A PhoPQ-Regulated ABC Transporter System Exports Tetracycline in Pseudomonas aeruginosa

Abstract

Pseudomonas aeruginosa is an important human pathogen whose infections are difficult to treat due to its high intrinsic resistance to many antibiotics. Here, we show that the disruption of PA4456, encoding the ATP binding component of a putative ATP-binding cassette (ABC) transporter, increased the bacterium's susceptible to tetracycline and other antibiotics or toxic chemicals. Fluorescence spectroscopy and antibiotic accumulation tests showed that the interruption of the ABC transporter caused increased intracellular accumulation of tetracycline, demonstrating a role of the ABC transporter in tetracycline expulsion. Site-directed mutagenesis proved that the conserved residues of E170 in the Walker B motif and H203 in the H-loop, which are important for ATP hydrolysis, were essential for the function of PA4456. Through a genome-wide search, the PhoPQ two-component system was identified as a regulator of the computationally predicted PA4456-4452 operon that encodes the ABC transporter system. A >5-fold increase of the expression of this operon was observed in the phoQ mutant. The results obtained also show that the expression of the phzA1B1C1D1E1 operon and the production of pyocyanin were significantly higher in the ABC transporter mutant, signifying a connection between the ABC transporter and pyocyanin production. These results indicated that the PhoPQ-regulated ABC transporter is associated with intrinsic resistance to antibiotics and other adverse compounds in P. aeruginosa, probably by extruding them out of the cell.

INTRODUCTION

Pseudomonas aeruginosa is capable of infecting a large number of hosts, such as humans, insects, plants, and animals (1, 2). It is a leading cause of nosocomial infections in humans (3). Infections caused by P. aeruginosa are very difficult to treat, and those of a chronic nature, such as infections in the lungs of cystic fibrosis patients, are almost impossible to eradicate (2). The difficulties associated with antipseudomonad therapy are mainly due to the pathogen's high intrinsic or adaptive resistance to many antibiotics. P. aeruginosa possesses an outer membrane of low permeability, which is about 12 to 100 times lower than that in Escherichia coli (2). The high intrinsic resistance of P. aeruginosa also depends on other mechanisms, such as the intrinsic or induced expression of efflux pumps, particularly the nodulation cell division (RND) systems MexAB-OprM and MexXY-OprM, and adaptive production of drug degradation enzymes, such as AmpC β-lactamase (4, 5). Also of note, metabolic versatility allows P. aeruginosa to adapt to a wide range of environments, including antibiotic stress (6–8). Adaptive resistance occurs as a result of the continuing presence of either an antibiotic or other environmental stimuli. Overexpression of genes encoding β-lactam and efflux pump can be triggered through regulatory genes (9). Interestingly, it has been demonstrated that the interplay between chromosomal β-lactamase and efflux systems or between efflux pumps also plays an important role in intrinsic resistance to antibiotics in P. aeruginosa (10, 11). Systemic analysis of the resistome of P. aeruginosa is needed, which will provide an opportunity for understanding the complex phenomenon of intrinsic antibiotic resistance from a broader, global point of view.

Recently, a number of resistomic studies have been carried out in P. aeruginosa (12–18). Genes of different functional classes have been identified to associate with intrinsic resistance against different types of antibiotics. A complex resistome accounts for the pathogen's ability to resist many antibiotics. Thorough characterization of these genes in the resistome thus becomes an important next step.

ATP-binding cassette (ABC) transporter systems constitute one of the largest superfamilies in living organisms and all ABC systems share a highly conserved domain which binds and hydrolyzes ATP (19, 20). ABC systems couple the energy of ATP hydrolysis to play a large variety of biological roles, encompassing not only substrate transport (20), but also non-transport-related processes, such as translation (21), elongation, and DNA repair (22). In some antibiotic-producing or drug-resistant bacteria, ABC systems are responsible for the efflux of antibiotics (23, 24). In P. aeruginosa, ABC systems are key participants in many process, such as siderophore synthesis or transfer (25), lipopolysaccharide secretion (26), the acquisition of heme and hemoglobin (27), orthophosphate uptake (28), homogentisic acid transport (29), and the acquisition of zinc (30). In contrast to the many RND efflux pumps, ABC systems associated with antibiotic susceptibility are less common in P. aeruginosa. To our knowledge, only two such systems are reported: one probable ABC transporter system was identified to mediate fluoroquinolone resistance (31), and another named NppA1A2BCD is required for uptake of peptidyl nucleoside antibiotics in Pseudomonas aeruginosa PA14 (32).

Our previous data showed that a transposon insertion at the ATP binding component of a novel putative ABC transporter system in P. aeruginosa affected antibiotic susceptibility (17). In the present study, the function of the putative ABC transporter in intrinsic resistance has been investigated. We present data showing that the increased sensitivity to tetracycline in the ABC transporter mutant was due to increased intracellular tetracycline accumulation. The evidence indicating the PhoPQ is a transcriptional regulator of the ABC system is also discussed. Our data revealed a new ABC transporter system that contributes to intrinsic antibiotic resistance in P. aeruginosa, probably by exporting the drugs out of the cell.

MATERIALS AND METHODS

Bacterial strains, plasmids, and culture conditions.

The bacterial strains, plasmids, and oligonucleotide primers used in this study are listed in Table 1. All strains were grown at 37°C in Luria-Bertani (LB) broth unless otherwise stated. Mueller-Hinton broth was used to determine MIC. Pseudomonas isolation agar (PIA; Beijing Land Bridge Tech., Ltd., China) medium was used to isolate the P. aeruginosa mutants. When required, 10% sucrose was supplemented to counterselect pEX18Ap insertion. BM2-glucose minimal medium containing 2 mM (high) or 20 μM (low) MgSO₄ was used in experiments testing the effects of Mg²⁺ concentrations (33). Antibiotics were used at the following concentrations: for E. coli, 100 μg/ml ampicillin (Amp), 15 μg/ml tetracycline (Tet), 15 μg/ml gentamicin (Gen), and 50 μg/ml kanamycin (Kan); for P. aeruginosa on PIA, 300 μg/ml Tet and 150 μg/ml Gen; and for P. aeruginosa in LB broth, 500 μg/ml carbenicillin (Car) and 300 μg/ml trimethoprim (Tmp).

TABLE 1.

Strains, plasmids, and oligonucleotide primers used in this study

Strain, plasmid, or primer	Genotype, characteristics, or sequence (5′-3′)a	Source or reference
Strains
P. aeruginosa
PAO1	Wild type	45
PA4456M	Genr; P. aeruginosa with PA4456 gene insertion mutant	This study
PA4456Mcom	Genr; PA4456 M complemented strain; PA4456M attB::PA4456-4452	This study
ΔphoQ	PAO1 with partial deletion of phoQ; unmarked	This study
PA44562pro-lux-PAO1	CTX-PA44562pro-lux integrated into P. aeruginosa chromosome; Tetr	This study
PA44562pro-lux-ΔphoQ	CTX-PA44562pro-lux integrated into ΔphoQ chromosome; Tetr	This study
E. coli
DH10B	F− mcrA Δ(mrr-hsdRMS-mcrBC) ϕ80lacZΔM15 ΔlacX74 recA1 endA1 araD139 Δ(ara leu)7697 galU galK λ− rpsL nupG	Invitrogen
SM10λpir	Kanr; mobilizing strain, RP4 integrated in the chromosome	Invitrogen
Plasmids
pEX18Ap	Ampr; oriT+ sacB+ gene replacement vector with MCS from pUC18	35
pZ1918	Source plasmid of Genr cassette	37
pBT20	Ampr Genr: mini-TnM delivery vector	71
pRK2013	Broad-host-range helper vector; Tra+; Kanr	38
pMS402	Expression reporter plasmid carrying the promoterless luxCDABE; Kanr Tmpr	37
pKD44562	pMS402 containing PA4456-4452 operon promoter region; Kanr Tmpr	This study
CTX6.1	Integration plasmid origins of plasmid mini-CTX-lux; Tetr	37
CTX-PA44562pro-lux	Integration plasmid, CTX6.1 with a fragment of pKD44562 containing PA4456-4452 promoter region and luxCDABE gene; Kanr Tetr	This study
pFLP2	Ampr; source of Flp recombinase	35
pAK1900	E. coli-P. aeruginosa shuttle cloning vector	72
mini-CTX1	Tetr; integration plasmid	39
mini-CTX1-44562	3.3 kb, including the promoter of PA4456-4452, was ligated into mini-CTX1	This study
pEX4456	Ampr; ligation of a 2-kb EcoRI and XhoI PCR fragment into the same site of pEX18Ap	This study
pEX4456lacZ	Ampr Genr; ligated the BamHI-digested lacZ fragment from pZ1918 into pEX4456	This study
pAK44562	3.3 kb, including the promoter of PA4456-4452, was ligated into pAK1900	This study
pAK44564	2.4 kb, including the promoter of PA4456-4454, was ligated into pAK1900	This study
pAK44562(E170A)	pAK44562 with E170 residue was substituted to A	This study
pAK44562(H203A)	pAK44562 with H203 residue was substituted to A	This study
pAK44562(E170A,H203A)	pAK44562 with both E170 and H203 residues were substituted to A	This study
pAK1180	phoQ, including the promoter, was ligated into pAK1900	This study
Primers
P4456knock sense	GCGAATTCCTTCCGAGGTCGG	This study
P4456knock anti	TCTACCGCGTCGCGCTCG	This study
P44562c sense	TATGAATTCTGCTGACGCTTGACCGG	This study
P44562c anti	CGGGTACCTTGACGAAATCGTCGC	This study
P4456-52 sense	ATAGCATGCGGCTCTTAACGTCTTCGG	This study
P4456-52 anti	GTGTCTAGATGAATCCAAGCTGAACGG	This study
P4456-54 sense	ATAGCATGCGGATACGGTCGAGAGTGG	This study
PlacZ	AGATCGCACTCCAGCCAG	This study
P1	GGCCACGCGTCGACTAGTACNNNNNNNNNNGATAT	This study
P2	GGCCACGCGTCGACTAGTAC	This study
P7-1	CTAACAATTCGTTCAAGCCG	This study
P7-2	GGATGCGTCTAAAAGCCTGC	This study
H203 anti check	CTCGGCATCACCAGCATCG	This study
H203 sense check	TATAGATGTAGTCGGCGATGCTGG	This study
H203 anti	GTCTCGGCCAGGTCAGCGGAAACCACGATGCT	This study
H203 sense	AGCATCGTGGTTTCCGCTGACCTGGCCGAGAC	This study
E170 anti check	GAGCTTTCCGGCGGCATG	This study
E170 sense check	GATCAGGCGCACCAGGACG	This study
E170 anti	CCCCACGAACGGCGCGTCGTAGAGCAG	This study
E170 sense	CTGCTCTACGACGCGCCGTTCGTGGGG	This study
PA1180 sense	ATAGTCGACAATACCTCATGCGGCATC	This study
PA1180 antisense	ATAGCATGCGCCAGCCGAACAGAC	This study

^aRestriction sites are underlined. Bases indicated in boldface are mutation sites. Tmp^r, trimethoprim resistance; Gen^r, gentamicin resistance; Kan^r, kanamycin resistance; Tet^r, tetracycline resistance; Amp^r, ampicillin resistance.

DNA manipulation techniques.

Preparation of genomic and plasmid DNA, restriction enzyme digestion, and agarose gel electrophoresis were carried out using standard methods (34). AxyPrep plasmid preparation kit (Axygen Biosciences, Inc.) was used for plasmid isolation. DNA restriction fragments were extracted from the gels by utilizing a gel extraction kit (Zymo). Restriction enzymes and T4 DNA ligase were purchased from New England Biolabs and used as recommended by the supplier. Taq DNA polymerase and a high-fidelity Phusion PCR kit were purchased from Thermo Scientific and used as recommended by the supplier.

Mutant construction.

PA4456 was interrupted by using chromosomal replacement (35). A 2-kb DNA fragment containing PA4456 (from base pair 4987379/4989416 on the P. aeruginosa chromosome) (36) was amplified by PCR using the primers PA4456knock sense and PA4456knock anti and then cloned into pEX18Ap, which was digested by SalI and EcoRI. The resulting plasmid was designated pEX4456. A 4.238-kb fragment of pZ1918 containing the lacZ, together with the Gen resistance (Gen^r) determinant was ligated into BamHI-digested pEX4456 to create pEX4456lacZ. It was then transferred into P. aeruginosa by triparental mating with the helper plasmid pRK2013 (37, 38). The PA4456 insertion mutant was selected in the presence of 10% sucrose and Gen. The mutant was confirmed by PCR using the special primer (PlacZ) and sequencing the PCR product.

To construct the phoQ unmarked deletion mutant, the DNA fragment containing phoQ was amplified using the primers PA1180 sense and PA1180 antisense. The PCR product was then ligated into pEX18Ap vector digested with SphI and SalI. A 910-bp DNA fragment within the PCR product was subsequently deleted by digesting with PstI. The religated plasmid was used to generate phoQ deletion mutant using triparental mating (37, 38). The correct mutant was verified by PCR.

Complementation of PA4456 knockout mutant.

To circumvent the use of antibiotic selection during the complementation experiments, the whole PA4456-4452 operon was integrated into the attB site on the chromosome using the mini-CTX1 vector (39). The entire gene was PCR amplified by a high fidelity PCR kit using the primers PA44562c sense and PA44562c anti. The product was ligated into mini-CTX1 to generate mini-CTX1-44562, which was transferred into E. coli SM10λpir. Transfer of mini-CTX1-44562 into the PA4456M was carried out by a biparental mating (40). Integrants containing the whole plasmid vector at the attB site of the P. aeruginosa genome were selected on PIA with Tet at 300 μg/ml. The plasmid portion of mini-CTX1-44562 was removed from the chromosome using the Flp recombinase encoded by pFLP2 (35). The final strain was designated PA4456Mcom.

For PA4556 site-directed mutation experiments, complementation plasmids containing the entire or partial PA4456-4452 gene cluster were constructed. The DNA fragment containing the entire PA4456-4452 cluster or PA4456-4554 was amplified using the Phusion high fidelity PCR kit (Thermo Scientific) with P. aeruginosa chromosomal DNA as the template. DNA fragment containing the entire operon was amplified using the primers PA4456-4552 sense and PA4456-4552 anti, and DNA containing PA4456-4454 was amplified using the primers PA4456-4554 sense and PA4456-4552 anti. These DNA fragments included the 150-bp sequence upstream of the start codon so that the native promoter of a putative operon would be incorporated into the complementing construct. The PCR products were cloned into shuttle vector pAK1900. The resulting plasmids, pAK44564 and pAK44562, were then introduced into the PA4456M, respectively, by electroporation. The pAK1900 was also introduced into the mutant as a control.

Generation of site-directed mutations.

The site-directed mutation plasmids, designated pAK44562(E170) and pAK44562(H203), respectively, were constructed using a previously reported PCR method (34). PCRs were performed with the following reagents and conditions: mutagenic primer (E170 sense and E170 anti primers for substituting E170 with A; H203 sense and H203anti primers for substituting H203 with A) at a final concentration of 0.25 μM; DNA template (pAK44562), ∼400 ng; deoxynucleoside triphosphate mixture at 0.25 mM each; and Phusion high-fidelity DNA polymerase at 0.05 U/μl. The PCR cycles were as follows: 98°C for 2 min, followed by 25 cycles of 98°C for 20 s and 72°C for 4 min, followed in turn by 72°C for an additional 10 min. The purified PCR products were digested by DpnI to linearize unmutated plasmid before being used to transform E. coli. Plasmids containing the right mutations were isolated from the transformants and identified by high-resolution-melting real-time PCR (41). The primers used were E170 sense check/E170 anti check or H203 sense check/H203 anti check. The desired mutations were confirmed by sequencing. The plasmid containing double mutations named pAK44562(E170A,H203A) was constructed by a second round of PCR using plasmid containing a single mutation as the template.

Tet accumulation assay.

Tet uptake was measured by using spectrofluorimetry as reported previously (42) with a minor modification. Briefly, bacterial cells grown in LB broth were centrifuged (9,000 × g, 5 min, 30°C), washed once and resuspended (5 × 10¹¹ cells/ml) with A-buffer (10 mM Tris-HCl [pH 8.0] with 0.4% glucose). Measurement was performed using a Shimadzu (Japan) spectrofluorophotometer RF-540 (excitation wavelength, 400 nm; emission wavelength, 520 nm; excitation and emission monochromator slit widths, 5 nm). At time zero, Tet (100 μg/ml) was added, and the fluorescence (520 nm) was recorded.

The accumulation of Tet in the cells was directly determined using a standard curve (43). Briefly, cells were inoculated into a starter culture of 5 ml of LB medium, followed by incubation for approximately 12 h at 37°C with vigorous shaking. On the following day, the cells were diluted 1:100 in the same medium and grown under the same conditions. When the culture reached the mid-exponential-growth phase (an optical density at 600 nm [OD₆₀₀] of 0.8), the cell pellets were collected by centrifugation (3,820 × g at room temperature) and washed once with A-buffer. The cells were resuspended in A-buffer and incubated at 37°C for 10 min. Tet was added to a final concentration of 100 μg/ml. After 10 min, the cells were collected by centrifugation at 4°C and washed once with ice-cold A-buffer. Pelleted bacteria were solubilized by boiling for 10 min in 5 M HCl. This also converts tetracycline to anhydrotetracycline (42). Cooled samples were centrifuged at 9,000 × g for 5 min, and the supernatant was filtered through a 0.22-μm-pore size membranes (Pall Corporation, Life Sciences) to remove the cell debris. The absorbance at 440 nm of the anhydrotetracycline contained in the filtrates was measured with a NanoDrop spectrophotometer. The amount of anhydrotetracycline contained in samples was determined with a standard curve and divided by cell wet weight.

Construction of gene expression reporters.

The plasmid pMS402 carrying a promoterless luxCDABE reporter gene cluster was used to construct promoter-luxCDABE reporter fusions, as reported previously (37). The PCR product containing the promoter region (from 1,279 bp upstream of the PA4456 start codon to 283 bp downstream of the start codon) of the putative PA4456-4452 operon was PCR amplified using a Phusion high-fidelity PCR kit (Thermo Scientific) with the primers PA4456knock sense and PA4456knock anti. The PCR product was digested with BamHI and XhoI and cloned into the BamHI-XhoI site upstream of the lux genes on pMS402. The resultant plasmid was named pKD44562. The PacI fragment of pKD44562, which contained the Kan^r marker, the multiple cloning site (MCS), and the PA4456-4452 promoter-luxCDABE reporter, was then isolated after restriction enzyme digest and ligated into CTX6.1 to generate CTX-PA44562pro-lux. The P. aeruginosa reporter integration strain PA44562pro-lux was obtained by triparental mating as previously reported (39).

Transcriptional regulator screening by transposon mutagenesis.

Cells of PA44562pro-lux-PAO1 and E. coli SM10 containing pBT20 were collected from overnight cultures and resuspended in phosphate-buffered saline (PBS) separately. The cell suspensions were adjusted to the same concentration before being mixed together. Fifty-microliter portions of mixed strains were spotted onto an LB agar plate and incubated for 3 h at 37°C. The mating mixtures were scraped and resuspended in PBS. A portion of this suspension was diluted and spread on PIA plates containing Gen at 150 μg/ml. After overnight incubation at 37°C, the luminescence of the colonies was imaged using a LAS-3000 image system (Fuji), and mutants with altered PA4456 promoter activity were selected for further characterization.

In order to determine the site of the transposon insertion in the mutant clones, arbitrary PCR (44) was performed using the primers described in Table 1. In the first round of PCR, a specific primer (P1) for the transposon sequence was paired with a semidegenerate primer (P7-1) with a defined tail. In the second round of PCR, a nested transposon primer (P2) was paired with a primer (P7-2) targeting the tail portion of the semidegenerate primer (P7-1) with 0.5 μl of PCR product from the first round used as the template. The PCR products were sequenced, and the results were compared to the P. aeruginosa chromosome sequences (45) to localize the transposon insertion sites.

Assay of survival after toluene shock.

A toluene shock assay was performed as previously described (46). Briefly, the cells were grown in LB broth overnight. The bacteria were then diluted 1:100 in fresh LB broth and grown under the same conditions for 3 h. The culture was divided into two aliquots. Then, 0.1% (vol/vol) toluene was added to one aliquot, and the other aliquot without toluene was used as a control. The number of viable cells was determined 10 min after toluene was added.

MIC determination and assays for Mg²⁺ effect on antibiotic susceptibility.

The MIC of antibiotics was determined by broth microdilution method according to the guidelines of the Clinical and Laboratory Standards Institute (47, 48). Briefly, 96-well plates containing 2-fold dilution of antibiotics were prepared in Mueller-Hinton broth, and wells were inoculated with ∼10⁵ CFU/ml of overnight bacterial cultures. The results were determined after incubation for 16 to 18 h at 37°C. To test the effect of Mg²⁺ on antibiotic susceptibility, PA4456M, PA4456Mcom, and PAO1 were first cultured overnight in BM2 broth at 37°C. The overnight cultures were then diluted 100-fold and grown to an OD₆₀₀ of 0.5. Aliquots (100 μl) of the cultures were evenly spread on the BM2 agar plates supplemented with 2 mM and 20 μM MgSO₄, respectively. Once the agar plates were dried, 10 μl of antibiotic was deposited on the sterile Kirby-Bauer discs placed on the agar plates. The plates were incubated at 37°C for 16 to 20 h before examination.

Membrane integrity and stability test.

Overnight bacterial cultures were given 10-fold serial dilutions in fresh LB medium, and 10-μl dilutions were transferred onto LB agar plates containing various concentrations of EDTA (1 to 2.5 μM) with or without 0.5% sodium dodecyl sulfate (SDS). Colonies were counted after overnight incubation at 37°C (49, 50).

Measurement of pyocyanin production.

Pyocyanin was extracted from culture supernatants with minor modifications and measured as described previously (51, 52). Briefly, quantitation of pyocyanin production was done by extraction of 15 ml of overnight cultures using 9 ml of chloroform. After extraction, the chloroform layer was mixed with 2 ml of 0.2 N HCl to give a red solution. After centrifugation, the top layer was collected, and its absorbance was measured at 520 nm. The concentrations were calculated using an extinction coefficient at 520 nm of 17.072 (52).

RESULTS

Identification of a putative ABC transporter associated with antibiotic resistance.

Previously, we have conducted a genome-wide screening for P. aeruginosa genes involved in intrinsic resistance to antibiotics (17). One of the transposon mutants obtained was PA4456 mutant which exhibited decreased resistance to antibiotics. To understand the role of this gene in intrinsic antibiotic resistance, PA4456 and its associated genes have been further characterized. On the P. aeruginosa PAO1 chromosome, PA4456, PA4455, PA4454, PA4453, and PA4452 genes are located within one computationally predicted operon that encodes a putative ATP-binding cassette (ABC) transporter (53). Proteins encoded by this operon share high similarities with those encoded by the ttg2 operon in Pseudomonas putida which is involved in toluene tolerance (46, 53). PA4456 shares 87.73% amino acid identity with Ttg2A and exhibits typical features of the ABC ATPase (see Fig. S1 in the supplemental material). PA4455 shares 86.04% amino acid identity with Ttg2B and is a probable permease component of the ABC transporter with five predicted TM helices (TMHMM v2.0), and PA4454 is likely a periplasmic component (81.53% identity with Ttg2C), which probably forms the core of the ABC transporter. Protein encoded by PA4453 is likely an auxiliary component and shares 64.49% identity with Ttg2D, while PA4452 is a putative anti-anti-sigma regulatory factor (53) with 61% similarity with Ttg2E. Based on the structural similarity, the gene products of the PA4456-4452 operon probably constitute an ABC transporter system which presumably is involved in the transport of antibiotics.

To test such a possibility, a deletion mutant of PA4456, which is the first gene in the putative PA4456-4452 operon, was constructed using the sacB-based gene replacement system (35). In addition, a complemented strain was also constructed by inserting an intact copy of the entire putative operon (PA4456-4452) at the attB site on the chromosome using the mini-CTX1 vector. The susceptibility of the mutant to antibiotics and organic compounds was compared to those in the wild type and the complemented strain. Strain PA4456M showed an approximately 3-fold increase in susceptibility to tetracycline and an approximately 2-fold increase in susceptibility to ciprofloxacin, trimethoprim, and chloramphenicol, whereas its susceptibility to erythromycin, rifampin, carbenicillin, and streptomycin did not change (Table 2). A toluene shock assay showed that PA4456M was unable to survive after 10 min of contact with 0.3% (vol/vol) toluene. The mutant showed increased susceptibility when treated with 0.1% (vol/vol) toluene for 10 min (Table 3). Complementation with the plasmid containing PA4456-4454 resulted in partial restoration of Tet susceptibility, and full restoration was only achieved when the plasmid contained the entire putative operon (PA4456-4452) (Table 2).

TABLE 2.

Antibiotics susceptibility assay

Strain	MIC (μg/ml)a
	Tet	Cip	Chl	Tmp	Car	Ery	Rif	Str	Kan
PAO1	20	0.4	15	160	150	>1,250	125	100	450
PA4456M	7.5	0.2	7.5	80	150	>1,250	125	100	450
PA4456Mcom	20	0.4	15	160	150	>1,250	125	100	450
PAO1/pAK1900	20	0.4	15	160	NT	>1,250	125	100	450
PA4456M/pAK1900	7.5	0.2	7.5	80	NT	>1,250	125	100	450
PA4456M/pAK44562	20	0.4	15	160	NT	>1,250	125	100	450
PA4456M/pAK44564	12.5	0.2	10	100	NT	>1,250	125	100	450
PA4456M/pAK44562 (E170)	7.5	0.2	7.5	80	NT	>1,250	125	100	450
PA4456M/pAK44562 (H203)	7.5	0.2	7.5	80	NT	>1,250	125	100	450
PA4456M/pAK44562 (H203,E170)	7.5	0.2	7.5	80	NT	>1,250	125	100	450

^aTet, tetracycline; Cip, ciprofloxacin; Chl, chloramphenicol; Tmp, trimethoprim; Ery, erythromycin; Car, carbenicillin; Rif, rifampin; Str, streptomycin; Kan, kanamycin. NT, not tested due to interference from the antibiotic resistance marker on the plasmid. Two sets of one-half serial dilutions of Tet, Cip, and Chl were carried out to obtain more accurate MIC values.

TABLE 3.

Survival of P. aeruginosa and its isogenic mutants after the addition of 0.1% (vol/vol) toluene

Strain	Cell survival after 10 min (CFU ml−1)
	Without toluene	With toluene
PAO1	109	107
PA4456M	109	105
PA4456Mcom	109	107

Intracellular accumulation of Tet in the PA4456 mutant.

As the mutant is more susceptible to Tet, it is possible that this ABC transporter system extrudes antibiotics from the cytoplasm. In other words, the antibiotics may be accumulated in the mutant cell, making it more sensitive to the antibiotic. We thus quantified the intracellular concentration of Tet to test such a possibility. The fluorescence results showed that Tet accumulation in PA4456M strain was significantly higher than in the wild-type and PA4456Mcom strains (Fig. 1A). The results were further verified by directly measuring the Tet concentrations in the cells. Indeed, PA4456M strain showed a higher accumulation of Tet than did PAO1 and PA4456Mcom (Fig. 1B). These results indicate that this ABC transporter system functions as an exporter of Tet in P. aeruginosa.

FIG 1.

Fluorescence enhancement and amount of tetracycline accumulation. (A) The time-dependent fluorescence enhancement of tetracycline. Bacteria were grown, harvested, washed, and resuspended as described in Materials and Methods. At time zero, tetracycline (100 μg/ml) was added, and accumulation was monitored using spectrofluorimetry. Square, PAO; triangle, PA4456M; diamond, PA4456Mcom. (B) Amount of tetracycline accumulation in cells. The results shown are representative of four independent experiments, all of which demonstrated the same trends. The bars show the means ± the standard deviations from triplicate experiments. Significance was analyzed with a Student t test using GraphPad Prism software (*, P < 0.05).

The histidine residue in the H-loop and glutamate residue in the Walker B motif are essential for PA4456 function.

ABC transporters import or export their substrates using energy generated by hydrolyzing ATP. PA4456 potentially serves as an ATP-binding component with the function of an ATPase. Two highly conserved residues, the histidine residue in H-loop and the glutamate residue in Walker B motif, are important for ATPase activity (19). We tested the role of these conserved residues of PA4456 in the function of the ABC transporter system. Four plasmids containing the entire PA4456-4452 operon with different substitutes at the conserved residues were constructed. One contained the E170A change at the Walker B motif, and the other had the H203A substitution in the H loop. The third plasmid contained both residue substitutions, and the fourth had the wild-type sequence. All three plasmids containing single or double substitutions could not restore the Tet susceptibility to the wild-type level; only the plasmid containing none of the substitutions could do so (Table 2). Clearly, both E170 and H203 are important for the function of PA4456.

PA4456 operon disruption does not affect membrane integrity or stability.

Some ABC transports are involved in the biogenesis of the outer membrane and are important for maintaining outer membrane integrity and stability (50, 54, 55). Disruption of such transporters adversely affects membrane integrity and stability, which in turn affects the cell's susceptibilities to toxic compounds. To examine whether the disruption of PA4456 affects the membrane stability and integrity, we grew the mutant, the wild type, and the complemented strains on agar media containing various amounts of EDTA (1 to 2.5 mM) with or without 0.5% SDS and compared their sensitivities to polymyxin B (molecular weight = 1,301.6) and vancomycin (molecular weight = 1,485.7). Changed susceptibility to these compounds serves as an indication for disrupted outer membrane integrity (56–58). EDTA, a chelator of divalent cations, affects the stability and integrity of the outer membrane by destabilizing lipopolysaccharide interactions (49) The results showed no differences between PA4456M and the wild type (data not shown). This suggests that the outer membrane stability and integrity were not disrupted in PA4456M and did not contribute to the changed antibiotic susceptibility.

A two-component regulatory system (PhoPQ) is a regulator for the putative ABC transporter.

To understand the regulation of the putative ABC transporter, we carried out a transposon mutagenesis to identify regulators of the putative PA4456-4452 operon. Genes that affect the expression of the putative operon were screened using a promoter-lux fusion reporter. Of the ∼20,000 transposon insertion mutants screened, 10 mutants exhibited enhanced or reduced reporter luminescence levels (see Table S1 in the supplemental material). The most common site of insertion of the transposon was in phoQ, which belongs to the phoPQ two-component regulatory system (59).

To confirm the regulatory role of the PhoPQ in the putative PA4456-4452 operon expression, we constructed a phoQ deletion mutant and tested the effect of PhoPQ on the ABC transporter operon. PA4456-4452 promoter-lux fusion was then introduced to the mutant, and the promoter activity was measured. The expression of PA4456-4452 promoter-lux fusion in a ΔphoQ background was significantly higher (Fig. 2) than that in the wild type or the complemented strain. This result confirms that PA4456 expression is regulated by PhoPQ.

FIG 2.

Impact of the ΔphoQ mutation in the expression of the putative PA4456-4452 operon. Square, PA44562pro-lux-PAO1/pAK1900; triangle, PA44562pro-lux-ΔphoQ/pAK1900; diamond, PA44562pro-lux-ΔphoQ/pAK1180. The assay was independently repeated three times. cps, counts per second.

Since the PhoPQ system is known to be activated by limiting concentrations of Mg²⁺ (59), we tested whether the induced expression of phoPQ under low-Mg²⁺ conditions affected the putative ABC transporter and hence the bacterium's susceptibilities to antibiotic Tet. The susceptibilities of the wild type, the mutant PA4456M, and the complemented strain to Tet were compared in BM2 medium supplemented with either 2 mM MgSO₄ (high concentration) or 20 μM MgSO₄ (low concentration). As expected, at low concentrations of Mg²⁺ the wild type was more susceptible to Tet, probably due to the negative regulation of the ABC transporter by the increased phoPQ expression under this condition (see Fig. S2 in the supplemental material). The PA4456M showed only a slight difference in its susceptibility to Tet. This result further confirms the regulation of the putative ABC transporter by phoPQ system.

Increased production of pyocyanin in PA4456 mutant.

Pyocyanin is a blue redox-active secondary phenazine metabolite produced by P. aeruginosa. It is an important virulence factor required for establishing long-term infection by P. aeruginosa (60). Previously, our lab observed that the promoter activity of the phenazine synthesis gene cluster phzA1 was increased in a PA4456 insertion transposon mutant (61). We introduced the phzA1promoter-lux fusion reporters in P4456M, and the expression of phzA1 was measured. In agreement with the previous result, the expression of phzA1 promoter production was elevated significantly during the late log and early stationary phases of growth (Fig. 3A). To verify the effect of PA4456 mutation on phenazine production, we also evaluated the concentration of pyocyanin, one of the end products encoded by two phzABCDEFG operons, in the mutant. As shown in Fig. 3B, the concentration of pyocyanin in PA4456M was significantly higher than in the wild-type and complemented strains.

FIG 3.

phzA1 expression and pyocyanin production. (A) phzA1 expression profile and growth in PAO1 (square) and PA4456M (triangle). (B) Pyocyanin production in the PAO1, PA4456M, and PA4456Mcom strains. Data were analyzed with a Student t test using GraphPad software version 5.0 (*, P < 0.05). These assays were independently repeated at least three times. cps, counts per second.

DISCUSSION

A wealth of ABC transporter components are annotated on the P. aeruginosa genome, but little is known about their role in intrinsic antibiotic resistance. We previously showed that a transposon insertion in PA4456, a component of a putative ABC transporter encoded by PA4456-4452, caused increased susceptibility to Tet (17). In the present study, we further explore the role of this transporter in the susceptibility of P. aeruginosa to Tet and other antibiotics. Our results suggest the putative ABC transporter is a Tet exporter.

A set of RND pumps in P. aeruginosa has been reported to be associated with Tet susceptibility, which include MexAB-OprM, MexCD-OprJ, MexXY-OprM, MexVW-OprM, MexPQ-OprE, MexMN-OprM, MexJK-OprM, MuxABC-OpmB, and MexGHI-OprD (5, 63, 64). MexXY-OprM is the primary system for intrinsic resistance to Tet, and deletion of mexXY causes an 8-fold increase in susceptibility to Tet (63, 64). Mutation of the ABC system encoded by PA4456-4452 caused a roughly 3-fold increase in susceptibility to Tet, albeit the intact MexXY-OprM and MexAB-OprM are present in the strain. This suggests that, in addition to the RND systems, the ABC transporter is also an important system to extrude Tet in P. aeruginosa. Recently, an ABC transporter named NPPA1A2BCD was reported for uptake of peptidyl nucleoside antibiotics in P. aeruginosa PA14 (32), and another putative ABC transporter has been reported to be associated with Cip susceptibility (31). It is possible that, in addition to RND pumps, ABC transporters may play an auxiliary and yet important role in intrinsic antibiotic resistance in P. aeruginosa.

There are two potential mechanisms for the increased Tet susceptibility in the PA4456-4452 putative ABC transporter mutant. One is that Tet was more easily transported into the cell in the mutant due to changed permeability of the outer membrane caused by PA4456 disruption. The other is that the putative ABC transporter functions as an efflux transporter for antibiotics, and loss of this transporter resulted in increased intracellular Tet accumulation. The tests of membrane integrity and stability suggest there was no change of outer membrane caused by the PA4456 disruption. The increased accumulation of Tet in the cell fraction of the PA4456M suggests that the ABC transporter is possibly involved in the efflux of Tet. It is noted, however, that such measurements reflect the intracellular Tet plus Tet absorbed on the cells. Nevertheless, increased intracellular concentration of Tet was confirmed by the fluorescence based absolute Tet concentration test. The ABC transporter mutant also showed increased susceptibility to Cip, Tmp, Chl, and dimethylformamide; it is postulated that this ABC transporter also functions as an exporter for these compounds.

Consistent with the active transporting function of the ABC transporter in Tet efflux, a plasmid carrying PA4456 with site-directed mutations at the predicted ATP binding residues could not restore antibiotic susceptibility to the wild-type level. While the intact gene could completely restore susceptibility to Tet, substitution of any one of the two residues (E170 and H203) would abolish its ability to complement. Clearly, the active function of the entire ABC transporter, as well as its energy supply through the ATPase activity, is important for the Tet resistance in P. aeruginosa.

It is known that many antibiotic resistance determinants are regulated and respond to the presence of toxic chemicals (65). Genome screening for the regulators of the ABC transporter identified PhoPQ as a strong transcriptional regulator. PA4456-4452 operon was negatively regulated by the phoPQ two-component regulatory system. PhoPQ system is important for virulence in Enterobacteriaceae, Pseudomonas and Salmonella, and plays a role in inducible resistance to cationic antimicrobial peptides in response to limiting divalent cations (66, 67). In agreement with our observations, previous microarray analyses indicate that PA4454, PA4455, and PA4456 were among the genes that were upregulated in the ΔphoQ mutant (66) and affected by Mg²⁺ (68). In agreement with the native regulation of the putative ABC transporter by the phoPQ system the antibiotic susceptibility to Tet in the wild type was higher under low-Mg²⁺conditions than under high-Mg²⁺conditions, presumably due to the repression of the ABC transporter system by the increased phoPQ expression in low Mg²⁺condition. The difference of susceptibility to Tet between the two Mg²⁺conditions became marginal in the mutant strain PA4456M. The slight difference in the mutant may be due to the effect of Mg²⁺ on other systems associated with Tet susceptibility.

Pyocyanin is a blue redox-active zwitterion occurring as a secondary metabolite, which plays an important role for full virulence in P. aeruginosa (69) and serves as a terminal signaling factor in the quorum-sensing network (70). We noticed increased pyocyanin production in PA4456M due to the color changes in the culture of the mutant, which is consistent with our previous observation (61). The connection between the ABC transporter and pyocyanin production is not clear. It is not known whether the PA4456-4452 ABC transporter affects pyocyanin crossing the membranes, although it is believed that the small molecule is able to pass freely through the cell membrane. Further study is required to reveal the role of the ABC transporter in pyocyanin production.

In conclusion, our results show that the ABC transporter encoded by PA4456-4452 is an active exporter of Tet in P. aeruginosa, and it is also a potential transporter of ciprofloxacin, trimethoprim, chloramphenicol, and dimethylformamide. The ABC transporter is associated with intrinsic resistance to antibiotics and adverse compounds in P. aeruginosa, probably by exporting them out of the cell. In addition to the RND pumps, ABC transporters potentially also play an important role in antibiotic efflux in P. aeruginosa.