most significant difference is in the loop conformations. The long loop II connecting the β₃- and β₄-strands is poorly defined in the solution structure with only short and medium range (|i − j|<5) NOEs observed in this region (Fig. 2F). This is in contrast to the crystal structure where residues 625–635 form a type I β-hairpin. The position of the hairpin is stabilized by interaction with the UBL2 domain, including inter-domain salt bridges formed by residues Arg-628 and Asp-764, as well as Arg-634 and Glu-737. Similarly, position of the loop I connecting β₁- and β₂-strands (residues 571–591) is poorly defined in our solution structure, whereas in the crystal structure it is stabilized by several inter-domain hydrogen bonds with the UBL2 residues. Additionally, in the crystal structure, relative position of the two long loops is constrained by hydrogen bond between the backbone HN group of Lys-633 (loop II) and OD2 group of Asp-582 (loop I), although in the NMR ensemble the loops sample multiple conformations. Overall, the observed differences between the two structures may result from additional domains present in the x-ray structure and the fact that NMR is sensitive to protein dynamics in solution.

Backbone Dynamics of the USP7 UBL1 Domain

To confirm flexible conformations of the loops, we have investigated the extent of conformational dynamics of the UBL1 domain using the backbone ¹⁵N NMR relaxation measurements, including ¹⁵N R₁ and R₂ rates and heteronuclear ¹⁵N{¹H} NOE values (39–41). These data report on Brownian rotational diffusion of a protein and its conformational flexibility on the pico- to nanosecond time scales. ¹⁵N R₁ and R₂ relaxation rates and ¹⁵N{¹H} NOEs suggest that the UBL1 is a rigid molecule with increased sub-nanosecond time scale flexibility of the two long UBL1 loops, as evidenced by a decrease in ¹⁵N{¹H} NOE values, lower R₂ rates, and elevated R₁ rates for amino acid residues located in the loops I and II (Fig. 3). Additionally, relaxation rates and NOEs suggest that the N-terminal α-helix that does not belong to the β-grasp fold is also highly dynamic on the sub-nanosecond time scale.

FIGURE 3.

Backbone dynamics of the UBL1 from ¹⁵N relaxation. A, ¹⁵N R₁ and R₂ relaxation rates, and ¹⁵N{¹H} heteronuclear NOE values shown as a function of the UBL1 residue number. Secondary structural elements are shown at the bottom. B, mapping of heteronuclear 1-NOE values onto the UBL1 structure. 1-NOE values are mapped as a color gradient (blue to magenta) and ribbon radius. Dynamic regions correspond to intense magenta color and a thicker ribbon. All experimental relaxation data were acquired at 500 MHz (¹H) and 25 °C.

USP7 Is Required for the Efficient HSV-1 Infection in HFF-1 Cells

As a first step toward understanding the mechanism of substrate recognition by the C-USP7, we have characterized its interaction with the ICP0 E3 ligase from HSV-1. ICP0 was the first discovered and remains the best studied substrate of the USP7 that interacts exclusively with the enzyme's C terminus (19). ICP0 is a 775-amino acid residue-long immediate-early protein that is expressed immediately after infection. Although ICP0 does not interact with DNA directly, it acts as a promiscuous activator for all three temporally regulated kinetic classes of viral genes (46). It was previously shown that the ICP0 self-ubiquitination promotes its own degradation; however, the formation of a complex with cellular USP7 stabilizes ICP0 and rescues it from proteasomal degradation (47, 48). Mutations that abolish the USP7 binding lead to ICP0 destabilization during HSV-1 infection in U2O2 cells (48). Moreover, treatment of HeLa cells with siRNA against USP7 leads to a defect in ICP0 accumulation and reduced expression of many ICP0 target genes, including ICP4 and UL42 (49). Furthermore, ICP0 interaction with USP7 causes migration of the latter from the nucleus to the cytoplasm where it inhibits NF-κB-dependent inflammatory cytokine response to protect HSV-1 from innate immunity (50).

Altogether, these data suggest that USP7 not only plays an essential role in regulation of ICP0 levels in the infected cell, but it also is required for establishment of successful HSV-1 infection. This makes the USP7/ICP0 binding interface an attractive target for the development of antiviral therapeutics. Therefore, we have explored the effect of USP7 knockdown on the efficiency of HSV-1 infection. Although ICP0 is not essential for virus replication in cultured cells, ICP0-null mutant viruses grow poorly at low m.o.i. Because this effect is cell type-dependent, we have utilized limited-passage human diploid fibroblasts since they are sensitive to the presence of ICP0 (46). HFF-1 cells were infected with lentiviruses expressing shRNA against either USP7 or GFP (control) followed by HSV-1 infection at an m.o.i. of 2 pfu/cell. The knockdown of USP7 was confirmed by Western blot (Fig. 4C). As expected, ICP0 levels were severely decreased in cells lacking USP7 compared with cells expressing shRNA against GFP. In addition, cells were infected with HSV-1 at a lower m.o.i. of 0.1 pfu/cell. Progeny virus was collected 24 h post-infection, and formation of plaques was monitored on Vero cells (Fig. 4, A and B). We observed that viral growth was reduced 100-fold in cells expressing shRNA against USP7 compared with control cells treated with shRNA against GFP. These results suggest that the presence of USP7 in the cell and its interaction with ICP0 are essential for establishment of successful lytic infection at a low m.o.i. in HFF-1 cells.

FIGURE 4.

USP7 is required for successful establishment of HSV-1 lytic infection. HFF-1 cells were infected with lentiviruses expressing shRNA against USP7 (shUSP7) to down-regulate cellular USP7. shRNA against GFP (shGFP) was used as a control. A and B, after selection, knockdown cells were infected with HSV-1 at an m.o.i. of 0.1 pfu/cell. Progeny virus was collected at 24 h post-infection, and titers were determined on Vero cells by staining with either crystal violet (A) or X-gal for β-galactosidase-positive plaques (B). B, values correspond to the average of three independent experiments, and error bars correspond to 1 S.D. C, efficiency of USP7 knockdown and ICP0 stability were tested by Western blot analysis. USP7 knockdown cells were infected with HSV-1 at an m.o.i. of 2 pfu/cell, and cell lysates were prepared at 4 h post-infection and subjected to Western blot analysis for ICP0 and USP7. Ku70 serves as a loading control.

The First Two USP7 UBL Domains (UBL12) Are Responsible for Interaction with ICP0

The minimal ICP0 region required for interaction with USP7 was previously defined by Everett et al. (47) as residues 619–626. This short peptide contains several lysine and arginine residues, which make it highly positively charged. The region of USP7 responsible for interaction with ICP0 was roughly defined using limited proteolysis to reside within residues 599–801 (19). This region contains a part of UBL1, the entire UBL2, and a part of the UBL3 domains. To determine the domain(s) of C-USP7 responsible for interaction with ICP0, we have performed a series of NMR binding experiments. Isolated ¹⁵N-labeled UBL1, UBL12, and UBL3 domains of the USP7 were gradually titrated with the unlabeled ICP0 peptide (residues ⁶¹⁷GPRKCARKTRH⁶²⁷), and binding-induced changes in peak positions in ¹H-¹⁵N HSQC spectra of the domains were monitored. As seen in Fig. 5, B and C, no peak shifts were observed for the UBL1 and UBL3, indicating that these domains alone are not sufficient for interaction with the ICP0 peptide. In contrast, the addition of ICP0 peptide to the ¹⁵N UBL12 caused progressive changes in the positions and intensities of a number of peaks in its ¹H-¹⁵N HSQC spectrum indicative of specific ICP0 binding (Fig. 5A).

FIGURE 5.

NMR and ITC analysis of the USP7 UBL domain interactions with the ICP0(617–627) peptide. Overlay of ¹H-¹⁵N HSQC spectra of the UBL12 (A), UBL1 (B), and UBL3 (C) domains before (red) and after addition of the unlabeled ICP0 peptide (residues 617–627) to a final protein/peptide ratio of 1:10 (blue). A, signals of UBL12 with chemical shift perturbations over 100 Hz are labeled. Among these, the peaks corresponding to residues located on the ICP0-binding interface are labeled with asterisks. The bottom panel shows changes in line shapes for selected UBL12 peaks upon ICP0 binding. D, ITC profiles for UBL12 binding to ICP0. Left panel shows heat change upon ligand addition; right panel shows an integrated ITC isotherm and its best fit to an independent site model.

In the course of titration with ICP0, the peaks in the NMR spectrum of UBL12 do not move gradually, but rather disappear and then show up in the new positions in the spectrum, indicative of slow on the NMR time scale binding process. Therefore, to measure UBL12-ICP0 binding affinity and determine thermodynamic parameters for this interaction, we have employed isothermal titration calorimetry (ITC) (Fig. 5D). The results indicate that UBL12 binds ICP0 in a 1:1 stoichiometry. The best fit of the titration curve was obtained with an independent site model with dissociation constant (K_D) of 14.6 ± 1.3 μm and enthalpy (ΔH) of −24.5 ± 0.7 kcal/mol, resulting in entropy (ΔS) of −60.2 cal/(mol K) and Gibbs free energy (ΔG) of −6.6 kcal/mol at 25 °C. High ΔH value suggests that reaction is enthalpy-driven with primary contributions to the complex stabilization likely resulting from electrostatic interactions and/or hydrogen bonds.

Mapping of UBL12-ICP0-binding Site

As seen in Fig. 5A, a large number of peaks have shifted in the ¹H-¹⁵N HSQC spectrum of the USP7 UBL12 as a result of ICP0 peptide binding. Because of slow on the NMR time scale binding, the backbone resonances of the UBL12 in complex with ICP0 cannot be assigned by tracing peak shifts in the UBL12 spectrum during the titration. Therefore, to quantify ICP0-induced changes in peak positions and thus identify the UBL12 amino acid residues responsible for ICP0 recognition, we have assigned the backbone resonances of the free and ICP0-bound forms of the UBL12.

Fig. 6A summarizes the extent of UBL12 chemical shift assignment: circles below the amino acid sequence correspond to assigned peaks in ¹H-¹⁵N HSQC spectra of the free and ICP0-bound UBL12 constructs. UBL1 and UBL2 portions of UBL12 are colored in blue and green, in Fig. 6A, respectively. A total of 74% of expected NMR resonances of free UBL12 and 82% resonances of ICP0-bound UBL12 have been assigned. The remaining peaks were broadened beyond detection. The residues with missing assignments in either free or ICP0-bound UBL12 are marked by asterisks and arrows above the amino acid sequence in Fig. 6A. Most of these residues are missing in the spectrum of free UBL12 and appear only after ICP0 binding. Such behavior points to changes in the UBL12 conformation and dynamics as well as changes in chemical environment of the nuclei on the interaction interface associated with the substrate recognition.

FIGURE 6.

Analysis of ICP0 binding to the USP7 UBL12 tandem. A, completeness of the backbone assignment for the free and ICP0-bound UBL12. Here and later UBL1 and UBL2 domains are colored in shades of blue and green, respectively. Circles below the protein sequence represent amino acid residues with assigned NMR resonances in ¹H-¹⁵N HSQC spectra of the free (light circles) and ICP0-bound UBL12 (dark circles). Open spaces indicate residues with unassigned amide peaks. Asterisks indicate UBL12 residues with assigned amide peaks in the bound state only, and arrows indicate residues with assigned amide peaks in the free state only. B, ribbon representation of the UBL12 (PDB code 2YLM) (25). C, mapping of the frequency differences between the free and ICP0-bound UBL12 Δω_i = (Δω_N² + Δω_H^2)1/2 on the UBL12 surface. Color gradient corresponds to Δω values, with larger changes shown by more intense color. D, mapping of the UBL2 residues located on the UBL1/UBL2 interface and affected by ICP0 binding. Same as in C (top view) but rotated about z axis by 90°; for clarity, UBL1 is shown as orange ribbon. E, close-up view of the UBL12 ICP0-binding interface. F, per residue amide frequency differences between the free and ICP0-bound states of the UBL12 (Δω, Hz) as a function of residue number. Residues with peaks missing in one of the two spectra (free or bound) are shown as bars with the maximum Δω of 650 Hz to indicate that these residues are sensitive to ICP0 binding. Prolines and residues with missing amide group assignment in both spectra are shown as empty spaces. Secondary structure elements are shown at the top.

ICP0 binding led to substantial frequency (chemical shift) changes for the vast majority of the UBL12 amide resonances (Fig. 5A, 6F) with largest perturbations (>150 Hz) observed for the residues Gly-631, Leu-638, Val-685, Leu-699, Ile-709, Ser-710, Ser-752, Leu-757, and Asp-758. The complex formation noticeably improved the quality of the spectrum, suggesting that ICP0 binding stabilizes the UBL12 tandem (Fig. 5A, bottom panel). As a result, a number of intense peaks appeared in the UBL12 spectrum upon ICP0 binding. Although the backbone amide resonances for 171 of 230 non-proline residues were observed for the free protein, 25 additional peaks were assigned for the complex (Fig. 6A). The vast majority of these new peaks correspond to residues located either on the UBL1/UBL2 interface or in its close proximity (Glu-572, Phe-575, His-578, Gln-579, Asn-581, Asp-582, Ile-620, Gln-626, Arg-628, Asn-630, Thr-632, Glu-663, Thr-664, Val-665, Met-686, Asn-700, Tyr-701, Tyr-706, and Val-738) (Fig. 6D). In addition, eight peaks in the ¹H-¹⁵N HSQC spectrum of the UBL12 disappeared upon ICP0 binding, pointing to changes in the UBL12 conformation and/or dynamics caused by the complex formation. These peaks correspond to residues Asp-680, Lys-681, Asp-682, Gly-763, Asp-764, and Ile-765 located on the UBL1/UBL2 interface and residues Glu-759 and Leu-760 located in the loop between β₄- and β₅-strands of the UBL2.

Overall, mapping binding-induced frequency (chemical shift) changes onto the UBL12 structure (25) identified residues sensitive to ICP0 binding in both UBL1 and UBL2 domains. The regions of the UBL1 and UBL2 with NMR peaks affected by ICP0 addition are shown on the protein surface in Fig. 6, C and D. The UBL1 residues exhibiting pronounced frequency (chemical shift) changes are mainly located in the loops I and II. The residues of UBL2 affected by ICP0 binding are located in the two distinct regions. The first region includes a hydrophobic patch formed by residues in strands β₁, β₂, β₃, and β₅ of the UBL2 β-sheet. This face of the UBL2 domain makes extensive contacts with the UBL1, which protects this patch from solvent exposure (Fig. 6D). The second region is solvent-exposed and includes residues from the two loops as follows: the UBL2 loop connecting β₂-strand with the following α-helix, and the loop connecting β₄ and β₅ strands (Fig. 6, C and E). These loops form a negatively charged cluster on the UBL2 surface, which provides a binding interface for the positively charged ICP0 peptide.

Discussion

Because of USP7 involvement in maintenance of several important tumor suppressors and key viral proteins, it has emerged as a potential therapeutic target for treatment of cancer and infections caused by DNA viruses (51). Therefore, the mechanisms of USP7 specificity toward its diverse substrates are of significant interest.

Although functions of the USP7 N-terminal TRAF and catalytic domains were previously characterized, the functions of its UBL domains remain largely unknown. Roughly, UBLs within the USP family of proteins can be divided into three groups as follows: N-terminal, C-terminal, or embedded in the USP catalytic core (52). The USP7 UBL domains belong to the third group of the C-terminal UBLs. Previous studies revealed that UBLs of USP7 enhance its enzymatic activity, because even small truncations of the extreme C terminus dramatically decrease the USP7 catalytic activity (25, 28). Furthermore, it was recently shown that the UBL domains can function as a binding platform for several USP7 substrates. However, the precise location of the C-USP7 substrate-binding sites remained unknown (9, 19, 28).

USP7 is unique within the USP family because, unlike other family members, it contains a tandem array of the five UBL domains. As a consequence of the large size of the USP7 C terminus, it is challenging to study all five tandem UBL domains together. Here, we show that this complex system can be simplified by the isolation of stable individual UBL domains and/or constructs containing two consecutive UBL domains. Our NMR data reveal that these constructs can be studied in isolation in solution, providing new insights into the C-USP7 structure, dynamics, and substrate specificity. Although there are two available x-ray crystal structures of the C-USP7 (PDB codes 2YLM and 4PYZ), these structures provide little information about protein dynamics. In this study we focused on the UBL1 domain and UBL12 tandem. We have done the following: (i) determined three-dimensional NMR structure of the UBL1 domain and characterized its dynamic properties, (ii) narrowed down the ICP0-binding region of the USP7 to the UBL12 domains, and (iii) obtained high resolution NMR mapping of the USP7-binding site for ICP0.

Once inside the cell, HSV-1 encounters a hostile environment created by host proteins that are intrinsically antiviral. HSV-1 encodes proteins such as ICP0 intended to inactivate cellular antiviral mechanisms (46). The interaction between ICP0 and USP7 is essential to prevent ICP0 degradation during the infection, and in this study, we have structurally and functionally characterized this interaction. As a first step, we have investigated the effect of USP7 ablation on the efficiency of HSV-1 lytic infection. We utilized shRNA to generate USP7 knockdown cells and demonstrated that in cells lacking USP7 the growth of virus is severely reduced. These results suggest that the USP7/ICP0 interaction is important for the establishment of effective lytic HSV-1 infection in HFF-1 cells.

Next, we used solution NMR to structurally characterize the ICP0/USP7 interaction, and we have shown that USP7 binds ICP0 via its first two C-terminal UBL domains, providing evidence that the USP7 UBL domains function as a substrate interacting platform. The ICP0 peptide used in this study was previously identified as a minimal USP7-binding region of ICP0 (47). This peptide is composed of 11 amino acid residues, six of which are positively charged and three are polar (Fig. 7B). Thus, of the two USP7 regions affected by ICP0 binding, the one located at the UBL2 β-sheet is unlikely to directly interact with ICP0 because it consists of mainly hydrophobic residues buried on the UBL1/UBL2 interface. In contrast, the second region encompassing the UBL2 loops, one between the β₂-strand and the following α-helix and the other between the β₄ and β₅ strands, has a negatively charged surface and is more likely to directly bind positively charged ICP0 peptide. High enthalpy of complex formation (−24.5 ± 0.7 kcal/mol) measured by ITC provides further evidence of the electrostatic nature of UBL12/ICP0 interaction.

FIGURE 7.

C-terminal region of or the ICP0 may contain a structured domain. A, sequence alignment of the HSV-1 ICP0 (residues 604–775) and a number of its viral orthologues performed in ClustalW (56). Viruses are human herpesvirus 1 (HSV1), chimpanzee α-1 herpesvirus, human herpesvirus 2 (HSV2), Cercopithecine herpesvirus 1 (CeHV1), Cercopithecine herpesvirus 16 (CeHSV16), macropodid herpesvirus 1 (MaHV1), and saimiriine herpesvirus 1 (SHV1). Residues are colored according to conservation scores calculated using ConSurf server (57, 58). Secondary structure elements predicted in Jpred (55) for the HSV-1 ICP0 are shown at the top. Arrows above the alignment indicate residues critical for USP7 binding identified in previous mutagenesis analysis (47). B, HSV-1 ICP0 peptide (residues 617–627) shown in a helical wheel projection created using EMBOSS Pepwheel program. Hydrophobic residues are shown as gray spheres, polar residues as diamonds, and basic residues as blue spheres.

NMR chemical shift mapping revealed that the binding of the two proteins is likely mediated by electrostatic interactions. This is in agreement with previous mutational analysis of ICP0, which identified Arg-619, Lys-620, Lys-624, and Arg-626 as residues critical for interaction with the USP7 (Fig. 7A) (47). Interestingly, although the UBL1 domain alone does not interact with ICP0 (Fig. 5B), it exhibits extensive binding-induced chemical shift changes in the context of the UBL12 construct (Fig. 6F). Notably, UBL1 residues involved in ICP0 binding belong to the two long flexible loops located in close proximity to the UBL1-UBL2 interface, supporting the notion that these two domains may function in tandem. The presence of UBL2 may constrain conformation of the UBL1 flexible loops, as seen in crystal structures of the C-USP7 UBL domains. Overall, our data suggests that UBL12 may undergo micro- to millisecond opening/closing events, resulting in the observed line broadening and/or disappearance of peaks on the interface of UBL1 and UBL2 domains. As evident from chemical shift mapping, most of the UBL12-binding site for ICP0 is located on the UBL2 surface with an additional participation of residues from loop II of the UBL1. We speculate that the substrate binding may lock the two domains in a closed conformation, thus limiting micro- to millisecond conformational sampling and quenching exchange contributions to transverse relaxation. This model could explain chemical shifts changes and line narrowing on the inter-domain interface observed upon ICP0 binding.

The HSV-1 ICP0 has never been structurally characterized, although it was shown to contain an N-terminal RING domain similar to one from an immediate-early protein of equine herpesvirus (53, 54). The USP7-binding motif of ICP0 is located within the molecule's C terminus (residues 619–626). We used Jpred (55) to predict the secondary structure of the HSV-1 ICP0 and found that its C-terminal region is predicted to contain a structured domain with α-α-β-β-α-β-β arrangement (Fig. 7A). Furthermore, we have compared the HSV-1 ICP0 protein with its orthologues from other Alphaherpesvirinae subfamily viruses using SIB Blast followed by multiple sequence alignment in ClustalW (56) and conservation score calculation using ConSurf server (57, 58), and found that the ICP0 sequence has two highly conserved regions. The first region includes the N-terminal RING domain characteristic of E3 ubiquitin ligases, and the second contains a yet uncharacterized C-terminal domain (CTD). Fig. 7A shows a multiple sequence alignment of the ICP0 CTD. Remarkably, the USP7-binding motif (residues 619–626) is one of the best conserved regions within the ICP0 C terminus, and it is predicted to form an α-helix. According to the helix wheel projection, this helix is amphipathic (positively charged on one side and neutral on the other), which may facilitate its interaction with a negatively charged cluster on the UBL2 surface (Fig. 7B). Other predicted secondary structural elements of the ICP0 CTD are also conserved, supporting the notion that ICP0-like proteins harbor a structured CTD in addition to the N-terminal RING domain. High amino acid conservation in the ICP0 region involved in USP7 binding implies that ICP0 interaction with the USP7 is not unique to HSV-1 but may represent a common feature shared by other members of the herpesvirus family.

The fact that the five nonhomologous USP7 UBL domains can interact with multiple USP7 targets suggests that the UBL domains serve as a versatile binding platform and endow the enzyme with specificity to its diverse substrates. However, until now, none of the C-USP7 substrate-binding sites has been characterized at high resolution. In this work, for the first time, we have structurally and functionally characterized the interaction of the C-USP7 with its first identified target, the HSV-1 ICP0 protein. Our results, along with future studies of other C-USP7 substrate-binding sites, may unravel determinants of the USP7 specificity toward its substrates and provide a structural basis for the future development of new therapeutic strategies to prevent lifelong HSV-1 infection and virus expansion among the human population.

Author Contributions

A. K. P. performed all experiments and data analysis associated with USP7-Icp0 binding and wrote the manuscript. K. N. M. and S. K. W. performed and analyzed in vivo experiment shown in Fig. 4. I. B., S. D. P., and C. H. A. contributed to NMR structural determination of UBL1 domain. A. K. P. and D. M. K. performed and analyzed NMR dynamics experiments. All authors reviewed the results and approved the final version of the manuscript.