Abstract
An efficient transformation and expression system was developed for the industrially relevant basidiomycete Pycnoporus cinnabarinus. This was used to transform a laccase-deficient monokaryotic strain with the homologous lac1 laccase gene placed under the regulation of its own promoter or that of the SC3 hydrophobin gene or the glyceraldehyde-3-phosphate dehydrogenase (GPD) gene of Schizophyllum commune. SC3-driven expression resulted in a maximal laccase activity of 107 nkat ml−1 in liquid shaken cultures. This value was about 1.4 and 1.6 times higher in the cases of the GPD and lac1 promoters, respectively. lac1-driven expression strongly increased when 25 g of ethanol liter−1 was added to the medium. Accordingly, laccase activity increased to 1,223 nkat ml−1. These findings agree with the fact that ethanol induces laccase gene expression in some fungi. Remarkably, lac1 mRNA accumulation and laccase activity also strongly increased in the presence of 25 g of ethanol liter−1 when lac1 was expressed behind the SC3 or GPD promoter. In the latter case, a maximal laccase activity of 1,393 nkat ml−1 (i.e., 360 mg liter−1) was obtained. Laccase production was further increased in transformants expressing lac1 behind its own promoter or that of GPD by growth in the presence of 40 g of ethanol liter−1. In this case, maximal activities were 3,900 and 4,660 nkat ml−1, respectively, corresponding to 1 and 1.2 g of laccase per liter and thus representing the highest laccase activities reported for recombinant fungal strains. These results suggest that P. cinnabarinus may be a host of choice for the production of other proteins as well.
Filamentous fungi belonging to the homobasidiomycetes offer great potential for industrial and medical applications. They secrete proteins into their culture media with activities or in amounts that are not found in other fungi. For instance, homobasidiomycetes produce various metalloenzymes, such as laccases, which are attractive candidates for a wide variety of applications. These enzymes degrade a large number of recalcitrant pollutants and are a biological and environmentally friendly alternative to the highly contaminating pulping and bleaching treatments of the paper and pulp industries (3, 4). Until now, the expression of basidiomycete metalloenzymes in ascomycete production systems such as Aspergillus ssp. and Trichoderma reesei has had limited success (6). Therefore, basidiomycetes should be developed as hosts for large-scale protein production. The white rot fungus Pycnoporus cinnabarinus is an attractive candidate in this respect. This basidiomycete was selected for its ability to efficiently degrade lignin and to transform lignin-derived compounds such as ferulic acid into vanillin (9, 11, 22). P. cinnabarinus has a simple ligninolytic system. Neither lignin peroxidase nor manganese peroxidase activity has been detected, but laccase is produced (9). Two laccase genes have been cloned, i.e., lcc3-1 or the allelic form lac1 (10, 23) and lcc3-2 (34). Until now, transformation procedures and expression systems for P. cinnabarinus were not available. This was part of the subject of this study.
Classical and molecular genetics have been well established for Schizophyllum commune, which can be considered a model system for the homobasidiomycetes. S. commune was transformed to phleomycin and hygromycin resistance by use of the regulatory sequences of the GPD (glyceraldehyde-3-phosphate dehydrogenase) gene (26, 27). Apart from the GPD promoter, the SC3 promoter can also be used for high-level gene expression (36). The former promoter is constitutively expressed, whereas the monokaryon-specific SC3 promoter is expressed only after a few days of growth. mRNA accumulation in S. commune does not only depend on the promoter used but also depends on the presence of introns in or near the coding sequence of the gene (18, 26). Moreover, AT-rich regions within the coding sequence cause premature termination, resulting in truncated mRNAs (28). Full-length mRNAs have been produced by increasing the GC content in such a region (26).
For this study, a transformation and expression system for P. cinnabarinus was developed. This system was used to produce high levels of the homologous laccase lac1.
MATERIALS AND METHODS
Cultivation of P. cinnabarinus.
The monokaryotic laccase-deficient P. cinnabarinus strain BRFM 44 (Banque de Resources Fongiques de Marseille, Marseille, France) was routinely grown at 30°C in liquid or solid (1.5% agar) yeast malt medium (YM) containing the following ingredients per liter: 10 g of glucose, 5 g of peptone, 3 g of yeast extract, and 3 g of malt extract. For laccase production, conditions were used that are optimal for lac1 production in wild-type P. cinnabarinus (17). Strains were grown in 250 ml of minimal medium (MM) with or without filter-sterilized ethanol in 1-liter Erlenmeyer flasks at 250 rpm at 30°C. MM contained the following ingredients per liter: 20 g of maltose, 1 g of yeast extract, 2.3 g of C4H4O6Na2 · 2H2O, 1.84 g of (NH4)2C4H4O6, 1.33 g of KH2PO4, 0.1 g of CaCl2 · 2H2O, 0.5 g of MgSO4, 0.07 g of FeSO4 · 7H2O, 0.048 g of ZnSO4 · 7H2O, 0.036 g of MnSO4 · H2O, 0.1 g of CuSO4, and 1 ml of a vitamin solution (33).
Transformation of P. cinnabarinus.
P. cinnabarinus was transformed by use of a modified procedure for the transformation of S. commune (18, 27). All steps in the transformation procedure were performed at 30°C unless stated otherwise. A 15-day-old colony (6 to 8 cm in diameter) was homogenized in 50 ml of YM for 1 min in a Waring blender. After an addition of the same volume of medium, the homogenate was grown for 24 h at 200 rpm. This culture was again homogenized, diluted twice in YM, and grown for 24 h at 200 rpm. The mycelium was induced to form protoplasts in 0.5 M MgSO4 or 0.5 M sucrose with gentle shaking by using 1 mg of Glucanex (Sigma-Aldrich) ml−1. Protoplasts (107) and 5 μg of plasmid DNA were incubated for 15 min on ice. After the addition of 1 volume of polyethylene glycol 4000, the mixture was incubated for 5 min at room temperature. Protoplasts were regenerated overnight in 2.5 ml of regeneration medium (32). After the addition of 3 volumes of YM containing 5 μg of phleomycin or hygromycin ml−1 and 1% low-melting-point agarose, the mixture was spread on YM agar containing 5 μg of the antibiotic ml−1.
The following plasmids (described in reference 26) were used to set up an efficient transformation system. Plasmid pHYB1:1 contains a ble and an hph gene, conferring resistance to phleomycin and hygromycin, respectively. Both genes are under control of the regulatory sequences of the GPD gene of S. commune. Plasmid pHYM1:1 is similar to pHYB1:1 but contains an hph gene with an increased GC content in an AT-rich region within the coding sequence. Plasmids pHYM1:2, pHYM2:1, and pHYM2:2 are derivatives of pHYM1:1 that contain an intron downstream of the stop codon, an intron upstream of the start codon, and a combination of both, respectively. Construct pSC3g contains the phleomycin resistance cassette as well as the genomic SC3 gene (18). Construct pSC3GPD is a derivative of pSC3g in which the SC3 promoter is replaced by the GPD promoter (see below).
Construction of laccase expression vectors.
For expression of the laccase lac1 gene from P. cinnabarinus (23) (GenBank accession number AF170093) behind the SC3 and GPD promoters of S. commune, the lac1 coding sequence was amplified by a PCR using primers NcoIPyc and BclIPyc (Table 1). This resulted in a fragment with an introduced NcoI site in the start codon and a BclI restriction site directly following the stop codon. For expression of the lac1 gene behind its own promoter, the coding sequence was amplified by using primers PromoNCOforward and PromoLACreverse (Table 1), resulting in a fragment with an introduced NcoI site at the 5′ end and a SmaI site immediately following the stop codon. The amplified coding sequences of lac1 were cloned into the expression vector pESC and its derivatives pEGP and pELP, resulting in plasmids pESCL1, pEGPL1, and pELPL1, respectively. Plasmid pESC contains a phleomycin resistance cassette (27) from which the internal NcoI site has been deleted. Moreover, it contains the regulatory sequences of the SC3 gene in between which coding sequences can be cloned by using the NcoI and BamHI sites. The SC3 promoter is carried on a 1.2-kb HindIII/NcoI fragment, while its terminator consists of a 434-bp BamHI/EcoRI fragment. Plasmids pEGP and pELP are derivatives of pESC in which the SC3 promoter is replaced with HindIII/NcoI promoter fragments of GPD (700 bp) (14) and lac1 (2.5 kb), respectively. The lac1 promoter was isolated as follows. BglII-digested genomic DNA from P. cinnabarinus was circularized by self-ligation and used as a template for an inverse PCR using the primers INVSE and INVASE (Table 1). The resulting 3.5-kb fragment was cloned into XL-TOPO (Invitrogen), resulting in plasmid pPL100. Sequencing confirmed that pPL100 contained a 2.5-kb promoter region. This region was amplified by a PCR using primers promoLACforward and promoNCOrev, introducing a HindIII and an NcoI site at the 5′ and 3′ ends, respectively.
TABLE 1.
Primers used for this study
| Primer | Sequence |
|---|---|
| NcoIPyc | TTCTGACCATGGCGAGGTTCCAGTC |
| BclIPyc | ACAGTAACTGATTCAGCTCAGAGGTCGCTG |
| PromoNCOforward | ACCCCCTCTTTCTGACCATGGCGAGGTTCCAGTC |
| PromoLACreverse | TAACCCGGGCGCTCAGAGGTCGCTGGGGTCAAGTGC |
| INVSE | TCTGATCATGTCGAGGTTCCAGTCC |
| INVASE | GTCTTCAAGGACCTGCGGACAGACATC |
| Promolacforward | ACCAAGCTTAGATCTCCGAACCAGAAATGC |
| PromoNCOrev | GACTGGAACCTCGCCATGGTCAGAAAGAGGGGT |
| HYGFOR | CGCAAGGAATCGGTCAATAC |
| HYGREV | CCGTCAACCAAGCTCTGATA |
RNA hybridization.
RNAs were isolated by use of the Trizol reagent according to the manufacturer's instructions (Gibco BRL). Ten micrograms of RNA was separated in a 1% formaldehyde-agarose gel and blotted overnight onto a Hybond-N+ membrane (Amersham, Chalfont St. Giles, Bucks, United Kingdom). RNAs were hybridized at 65°C to 32P-labeled probes made with a Prime a Gene labeling kit (Promega). The levels of mRNAs were quantified by densitometry by the use of AD software (Phoretix International, Newcastle upon Tyne, United Kingdom).
Reverse transcription-PCR (RT-PCR).
DNase I-treated RNA samples were reverse transcribed in a 20-μl reaction volume according to the instructions of the manufacturer (Invitrogen, Leek, The Netherlands). The absence of reverse transcriptase in the reaction mixture served as a control to show that products were not the result of contaminating DNAs. PCR amplification was carried out with 5% of the reaction mixture in a 20-μl reaction volume with primers HYGFOR and HYGREV (Table 1).
Laccase activity.
The laccase activities of P. cinnabarinus strains were monitored on solid YM supplemented with 0.2 mM ABTS (2,2′-azinobis(3-ethylbenzthiazolinesulfonic acid) and 0.1 mM CuSO4. Laccase activity in the culture medium was determined quantitatively by monitoring the oxidation of 5 mM ABTS at 420 nm (extinction coefficient, 36,000 mM−1 cm−1) in the presence of 50 mM Na-K-tartrate, pH 4.0. Activity was expressed in nanokatals per milliliter. One nanokatal was defined as the amount of enzyme catalyzing the oxidation of 1 nmol of ABTS per s. Assays were performed in triplicate at 30°C. Standard deviations did not exceed 10% of the average values.
Quantification of maltose.
The maltose concentration in the medium was analyzed by high-performance liquid chromatography using a 25-cm-long Econosil-NH2 reverse-phase column (Altech Associates Inc., Breda, The Netherlands). The disaccharide was eluted with acetonitrile-water (75:25 [vol/vol]) at a flow rate of 1 ml per min at 30°C. Detection was done with a refractive index 830 detector (Jasco International Co. Ltd., Tokyo, Japan).
RESULTS AND DISCUSSION
Efficient transformation system for P. cinnabarinus.
P. cinnabarinus strain BRFM 44 was transformed with pHYM1.1. This construct contains both a phleomycin and a hygromycin resistance cassette under control of the GPD regulatory sequences of S. commune. Selection for either antibiotic routinely yielded 30 to 50 transformants per 5 μg of transforming DNA. These numbers were similar to those obtained with S. commune (26, 27).
AT-rich regions in coding sequences cause the premature termination of mRNAs in S. commune. As a result, the hph gene of Escherichia coli can only confer hygromycin resistance in S. commune if the GC content of an AT-rich region within the coding sequence is increased (26). To examine whether this AT-rich region also affects hygromycin resistance in P. cinnabarinus, we transformed this basidiomycete with constructs containing a modified (pHYM1:1) and unmodified (pHYB1:1) hph gene. In contrast to the case for S. commune (26), hygromycin-resistant colonies were obtained with both constructs (50 and 60 transformants per 5 μg of DNA, respectively). However, colonies that were transformed with the modified hph gene still grew at 20 μg of hygromycin ml−1, while those transformed with the unmodified gene grew maximally at half this concentration. This indicates that the AT-rich region within the hph coding sequence does affect mRNA accumulation. However, the levels of hph mRNA were below the limits of detection for Northern analysis and RT-PCR for all transformants tested. The unmodified hph gene was also active in the basidiomycetes Agaricus bisporus (7) and Pleurotus ostreatus (15). This suggests that premature termination due to AT-rich regions to the extent observed for S. commune is not widespread among the homobasidiomycetes.
To investigate whether accumulation of the modified hph gene could be increased by the presence of introns, we transformed P. cinnabarinus with constructs containing an intron directly upstream of the start codon (pHYM2:1), an intron downstream of the stop codon (pHYM1:2), or both (pHYM2:2). The presence of introns did not increase the number of transformants. However, introns cloned downstream of the hph coding sequence did increase mRNA accumulation, as shown by RT-PCR. A 280-bp hph cDNA could be amplified from 4 of 12 strains that were transformed with pHYM1:2 or pHYM2:2. In contrast, no PCR product was obtained from the RNAs of 12 strains containing pHYM2:1 or pHYM1:1 (Fig. 1). This shows that the accumulation of the hph gene in P. cinnabarinus is enhanced by the presence of introns and that, in contrast to the case for S. commune (26), the accumulation of mRNA in P. cinnabarinus is affected by the position of the intron. Intron-dependent accumulation in P. cinnabarinus was also observed for the SC3 hydrophobin gene of S. commune (data not shown). Thus, this phenomenon seems to be widespread in the fungal kingdom. It has now been reported for the basidiomycetes S. commune (18, 26), Phanerochaete chrysosporium (19), and P. cinnabarinus and for the ascomycete Podospora anserina (8).
FIG. 1.
Accumulation of hph mRNA in P. cinnabarinus transformants containing pHYM1:1 (lanes 1 and 2) and pHYM1:2 (lanes 3 and 4) as analyzed by RT-PCR. Samples were treated with RNase (lanes 1 and 3) or DNase (lanes 2 and 4). M represents a 100-bp ladder.
Promoters for high-level expression of genes in P. cinnabarinus.
The GPD promoter of S. commune is active in P. cinnabarinus, as shown by the resistance of strains transformed with the pHYM and pHYB vectors to hygromycin and phleomycin. To establish whether the SC3 promoter of S. commune is functional in P. cinnabarinus as well, we transformed strain BRFM 44 with construct pSC3g, which contains the SC3 gene. High levels of SC3 mRNA were detected in five of six transformants when these strains were grown for 3 days (Fig. 2) or 6 days (not shown) on solid YM. The level of accumulation of SC3 mRNA was roughly 1.5-fold lower than that in S. commune when its own promoter was used. However, it was on average three times higher than that in P. cinnabarinus strains containing the SC3 gene under regulation of the GPD promoter of S. commune (Fig. 2).
FIG. 2.
Northern analysis of SC3 mRNA in 3-day-old cultures of strains of P. cinnabarinus transformed with the SC3 gene of S. commune under control of its own promoter (T1 to T6) or under control of the GPD promoter of S. commune (GP1 to GP6). An mRNA of S. commune 4-40 served as a control. The blots were probed with a 300-bp fragment of the coding sequence of the SC3 gene.
P. cinnabarinus strains T3 and GP2, which expressed SC3 behind its own promoter or that of GPD, respectively, were selected for monitoring of the expression of the hydrophobin gene in liquid shaken cultures in YM. SC3 mRNA accumulation peaked sharply at day 3 in strain T3 (Fig. 3). In contrast, the GPD-driven expression of SC3 in strain GP2 resulted in high levels of SC3 mRNA during the first 3 days of growth for a 6-day cultivation. The absence of SC3 mRNA from day 4 on correlated with the absence of glucose in the medium. From these data, we concluded that the SC3 promoter is stronger than the GPD promoter on solid medium but that for the high-level expression of genes in liquid shaken cultures, the latter promoter is favored because of its temporal expression.
FIG. 3.
Temporal accumulation of SC3 mRNA in 1- to 6-day-old liquid shaken cultures of the recombinant P. cinnabarinus strains T3 (A) and GP2 (B). These strains express the SC3 gene of S. commune behind its own promoter or that of GPD, respectively. The Northern blot was probed with an internal fragment of the SC3 gene. An RNA from a 3-day-old culture of S. commune 4-40 served as a control. Lanes 1 to 6 represent samples from days 1 to 6, respectively.
Apart from the heterologous SC3 and GPD promoters, the promoter of lac1 was also isolated (see Materials and Methods). The 2.5-kb fragment (accession number AY434884) contained several putative regulatory elements, including one catabolite-responsive element (creA-binding site) (1), five metal-responsive elements (35), four stress-responsive elements (12), and four heat shock elements (20). The temporal expression of this promoter was studied by using a construct containing a fusion with the lac1 coding sequence (see below).
High-level production of laccase in recombinant strains of P. cinnabarinus.
Purified lignin peroxidase LiPH8 from Phanerochaete chrysogenum (13), versatile peroxidase (VP) from Pleurotus eryingii (25), and the laccase lac1 of P. cinnabarinus (23) were incubated at 30°C for 24 h in growth media (YM and MM) of strain BRFM 44 to determine their stabilities. LiPH8 was not affected in media of 2-day-old cultures, but proteolytic degradation was observed after the growth of BRFM 44 for 6 days. In contrast, the proteolytic degradation of laccase and VP was minor, if present at all, under all conditions tested (results not shown). P. cinnabarinus thus seems to be a promising host for the large-scale production of metalloproteins. In the case of lignin peroxidase, the culture conditions should be optimized or protease-negative strains should be isolated.
The coding sequence of the laccase gene lac1 was cloned behind its own promoter and behind those of SC3 and GPD of S. commune. This resulted in constructs pELPL1, pEGPL1, and pESCL1, respectively. These constructs were introduced into the laccase-deficient strain BRFM 44, and 40 transformants of each were plated on medium containing ABTS. From these plate assays, we concluded that the introduction of either construct resulted in laccase activity in the medium. Ten strains from each transformation showing the highest ABTS conversion rates were grown for 14 days in liquid shaken cultures in the absence or presence of 25 g of ethanol liter−1. The transformants with the highest activities are shown in Table 2. Ethanol was recently reported to induce the lac1 gene in the monokaryotic SS3 strain of P. cinnabarinus, resulting in a 155-fold increase in laccase activity in the medium (17). In the liquid shaken cultures of the recombinant strains L12-7 and L12-8, which express lac1 behind its own promoter, laccase activity was increased 7 and 33 times, respectively, upon the addition of the inducer to the medium. The maximal activity was 1,223 nkat ml−1 for strain L12-7. Surprisingly, the laccase activity was also increased by the presence of ethanol when lac1 was expressed behind the SC3 and GPD promoters (Table 2). The activities were three to four times higher in the case of SC3-driven expression (strains S2 and S1). The maximal activity was 431 nkat ml−1 for strain S1. In the case of GPD-driven expression (strains G14 and G11), the activities were increased 10- to 12-fold. The maximum activity was observed for transformant G14 (1,393 nkat ml−1).
TABLE 2.
Laccase activity in medium of 14-day-old cultures of recombinant strains of P. cinnabarinus BRFM 44 expressing the laccase gene lac1 behind its own promoter or the SC3 or GPD promoter of S. communea
| Strain | Promoter | Activity (nkat · ml−1) without ethanol | Activity (nkat ml−1) with ethanol |
|---|---|---|---|
| BRFM 44 | ND | ND | |
| S1 | SC3 | 107 | 431 |
| S2 | SC3 | 49 | 138 |
| L12-7 | lac1 | 175 | 1,223 |
| L12-8 | lac1 | 20 | 666 |
| G11 | GPD | 60 | 700 |
| G14 | GPD | 145 | 1,393 |
Strains were grown in the presence or absence of 25-g/liter ethanol. ND, not detectable. Experiments were performed in triplicate. The standard deviation was less than 10%.
Strains S1, L12-7, and G14 were selected for further study. The consumption of maltose, the laccase activity, and the accumulation of lac1 mRNA were monitored for 14 days in liquid shaken cultures grown in the absence or presence of 25 g of ethanol liter−1. The consumption of maltose was similar for all strains (Fig. 4). In the absence of ethanol, the maltose concentration rapidly decreased around day 8. Most of the maltose had disappeared by day 10. The consumption of maltose was somewhat delayed when ethanol was added to the medium. This can be explained by the fact that this organic solvent suppresses growth of the mycelium and can thus be considered a stress factor (17). In all cases, laccase activity appeared in the medium on days 4 to 6 (Fig. 4). In the absence of ethanol, the activities reached a plateau on days 6 and 10 in the cultures of strains G14 and L12-7, respectively. In the case of strain S1, the activity slowly increased until day 14. In the presence of ethanol, activities in the culture medium of the three strains were 4- to 10-fold higher. The activities did not reach a plateau but rather increased until day 14. The accumulation of lac1 mRNA was in agreement with the evolution of laccase activity (Fig. 5). The accumulation of lac1 was low, if present at all, in 3-day-old cultures grown in the absence of ethanol independent of the promoter used. Accumulation increased by days 7 and 11 but decreased again by day 14. The expression profiles resulting from the SC3 and lac1 promoters were as expected, but that of GPD was a surprise. This promoter is supposed to be constitutive. Indeed, the expression on YM was hardly changed as long as glucose was available in the medium. The accumulation of lac1 mRNA increased in all cases when ethanol was added to the medium (Fig. 5). In the case of the SC3 promoter, expression was about twofold higher in spite of the fact that the maximum accumulation was obtained on day 14. Stronger effects of ethanol were observed with the GPD and lac1 promoters. A 20-fold increase was observed with the former promoter, and an 11-fold increase was observed with the latter. These data indicate that the increase in laccase activity by the addition of ethanol to the culture medium was due to increased transcription from the SC3, GPD, and lac1 promoters. As mentioned above, ethanol is considered a stress factor (17). Interestingly, stress-responsive elements (25) are not only present in the lac1 promoter but are also present in those of SC3 (29) and GPD (14). Future research should establish whether these elements are responsible for the increase in activity of these promoters in the presence of ethanol.
FIG. 4.
Consumption of maltose (triangles) and evolution of laccase activity (circles) in liquid shaken cultures of strains S1 (A), G14 (B), and L12-7 (C) containing the lac1 gene under regulation of the SC3 promoter or those of GPD and lac1, respectively. Cultures were grown in MM in the absence (closed symbols) or presence (open symbols) of ethanol.
FIG. 5.
Accumulation of lac1 mRNA in liquid shaken cultures of strains S1 (A), G14 (B), and L12-7 (C) containing the lac1 gene under regulation of the SC3 promoter or those of GPD and lac1, respectively. RNAs were hybridized with a 1,557-bp fragment of the coding sequence of lac1 and with 18S ribosomal DNA to quantify the amount of RNA loaded in each lane. Cultures were grown in the absence or presence of ethanol.
To establish whether the production of laccase could be further improved, we grew strains G14 and L12-7 in the presence of 40 g of ethanol liter−1. At this concentration, a considerable delay in growth was observed. However, about 4 and 6.5 times more laccase was produced, respectively, than that in cultures grown in the presence of 25 g of ethanol liter−1 (Table 3). Assuming a specific activity for lac1 of 230 U mg−1 (30), strains G14 and L12-7 produced 1.2 and 1 g of laccase liter−1, respectively, when grown in the presence of 40 g of ethanol liter−1. These activities are the highest reported for liquid shaken cultures of recombinant fungal strains. Normally, levels of up to 70 mg liter−1 are obtained with heterologous systems (2, 5, 16, 21, 23, 24, 31, 37), and in only one case did levels exceed 100 mg liter−1 (38).
TABLE 3.
Laccase activity in cultures of recombinant strains G14 and L12-7 grown in the absence or presence of 25 or 40 g of ethanol per litera
| Strain | Amt of ethanol (g liter−1) | Activity (nkat ml−1) on day:
|
||
|---|---|---|---|---|
| 7 | 14 | 21 or 24 | ||
| G14 | 0 | 1 | 65 | 65 |
| 25 | 3 | 1,580 | 1,160 | |
| 40 | 0 | 390 | 4,660 | |
| L12-7 | 0 | 5 | 126 | 250 |
| 25 | 5 | 600 | 1,200 | |
| 40 | 2 | 532 | 3,875 | |
Residual maltose concentrations after 21 (G14) and 24 (L12-7) days were below 3 mM. Experiments were performed in duplicate.
For this report, a mutant strain that had no laccase activity by itself was used. This strain will be used to produce heterologous laccases. Moreover, we are currently transforming strain SS3 with constructs pELPL1 and pEGPL1. SS3 is a monokaryotic strain of P. cinnabarinus that is known to produce 1 g of laccase per liter in the presence of ethanol (17). This should establish whether production levels in a strain that already produces such high levels of laccase can be further increased by genetic modification.
Acknowledgments
We are indebted to A. Smith (Sussex University, Sussex, United Kingdom) and A. Martinez (CSIC, Madrid, Spain) for providing us with purified LipH8 and VP.
This work was supported by European Commission project QLK3-1999-00590.
REFERENCES
- 1.Arst, H. N., Jr., and D. W. MacDonald. 1975. A gene cluster in Aspergillus nidulans with an internally located cis-acting regulatory region. Nature 254:26-31. [DOI] [PubMed] [Google Scholar]
- 2.Berka, R. M., P. Schneider, E. J. Golightly, S. H. Brown, M. Madden, K. M. Brown, S. H. Brown, T. Halkier, K. Mondorf, and F. Xu. 1997. Characterization of the gene encoding an extracellular laccase of Myceliophthora thermophila and analysis of the recombinant enzyme in Aspergillus oryzae. Appl. Environ. Microbiol. 63:3151-3157. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Bourbonnais, R., M. G. Paice, I. D. Reid, P. Lantheir, and M. Yaguchi. 1995. Lignin oxidation by laccase isoenzymes from Trametes versicolor and role of the mediator 2,2′-azinobis(3-ethylbenzthiazoline-6-sulfonate) in kraft lignin depolymerization. Appl. Environ. Microbiol. 61:1876-1880. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Breen, A., and F. L. Singleton. 1999. Fungi in lignocellulose breakdown and biopulping. Curr. Opin. Biotechnol. 10:252-258. [DOI] [PubMed] [Google Scholar]
- 5.Bulter, T., M. Alcalde, V. Sieber, P. Meinhold, C. Schlachtbauer, and F. H. Arnold. 2003. Functional expression of a fungal laccase in Saccharomyces cerevisiae by directed evolution. Appl. Environ. Microbiol. 69:987-995. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Conesa, A., P. J. Punt, N. van Luijk, and C. A. M. J. J. van den Hondel. 2001. The secretion pathway in filamentous fungi: a biotechnological view. Fungal Genet. Biol. 33:155-171. [DOI] [PubMed] [Google Scholar]
- 7.de Groot, M. J. A., P. Bundock, P. J. J. Hooykaas, and A. G. M. Beijersbergen. 1998. Agrobacterium tumefaciens-mediated transformation of filamentous fungi. Nat. Biotechnol. 16:839-842. [DOI] [PubMed] [Google Scholar]
- 8.Dequard-Chabalt, M., and A. Rotig. 1997. Homologous and heterologous expression of a ribosomal protein gene in Podospora anserina requires an intron. Mol. Gen. Genet. 253:546-552. [DOI] [PubMed] [Google Scholar]
- 9.Eggert, C., U. Temp, and K.-E. L. Eriksson. 1996. The ligninolytic system of the white rot fungus Pycnoporus cinnabarinus: purification and characterization of the laccase. Appl. Microbiol. Biotechnol. 62:1151-1158. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Eggert, C., P. R. Lafayette, U. Temp, K. E. Eriksson, and J. F. Dean. 1998. Molecular analysis of a laccase gene from the white rot fungus Pycnoporus cinnabarinus. Appl. Environ. Microbiol. 64:1766-1772. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Falconnier, B., C. Lapierre, L. Lesage-Meesen, G. Yonnet, P. Brunerie, B. C. Colonna, G. Corrieu, and M. Asther. 1994. Vanillin as a product of ferulic acid biotransformation by the white rot fungus Pycnoporus cinnabarinus I-937. J. Biotechnol. 37:123-132. [Google Scholar]
- 12.Galhaup, C., S. Goller, C. K. Peterbauer, J. Strauss, and D. Haltrich. 2002. Characterization of the major laccase isoenzyme from Trametes pubescens and regulation of its synthesis by metal ions. Microbiology 148:2159-2169. [DOI] [PubMed] [Google Scholar]
- 13.Gelpke, M. D. S., M. Mayfield-Gambill, G. P. L. Cereghino, and M. H. Gold. 1999. Homologous recombinant lignin peroxidase in Phanerochaetae chrysosporium. Appl. Environ. Microbiol. 65:1670-1674. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Harmsen, M. C., F. H. J. Schuren, S. M. Moukha, C. M. van Zuilen, P. J. Punt, and J. G. H. Wessels. 1992. Sequence analysis of the glyceraldehyde-3-phosphate dehydrogenase genes from the basidiomycetes Schizophyllum commune, Phanerochaete chrysosporium and Agaricus bisporus. Curr. Genet. 22:447-454. [DOI] [PubMed] [Google Scholar]
- 15.Irie, T., Y. Honda, T. Hirano, T. Sato, H. Enei, T. Watanabe, and M. Kuwahara. 2001. Stable transformation of Pleurotus ostreatus to hygromycin B resistance using Lentinus edodes GPD expression signals. Appl. Microbiol. Biotechnol. 56:707-709. [DOI] [PubMed] [Google Scholar]
- 16.Liu, W., Y. Chao, S. Liu, H. Bao, and S. Qian. 2003. Molecular cloning and characterization of a laccase gene from the basidiomycete Fomes lignosus and expression in Pichia pastoris. Appl. Microbiol. Biotechnol. 63:174-181. [DOI] [PubMed] [Google Scholar]
- 17.Lomascolo, A., E. Record, I. Herpoël-Gimbert, M. Delattre, J. L. Robert, J. Georis, T. Dauvrin, J. C. Sigoillot, and M. Asther. 2003. Overproduction of laccase by a monokaryotic strain of Pycnoporus cinnabarinus using ethanol as an inducer. J. Appl. Microbiol. 94:618-624. [DOI] [PubMed] [Google Scholar]
- 18.Lugones, L. G., K. Scholtmeijer, R. Klootwijk, and J. G. H. Wessels. 1999. Introns are necessary for mRNA accumulation in Schizophyllum commune. Mol. Microbiol. 32:681-700. [DOI] [PubMed] [Google Scholar]
- 19.Ma, B., M. B. Mayfield, and M. H. Gold. 2001. The green fluorescent protein gene functions as a reporter of gene expression in Phanerochaetae chrysosporium. Appl. Environ. Microbiol. 67:948-955. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Mager, W. H., and A. J. Kruijf. 1995. Stress-induced transcriptional activation. Microbiol. Rev. 59:506-531. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.O'Callaghan, J., M. M. O'Brien, and A. D. W. Dobson. 2002. Optimization of the expression of a Trametes versicolor laccase gene in Pichia pastoris. J. Ind. Microbiol. Biotechnol. 29:55-59. [DOI] [PubMed] [Google Scholar]
- 22.Oddou, J., C. Stentelaire, L. Lesage-Meesen, M. Asther, and B. C. Ceccaldi. 1999. Improvement of ferulic acid bioconversion into vanillin by use of high-density cultures of Pycnoporus cinnabarinus. Appl. Microbiol. Biotechnol. 1:1-6. [Google Scholar]
- 23.Otterbein, L., E. Record, S. Longhi, M. Asther, and S. Moukha. 2000. Molecular cloning of the cDNA encoding laccase from Pycnoporus cinnabarinus I-937 and expression in Pichia pastoris. Eur. J. Biochem. 267:1619-1625. [DOI] [PubMed] [Google Scholar]
- 24.Record, E., P. J. Punt, M. Chamkha, M. Labat, C. A. M. J. J. van den Hondel, and M. Asther. 2002. Expression of the Pycnoporus cinnabarinus laccase gene in Aspergillus niger and characterization of the recombinant enzyme. Eur. J. Biochem. 269:602-609. [DOI] [PubMed] [Google Scholar]
- 25.Ruiz-Duenas, F. J., M. J. Martínez, and A. T. Martínez. 1999. Molecular characterization of a novel peroxidase isolated from the ligninolytic fungus Pleurotus eryngii. Mol. Microbiol. 31:223-235. [DOI] [PubMed] [Google Scholar]
- 26.Scholtmeijer, K., H. A. B. Wösten, J. Springer, and J. G. H. Wessels. 2001. Effect of introns and AT-rich sequences on expression of the bacterial hygromycin B resistance gene in the basidiomycete Schyzophyllum commune. Appl. Environ. Microbiol. 67:481-483. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Schuren, F. H. J., and J. G. H. Wessels. 1994. Highly-efficient transformation of the homobasidiomycete Schizophyllum commune to phleomycin resistance. Curr. Genet. 26:179-183. [DOI] [PubMed] [Google Scholar]
- 28.Schuren, F. H. J., and J. G. H. Wessels. 1998. Expression of heterologous genes in Schizophyllum commune is often hampered by the formation of truncated transcripts. Curr. Genet. 33:151-156. [DOI] [PubMed] [Google Scholar]
- 29.Schuurs, T. A. 1998. Regulation of hydrophobin genes in Schizophyllum commune. Ph.D. thesis. University of Groningen, Groningen, The Netherlands.
- 30.Sigoillot, C., E. Record, V. Belle, J. L. Robert, A. Levasseur, P. J. Punt, C. A. M. J. J. van den Hondel, A. Fournel, J. C. Sigoillot, and M. Asther. 2004. Natural and recombinant fungal laccases for paper pulp bleaching. Appl. Microbiol. Biotechnol. 64:346-352. [DOI] [PubMed] [Google Scholar]
- 31.Soden, D. M., J. O'Callaghan, and A. D. W. Dobson. 2002. Molecular cloning of a laccase isoenzyme gene from Pleurotus sajo-caju and expression in the heterologous Pichia pastoris host. Microbiology 148:4003-4014. [DOI] [PubMed] [Google Scholar]
- 32.Specht, C. A., A. Rivas-Miniz, C. P. Novotny, and R. C. Ullrich. 1988. Transformation of Schizophyllum commune: an analysis of parameters for improving transformation frequencies. Exp. Mycol. 12:357-366. [Google Scholar]
- 33.Tatum, E. L., R. W. Barrat, N. Fries, and D. Bonner. 1950. Biochemical mutant strains of Neurospora produced by physical and chemical treatment. Am. J. Bot. 37:338-346. [Google Scholar]
- 34.Temp, U., U. Zierold, and C. Eggert. 1999. Cloning of a second laccase gene from the lignin-degrading basidiomycete Pycnoporus cinnabarinus. Gene 236:169-177. [DOI] [PubMed] [Google Scholar]
- 35.Thiele, D. J. 1992. Metal-regulated transcription in eukaryotes. Nucleic Acids Res. 20:1183-1191. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Wessels, J. G. H., G. H. Mulder, and J. Springer. 1987. Expression of dikaryon specific and non-specific mRNAs of Schizophyllum commune in relation to environmental conditions and fruiting. J. Gen. Microbiol. 133:2557-2561. [Google Scholar]
- 37.Yaver, D. S., F. Xu, E. J. Golightly, K. M. Brown, S. H. Brown, M. W. Rey, P. Schneider, T. Halkier, K. Mondorf, and H. Hendrik Dalbøge. 1996. Purification, characterization, molecular cloning, and expression of two laccase genes from the white rot basidiomycete Trametes villosa. Appl. Environ. Microbiol. 62:834-841. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Yaver, D. S., M. del C. Overjero, F. Xu, B. A. Nelson, K. M. Brown, T. Halkier, S. Bernauer, S. H. Brown, and S. Kaupinnen. 1999. Molecular characterization of laccase genes from the basidiomycete Coprinus cinereus and heterologous expression of the laccase gene lcc1. Appl. Environ. Microbiol. 65:4943-4948. [DOI] [PMC free article] [PubMed] [Google Scholar]





