Abstract
Though invasive mucinous adenocarcinoma of the lung (IMA) is pathologically distinctive, the molecular mechanism driving IMA is not well understood, which hampers efforts to identify therapeutic targets. Here, by analyzing gene expression profiles of human and mouse IMA, we identified a Mucinous Lung Tumor Signature of 143 genes, which was unexpectedly enriched in mucin‐producing gastrointestinal, pancreatic, and breast cancers. The signature genes included transcription factors FOXA3, SPDEF, HNF4A, mucins MUC5AC, MUC5B, MUC3, and an inhibitory immune checkpoint VTCN1/B7‐H4 (but not PD‐L1/B7‐H1). Importantly, induction of FOXA3 or SPDEF along with mutant KRAS in lung epithelium was sufficient to develop benign or malignant mucinous lung tumors, respectively, in transgenic mice. FOXA3 and SPDEF induced MUC5AC and MUC5B, while HNF4A induced MUC3 in human mucinous lung cancer cells harboring a KRAS mutation. ChIP‐seq combined with CRISPR/Cas9 determined that upstream enhancer regions of the mucin genes MUC5AC and MUC5B, which were bound by SPDEF, were required for the expression of the mucin genes. Here, we report the molecular signature and gene regulatory network driving mucinous lung tumors.
Keywords: FOXA3, IMA, MUC5AC/5B, SPDEF, VTCN1
Subject Categories: Cancer; Chromatin, Epigenetics, Genomics & Functional Genomics; Respiratory System
Introduction
Lung cancer is the leading cause of cancer death. Lung cancer is pathologically classified into two main types, non‐small cell lung cancer (NSCLC, the most common type) and small cell lung cancer (SCLC). Lung adenocarcinoma (LUAD) is the most frequent type of NSCLC followed by lung squamous cell carcinoma (SqCC) and large cell carcinoma (LCC). Invasive mucinous adenocarcinoma of the lung (IMA) comprises ~5–10% of LUAD (estimated approximately 5,000 deaths/year by IMA in the US) whose tumor cells display goblet cell morphology containing abundant intracytoplasmic mucin (Hata et al, 2010; Kunii et al, 2011; Travis et al, 2011). Recent RNA‐seq analyses demonstrated that KRAS mutation was the most frequent genetic alteration seen in IMA (40–62%) followed by NRG1 fusion (7–27%; Fernandez‐Cuesta et al, 2014; Nakaoku et al, 2014). IMA expresses mucins such as MUC5AC and MUC5B while lacking the transcription factor NKX2‐1 (also known as TTF‐1; Travis et al, 2011) that normally suppresses those mucin genes (Maeda et al, 2012). Since the majority of IMA carries “undruggable” KRAS mutations, few therapeutics have been identified other than chemotherapy. Determining the molecular mechanisms driving IMA is required to identify novel therapeutic targets.
Previously, we and others demonstrated that Kras lung cancer mouse models with reduced expression of Nkx2‐1 (Kras G12D ; Nkx2‐1 +/− or Kras G12D ; Nkx2‐1 flox/flox) developed mucinous lung tumors mimicking human IMA (Maeda et al, 2012; Snyder et al, 2013). Independent analyses of gene expression profiles using cDNA microarrays identified 287 genes (Kras G12D ;Nkx2‐1 +/−; Maeda et al, 2012) and 1381 genes (Kras G12D ; Nkx2‐1 flox/flox; Snyder et al, 2013) as genes induced in mucinous lung tumors in the mouse models. However, it remains unknown which genes are indeed expressed in human IMA. In the present study, we analyzed gene expression profiles of human IMA using RNA‐seq and determined genes commonly expressed in the mouse models and human IMA as a gene signature for IMA. The signature included potential therapeutic target genes such as the immune checkpoint VTCN1/B7‐H4. The uniqueness of the signature was further assessed using RNA‐seq data from 230 LUAD specimens from The Cancer Genome Atlas (TCGA; Cancer Genome Atlas Research Network, 2014) and 598 human cancer cell lines from 20 different organs/tissues, including NSCLC cell lines (Klijn et al, 2015). The analysis using the signature and human IMA specimens further revealed that pro‐mucous transcription factors FOXA3, SPDEF, and HNF4A in addition to the anti‐mucous transcription factor NKX2‐1 differentially regulate the expression of mucins and IMA‐related genes in human lung cancer cells in vitro. Importantly, induction of FOXA3 or SPDEF along with KRASG12D in lung epithelium was sufficient to develop mucinous lung tumors in vivo. ChIP‐seq analysis determined that SPDEF directly bound to the non‐coding loci of the mucin genes MUC5AC and MUC5B, two major mucins expressed in the lung. Deletion of the SPDEF‐bound regions using CRISPR/Cas9 significantly reduced the expression of the two mucins, indicating that these non‐coding regions are functionally indispensable in inducing the expression of mucins in IMA. Here, we report the novel gene signature and gene regulatory mechanisms for IMA.
Results
Mucinous Lung Tumor Signature is enriched in specific cancer types
In order to identify genes that are highly expressed in human IMA, we performed mRNA‐seq analysis using RNAs extracted from six human IMA and adjacent normal lung tissues and determined genes differentially expressed in human IMA (Figs 1A and EV1, and Datasets EV1 and EV2). We compared the genes induced in human IMA (Dataset EV2) with the genes induced in mouse mucinous lung tumors (Mouse IMA; Maeda et al, 2012; Snyder et al, 2013; Dataset EV3) and identified 143 genes that were commonly expressed in both mouse and human IMA as a “Mucinous Lung Tumor Signature” (Figs 1B and EV2, red rectangles). In order to assess whether the signature indeed represents gene expression profiles of human IMA, we retrieved the RNA‐seq data of nine human IMA and nine normal lung specimens (Dataset EV4) from TCGA (Cancer Genome Atlas Research Network, 2014) and performed Gene Set Enrichment Analysis (GSEA; Subramanian et al, 2005). The signature (141 genes out of the 143 genes since MUC5AC and MUC3A/B were not included in the TCGA datasets) was highly enriched in human IMA (Enrichment Score = 0.81; Fig 1C), confirming that the signature can be used to assess human IMA. Interestingly, the signature selectively clustered the TCGA‐human IMA cases that harbored KRAS mutations, which separated the cases harboring other genetic alterations, including fusion genes (Fig 1D and E). These results suggest that this signature represents human IMA cases, especially the ones that harbor a KRAS mutation, which is the most frequent driver mutation in the human IMA.
Figure 1. Mucinous lung tumor gene signature for human invasive mucinous adenocarcinoma of the lung (IMA).

- Shown are differentially expressed genes in human IMA. RNA‐seq was performed using six human IMA patient cases (case 1–6) along with adjacent normal lung tissues.
- 143 genes of the Mucinous Lung Tumor Signature (three red rectangles) are in common between genes expressed in mouse IMA (Maeda et al, 2012; Snyder et al, 2013) and genes induced in human IMA (see Dataset EV2).
- Gene Set Enrichment Analysis (GSEA) shows that the Mucinous Lung Tumor Signature is significantly enriched in TCGA‐human IMA specimens (nine cases) compared to TCGA‐normal lung specimens (nine cases). 141 genes out of the 143 genes were used for the analysis since the TCGA LUAD data do not include MUC5AC and MUC3A/B. ES and P were the “Enrichment Score” and “Nominal P‐value”, respectively, generated by GSEA.
- Five out of the nine cases of TCGA‐human IMA patient cases were highly clustered in 230 TCGA LUAD cases, including IMA and non‐IMA cases, based on the Mucinous Lung Tumor Signature of the 141 genes. Top panel, pathology (red indicates IMA cases), driver gene mutations (fusion or mutation), sex, smoking status, and tumor stage are shown in y‐axis. X‐axis indicates 230 patient cases from the TCGA LUAD datasets. Bottom panel, expression level of the 141 genes in the Mucinous Lung Tumor Signature is shown (y‐axis, the 141 genes). X‐axis is as described above.
- The nine human IMA patient cases from the TCGA LUAD datasets expressed the 140 genes out of the 141 genes (TNFSF18 was not expressed). The Mucinous Lung Tumor Signature of the 141 genes clustered the IMA cases harboring KRAS mutation differentially from those harboring fusions and wild‐type KRAS.
Figure EV1. Taqman qPCR validation of differentially regulated genes in human IMA compared to normal lung tissues.

- Mucin genes (MUC5AC, MUC5B, and MUC3A/B) were significantly induced in human IMA (n = 7) compared to normal lung tissues (n = 6).
- Transcription factors SPDEF, FOXA3, and HNF4A but not NKX2‐1 were significantly induced in human IMA (n = 7) compared to normal lung tissues (n = 6).
- Immune checkpoint gene VTCN1 but not PD‐L1 was significantly induced in human IMA (n = 7) compared to normal lung tissues (n = 6).
Figure EV2. 143 genes that were commonly expressed in both mouse and human IMA constitute the Mucinous Lung Tumor Signature.

Shown are the 143 genes induced in the two IMA mouse models (Maeda et al, 2012; Snyder et al, 2013) and human IMA.
Since mouse IMA is considered to be a lung tumor with gastric differentiation (Snyder et al, 2013), we sought to determine whether the Mucinous Lung Tumor Signature is enriched in human gastric cancers. We retrieved the RNA‐seq data of 598 cancer cell lines, including gastric and other cancer cell lines (Dataset EV4; Klijn et al, 2015), assessed the expression of the signature genes in the groups of the cell lines (Fig 2A) and calculated the GSEA enrichment for the signature in different cancer types (Fig 2B). Consistent with a previous report (Snyder et al, 2013), the signature was highly enriched in human stomach and colorectal cancer cells (Enrichment Score = 0.79 and 0.81, respectively). The signature was also highly enriched in human LUAD (Enrichment Score = 0.76), suggesting that human IMA maintains a lung lineage though it is morphologically distinct from non‐mucinous LUAD. Unexpectedly, the signature was also highly enriched in human pancreatic and breast cancers (Enrichment Score = 0.78 and 0.73, respectively). Similar to IMA, pancreatic and breast cancers produce mucins (Kufe, 2009). These results suggest that human IMA harbors a unique gene expression profile including not only gastric genes but also other genes expressed in mucin‐producing cancers.
Figure 2. The Mucinous Lung Tumor Signature is highly enriched in colorectal, stomach, pancreatic, lung (adenocarcinoma; LUAD), and breast cancers.

- Expression of the Mucinous Lung Tumor Signature genes (143 genes) in different cancers is shown. RNA‐seq data from different cancers were obtained from multiple cancer cell lines (n = 598, Dataset EV4), which were reported previously (Klijn et al, 2015). Gene expression was measured in RPKM quantile‐normalized and log2‐transformed. The minimum of log2‐transformed values was set to 0. The expression of a signature gene in a tissue group (cancer type) was measured as the average of the log2‐transformed gene expression in the cell lines of the tissue group. Hierarchical clustering was performed using Pearson's correlation‐based distance and average linkage.
- Mucinous Lung Tumor Signature enrichment score for different cancers using Gene Set Enrichment Analysis (GSEA) is shown. Using the lymphoid cell lines as control, colorectal, stomach, lung AD, pancreas, breast, urinary bladder, head–neck, lung SqCC, and ovarian cancers were highly enriched with the Mucinous Lung Tumor Signature. Lung_AD: lung adenocarcinoma; Lung_LCC: lung large cell carcinoma; Lung_SqCC: lung squamous cell carcinoma; Lung_SCLC: small cell lung cancer.
An immune checkpoint VTCN1 but not PD‐L1 is expressed in human IMA
Among the signature genes (Figs 1B and EV2, red rectangles), we identified an immune checkpoint VTCN1 (also known as B7‐H4). Recent successes on cancer immunotherapy targeting the immune checkpoint PD‐1 and/or PD‐L1 (also known as B7‐H1 or CD274) by therapeutic antibodies indicate that activating the immune system is beneficial for treating NSCLC in patients whose lung tumors express PD‐L1 (Herbst et al, 2014; Garon et al, 2015; Hirsch et al, 2016; Smyth et al, 2016). VTCN1 is also expected to be an antibody‐mediated therapeutic target for breast cancer (Leong et al, 2015; Smyth et al, 2016).
Thus, we further investigated the expression of the immune checkpoints VTCN1 together with PD‐L1 in human IMA. The expression of VTCN1 mRNA was higher in human IMA than in normal control lung tissues; however, the expression of PD‐L1 mRNA was not induced in human IMA compared to normal control lung tissues (Figs 1A and EV1). The expression of VTCN1 protein was observed in 64% of human IMA, while the expression of PD‐L1 protein was not observed in a majority of human IMA (< 10%; Fig 3A and B, and Dataset EV1). A binomial test indicates that the absence of PD‐L1 but not that of VTCN1 is significant in human IMA (one‐tailed binomial test: P‐value = 1.794E‐05). Next, we investigated the association of VTCN1 or PD‐L1 with genes expressed in human IMA using two RNA‐seq datasets from 105 NSCLC cell lines (Klijn et al, 2015) and 230 TCGA LUAD cases (Cancer Genome Atlas Research Network, 2014). 38 genes out of the top 200 VTCN1‐highly correlated genes in the 105 NSCLC cell lines were induced in human IMA, while only seven out of the top 200 PD‐L1‐highly correlated genes in the 105 NSCLC cell lines were induced in human IMA (Fig 3C, left panel and Dataset EV5). A similar association was observed using the 230 TCGA LUAD cases (Fig 3C, right panel and Dataset EV5), suggesting a gene signature associated with VTCN1, rather than with PD‐L1, is related to human IMA. An unbiased clustering analysis using the RNA‐seq dataset from the 105 NSCLC cell lines indicated that VTCN1 positively correlated with a mucinous marker MUC5B while PD‐L1 negatively correlated with HNF4A, another mucinous marker (Fig 3D and E). A similar analysis using the RNA‐seq dataset from the 230 TCGA LUAD cases indicated that VTCN1 positively correlated with HNF4A, while PD‐L1 negatively correlated with FOXA3 and SPDEF (Fig 3F and G). These results suggest that VTCN1 is a better cancer immunotherapeutic target for human IMA than PD‐L1.
Figure 3. VTCN1 but not PD‐L1 is expressed in human IMA .

- Shown is immunohistochemistry (IHC) detecting VTCN1 but not PD‐L1 in human IMA. Alcian blue detects mucus. Scale bar: 50 μm. Insets show higher magnification of regions indicated by arrows.
- 64% of the human IMA expressed VTCN1 but most of the human IMA did not express PD‐L1 as determined by IHC.
- Left panel, genes highly correlated with VTCN1 or PD‐L1 in NSCLC cell lines (n = 105; Klijn et al, 2015) were assessed as to whether they are expressed in human IMA. 38 genes highly correlated with VTCN1 were expressed in human IMA. However, only seven genes highly correlated with PD‐L1 were expressed in human IMA. Right panel, likewise, 28 genes highly correlated with VTCN1 in the TCGA LUAD cases (n = 230; Cancer Genome Atlas Research Network, 2014) were expressed in human IMA but only 1 gene highly correlated with PD‐L1 was expressed in human IMA. Red indicates genes in the Mucinous Lung Tumor Signature (the 143 genes).
- Hierarchical clustering of the expression of IMA‐related genes and cell type markers in the NSCLC cell lines (n = 105; Klijn et al, 2015). Genes in red color: pro‐mucous genes. Genes in green color: anti‐mucous genes.
- VTCN1 but not PD‐L1 positively correlates with a mucous gene marker MUC5B in the NSCLC cell lines (n = 105; Klijn et al, 2015). Of note, the anti‐mucous transcription factor NKX2‐1 was correlated with the pro‐mucous transcription factor SPDEF in the 105 human NSCLC cell lines; however, NKX2‐1 was not correlated with SPDEF when 41 cell lines that lack the expression of both NKX2‐1 and SPDEF (RPKM ≤ 1) were excluded from the calculation, suggesting that the positive correlation was seen due to the large number of the cell lines that lack the expression of both NKX2‐1 and SPDEF. Genes in red color: pro‐mucous genes. Genes in green color: anti‐mucous genes.
- Hierarchical clustering of the expression of IMA‐related genes and cell type markers in the TCGA LUAD cases (n = 230; Cancer Genome Atlas Research Network, 2014). Red indicates specimens with IMA pathology. Genes in red color: pro‐mucous genes. Genes in green color: anti‐mucous genes.
- VTCN1 but not PD‐L1 positively correlates with a mucinous tumor marker HNF4A in the TCGA LUAD cases (n = 230; Cancer Genome Atlas Research Network, 2014). Overall, VTCN1 but not PD‐L1 associates with mucous gene markers. Genes in red color: pro‐mucous genes. Genes in green color: anti‐mucous genes.
NKX2‐1 induces PD‐L1 in human mucinous lung cancer cells
In the analysis using the RNA‐seq data from the 105 NSCLC cell lines, PD‐L1 positively correlated with NKX2‐1 (Fig 3E), a transcription factor absent in human IMA (Travis et al, 2011). Our ChIP‐seq and cDNA microarray analyses indicated that ectopic NKX2‐1 bound to the locus of PD‐L1/PD‐L2 (Fig 4A and Appendix Fig S1) and induced the expression of PD‐L1 and PD‐L2 in mucus‐producing A549 human lung carcinoma cells (Fig 4B; Maeda et al, 2012), which was also confirmed at the protein level in A549 cells and other mucus‐producing lung cancer cell lines (Fig 4C and D). Next, we assessed whether PD‐L1 is expressed in NKX2‐1‐expressing tumor cells in human NSCLC specimens (Dataset EV1). Among the NKX2‐1‐positive tumor cases, 29% (20 out of 68) expressed PD‐L1 (Fig 4E and F). Among the NKX2‐1‐negative tumor cases, only 12% (nine out of 72) expressed PD‐L1 (Fig 4E and F). These results indicate that NKX2‐1 co‐localizes with PD‐L1 in a significant portion of human NSCLC cells (two‐tailed Fisher's exact test: P‐value = 2.078E‐02). Using immunohistochemistry, it has been shown that IMA lacks the expression of NKX2‐1 (Travis et al, 2011). We found that 23% (27 out of 116) of human non‐IMA cases expressed PD‐L1 (Fig 4G and H), while only 8% (two out of 24) of human IMA cases expressed PD‐L1 (Fig 4G and H, excluding non‐mucinous tumor cells heterogeneously existing with mucinous tumor cells), suggesting that PD‐L1 is rarely expressed in human IMA. In addition, HNF4A (a negative downstream gene of NKX2‐1; Maeda et al, 2012) that is expressed in human IMA was negatively correlated with NKX2‐1 and PD‐L1 in the 105 NSCLC cell lines (Fig 3E) and the 230 TCGA LUAD cases (Fig 3G), further suggesting a negative association of PD‐L1 with human IMA.
Figure 4. NKX2‐1 induces PD‐L1 in human mucinous lung cancer cell lines.

- A549 cells were infected with Nkx2‐1‐expressing lentivirus as previously reported (Maeda et al, 2012). ChIP‐seq indicates that NKX2‐1 bound to the locus of PD‐L1 and PD‐L2.
- PD‐L1 and PD‐L2 mRNAs were significantly induced by NKX2‐1. Results are expressed as mean ± SEM of biological triplicates for each group. P < 0.05 versus control was considered significant (Student's t‐test). Gene expression was normalized by comparison with the constitutive expression of GAPDH. Control: control lentivirus; Nkx2‐1: Nkx2‐1‐expressing lentivirus.
- A549 cells stably expressing Nkx2‐1 were developed as described in (A) and (B). Protein expression was confirmed by IB. PD‐L1 was detected by antibodies from Cell Signaling (CST), Spring Bioscience (Spring) and Sino Biological (Sino) as described in Materials and Methods. ACTA1 was used as a loading control. Shown is a representative image from three independent experiments. NKX2‐1 induced PD‐L1 in A549 cells.
- H2122, Calu‐3, and H292 mucus‐producing lung cancer cells were infected with control lentivirus or Nkx2‐1‐expressing lentivirus. Protein expression was confirmed by IB. PD‐L1 antibody from Cell Signaling (CST) was used to detect PD‐L1 protein. ACTA1 was used as a loading control. Shown is a representative image from two independent experiments. NKX2‐1 induced PD‐L1 in the mucus‐producing lung cancer cells.
- NKX2‐1 (black) was expressed in the nucleus of non‐mucinous lung tumor cells (non‐IMA) but not in mucinous lung tumor cells (IMA) in human. Scale bar: 50 μm.
- PD‐L1 was expressed in NKX2‐1‐positive lung tumor cells compared to NKX2‐1‐negative lung tumor cells in human (two‐tailed Fisher's exact test: P‐value = 2.078E‐02). PD‐L1‐positive cases include > 5% of tumor cells expressing PD‐L1 in cell membrane.
- PD‐L1 (black) was expressed in cell membranes of non‐mucinous lung tumor cells (non‐IMA) but not in mucinous lung tumor cells (IMA) in human. Scale bar: 50 μm.
- PD‐L1 was expressed in non‐mucinous lung tumor cells (non‐IMA) but not in mucinous lung tumor cells (IMA) in human. PD‐L1‐positive cases were determined as described in (F).
Source data are available online for this figure.
FOXA3 or SPDEF along with KRASG12D induces mucinous lung tumors in vivo
The Mucinous Lung Tumor Signature included the pro‐mucous transcription factors FOXA3 and SPDEF (Figs 1 and EV2, and Dataset EV3), which were among the top 50 genes highly induced in human IMA (Fig 5A and Dataset EV2). FOXA3 or SPDEF induces mucus‐producing goblet cells in airway lung epithelial cells in transgenic mouse models (Park et al, 2007; Chen et al, 2014). FOXA3 was expressed in the nucleus of mucinous tumor cells in 86% (12 out of 14) of human IMA (Fig 5B and Dataset EV1). In conditional transgenic mouse models (Fig EV3A), induction of FOXA3 or SPDEF along with KRASG12D in lung epithelium resulted in the production of mucinous lung tumors (Figs 5C and D, and EV3, and Dataset EV6). Although both transgenic mouse models developed mucinous lung tumors, induction of SPDEF along with KRASG12D produced malignant mucinous lung tumors (tubulopapillary‐like carcinoma), while induction of FOXA3 along with KRASG12D produced benign mucinous lung tumors (e.g., papilloma). The induction of FOXA3 or SPDEF without KRASG12D induced airway goblet cells but not mucinous lung tumors (Fig 5C and D and Dataset EV6), which is consistent with previous reports (Park et al, 2007; Chen et al, 2014). KRASG12D itself induced lung tumors but not mucinous lung tumors (Figs 5C and D, and EV3B, and Dataset EV6), which is also consistent with previous reports (Fisher et al, 2001; Maeda et al, 2012). These results suggest that FOXA3 or SPDEF along with mutant KRAS may be sufficient to induce mucinous lung tumors in human IMA.
Figure 5. FOXA3 or SPDEF produces mucinous lung tumors in the presence of KRASG 12D in transgenic mouse models.

- Shown are the top 50 genes highly expressed in human IMA. Transcription factors FOXA3 and SPDEF (red) were highly expressed in human IMA.
- Left panel, FOXA3 is expressed in the nucleus of human IMA but not in adjacent normal lung tissue. H&E: hematoxylin and eosin stain. Alcian blue detects mucus. Scale bar: 50 μm. Insets show higher magnification of regions indicated by arrows. Right panel, most of the human IMA express FOXA3.
- KRASG12D and/or FOXA3 are induced in lung epithelium upon doxycycline administration in a tet‐on transgenic mouse model (see Fig EV3 and Dataset EV6). Benign mucinous lung tumors (papilloma) were developed in the presence of both KRASG12D and FOXA3 around 6 months after doxycycline administration. H&E: hematoxylin and eosin stain. Alcian blue detects mucus. Scale bar: 50 μm. Insets show higher magnification of regions indicated by arrows.
- KRASG12D and/or SPDEF are induced in lung epithelium upon doxycycline administration in a tet‐on transgenic mouse model (see Fig EV3 and Dataset EV6). Malignant mucinous lung tumors (tubulopapillary‐like carcinoma) were developed in the presence of both KRASG12D and SPDEF around 4 months after doxycycline administration. H&E: hematoxylin and eosin stain. Alcian blue detects mucus. Scale bar: 50 μm. Insets show higher magnification of regions indicated by arrows.
Figure EV3. FOXA3 or SPDEF drives mucinous lung tumors in KRASG 12D lung tumor mouse model.

- Shown are schemes for the conditional lung cancer mouse model (upper panel) and the timing of doxycycline administration (lower panel). Rat Scgb1a1 (also known as CCSP) promoter (line 2) is active in mouse Club (also known as Clara) and alveolar type II cells (Perl et al, 2009). Doxycycline induces FOXA3 or SPDEF along with KRASG12D only in lung epithelial Club and alveolar type II cells.
- FOXA3 (left panel) or SPDEF (right panel) along with KRASG12D induced mucinous lung tumors in vivo. SPDEF along with KRASG12D induced malignant lung tumors (tubulopapillary‐like carcinoma). AAH: atypical adenomatous hyperplasia (a putative precursor lesion of adenocarcinoma of the lung). The tumor criteria are modified from Sutherland et al (2014). Percentage of tumor types was obtained by analyzing number and types of lung tumors on each lung section from five different mice in each group. P < 0.05 versus Scgb1a1‐rtTA;[tetO]‐Kras G12D was considered significant (Student's t‐test).
- Transgenic mice expressing KRASG12D and FOXA3 (Scgb1a1‐rtTA;[tetO]‐Kras G12D ;[tetO]‐Foxa3) in lung epithelium survived significantly longer than mice expressing only KRASG12D (Scgb1a1‐rtTA;[tetO]‐Kras G12D; left panel), while mice expressing KRASG12D and SPDEF (Scgb1a1‐rtTA;[tetO]‐Kras G12D ;[tetO]‐Spdef) in lung epithelium survived significantly shorter than mice expressing only KRASG12D (Scgb1a1‐rtTA;[tetO]‐Kras G12D; right panel). Kaplan–Meier survival analysis was performed using Prism 6. Statistical significance was obtained by log‐rank (Mantel–Cox) test. P < 0.05 versus Scgb1a1‐rtTA;[tetO]‐Kras G12D was considered significant. See Dataset EV6 for further details.
Anti‐mucous NKX2‐1 and pro‐mucous FOXA3, SPDEF and HNF4A differentially regulate IMA‐related genes in human lung cancer cells
Next, we sought to determine whether FOXA3 or SPDEF recapitulates the in vivo function in human lung cancer cells that harbor a KRAS mutation. FOXA3 or SPDEF independently induced the mucin genes MUC5AC and MUC5B, biomarkers for IMA, in human A549 lung carcinoma cells that harbor a KRAS mutation (Fig 6A–C; Chen et al, 2014), suggesting that FOXA3 or SPDEF along with mutant KRAS intrinsically drives a mucinous phenotype in human IMA as well. In addition to MUC5AC and MUC5B, differential gene expression analysis using RNA‐seq identified 17 IMA‐related genes induced by SPDEF and FOXA3 in common in A549 cells (Fig 6D, red and Dataset EV7; all of the genes shown in Fig 6D are genes induced in human IMA; see Dataset EV2).
Figure 6. Anti‐mucous (NKX2‐1) and pro‐mucous (FOXA3, SPDEF, and HNF4A) transcription factors differentially regulate mucin gene expression in human lung cancer cells.

- Lentivirus expressing Nkx2‐1 inhibited SPDEF, FOXA3, and HNF4A protein expression in A549 cells. SPDEF induced FOXA3 but inhibited HNF4A. FOXA3 induced SPDEF and HNF4A (three independent experiments). Constitutively expressed ACTA1 protein was used as a loading control. Endogenous SPDEF is marked by *.
- MUC5AC and MUC5B mRNAs were inhibited by NKX2‐1 and induced by SPDEF and FOXA3. Gene expression was normalized by comparison with the constitutive expression of GAPDH. Results are expressed as mean ± SEM of biological triplicates for each group. P < 0.05 versus control was considered significant (Student's t‐test).
- A549 cells were infected with control or SPDEF‐expressing lentivirus. Control or SPDEF‐expressing A549 cells were transfected with control or FOXA3 siRNA. Three days after transfection, RNA was extracted from the A549 cells. The RNA was used for Taqman gene expression qPCR analysis as described in Materials and Methods. Gene expression was normalized by comparison with the constitutive expression of GAPDH. Results are expressed as mean ± SEM of experimental triplicates for each group. SPDEF‐expressing lentivirus significantly induced mRNA expression of SPDEF, FOXA3, MUC5AC, and MUC5B in the presence of control siRNA (P < 0.05 was considered significant on SPDEF virus versus control virus; Student's t‐test). FOXA3 siRNA significantly reduced the endogenous expression of FOXA3 mRNA (# P < 0.05 compared to control siRNA is considered significant). SPDEF significantly induced the expression of MUC5AC and MUC5B in the presence of FOXA3 siRNA (P < 0.05 was considered significant on SPDEF virus versus control virus; Student's t‐test). Two independent experiments were performed.
- A549 cells expressing NKX2‐1 (Maeda et al, 2012) were infected with control lentivirus or lentivirus expressing SPDEF or Foxa3. Differentially expressed genes from biological triplicates were analyzed by RNA‐seq as described in Materials and Methods. Among the genes induced by SPDEF or FOXA3 in A549 cells, genes also expressed in human IMA are shown. Among the genes reduced by NKX2‐1 in A549 cells (Maeda et al, 2012), genes also expressed in human IMA are also shown. Genes in red are induced by both SPDEF and FOXA3. Among the genes in red, AGR2, BACE2, HKDC1, MUC5AC, MUC5B, and SPDEF were also reduced by NKX2‐1. Genes in green were induced by FOXA3 and reduced by NKX2‐1.
- Left panel, lentivirus expressing Hnf4a inhibited SPDEF and FOXA3 protein expression in A549 cells (two independent experiments). ACTA1 was used as a loading control. Endogenous SPDEF is marked by *. Right panel, MUC5AC and MUC5B mRNAs were inhibited by HNF4A. Gene expression was normalized by comparison with the constitutive expression of GAPDH. Results are expressed as mean ± SEM of biological triplicates for each group. P–value < 0.05 versus control was considered significant (Student's t‐test). MUC3 mRNA was induced by HNF4A (Taqman products were run on a gel due to no expression in control). The expression of GAPDH mRNA is shown as control.
- Summary of mucin gene regulation by mucus‐related transcription factors (anti‐mucous transcription factor NKX2‐1; pro‐mucous transcription factors FOXA3, SPDEF and HNF4A) in non‐IMA or IMA.
Source data are available online for this figure.
HNF4A was previously identified as a marker for mouse and human IMA (Maeda et al, 2012; Snyder et al, 2013; Sugano et al, 2013); however, its regulation in human IMA is not well known. As we reported previously, HNF4A was repressed by NKX2‐1 at the mRNA level (Maeda et al, 2012) and at the protein level as well (Fig 6A). Unexpectedly, HNF4A was repressed by SPDEF but induced by FOXA3 (Fig 6A). There is a group of such genes that are induced by FOXA3 but not by SPDEF (Fig 6D, green). Next, we sought to determine the function of HNF4A in A549 cells. HNF4A inhibited the expression of MUC5AC and MUC5B but induced MUC3 (Fig 6E), which recapitulates a role of HNF4A in mouse intestine in vivo that was reported previously (Ahn et al, 2008). These results indicate that transcription factors expressed in human IMA differentially regulate the expression of IMA‐related genes, including mucins, in part by recapitulating intestinal gene regulation (Figs 6E and EV4).
Figure EV4. Regulation of transcription factors (TF) involved in mucin gene expression in human IMA .

SPDEF binds to the functional enhancer regions in non‐coding loci of MUC5AC and MUC5B
Previously, our ChIP‐seq analyses determined that NKX2‐1 and FOXA3 bound to the locus of MUC5AC in A549 lung carcinoma cells and BEAS‐2B transformed bronchial epithelial cells (Maeda et al, 2012; Chen et al, 2014), suggesting that the expression of MUC5AC is directly regulated by NKX2‐1 and FOXA3. However, it is unknown whether SPDEF directly binds to the loci of MUC5AC and/or MUC5B in lung carcinoma cells. Thus, we performed ChIP‐seq to identify SPDEF binding sites in A549 cells (Figs 7, 8, and EV5). SPDEF bound to the non‐coding upstream regions of MUC5AC and MUC5B (Figs 7A, 8A, and EV5), which is in part consistent with SPDEF binding sites identified by ChIP‐seq using a MCF7 breast adenocarcinoma cell line (Figs 7A, 8A, and EV5; Fletcher et al, 2013). SPDEF binding regions on the MUC5AC and MUC5B loci were ~7 kb and ~3 kb away, respectively, from transcription start sites and distant from proximal promoter regions, including CRE and Sp1 binding sites (Figs 7B, 8B, and EV5; Choi et al, 2011; Kreda et al, 2012). Interestingly, the SPDEF binding site located in the ~3 kb upstream region of MUC5B contained rs35705950, a SNP that was previously reported as associated with idiopathic pulmonary fibrosis, in which the lung hypersecretes MUC5B (Fig 8B; Seibold et al, 2011). In order to determine whether the upstream regions bound by SPDEF are required for MUC5AC and MUC5B gene expression, we deleted these regions in A549 cells using CRISPR/Cas9 with two independent sgRNAs for each region (Figs 7A–C and 8A–C). The expression of MUC5AC in A549 cells that lack the upstream region (535 bp) of MUC5AC (Fig 7D, Deleted) was significantly reduced compared to that in control A549 cells (Fig 7D, Control; 94% reduction). The expression of AGR2, FOXA3, MUC5B, and SPDEF in the A549 (Fig 7D, Deleted) cells was similar to that in the A549 (Fig 7D, Control) cells. Likewise, the expression of MUC5B in A549 cells that lack the upstream region (746 bp) of MUC5B (Fig 8D, Deleted) was significantly reduced compared to that in control A549 cells (Fig 8D, Control; 87% reduction). The expression of AGR2, FOXA3, MUC5AC, and SPDEF in the A549 (Fig 8D, Deleted) cells was similar to that in the A549 (Fig 8D, Control) cells. These results indicate that the upstream regions bound by SPDEF contain functional enhancer elements required for the expression of MUC5AC and MUC5B in human IMA.
Figure 7. The upstream region of MUC5AC bound by SPDEF is required for the expression of MUC5AC in human lung cancer cells.

- Top panel, ChIP‐seq was performed twice using SPDEF antibody and chromatin from A549 cells as described in Materials and Methods. The SPDEF binding site was identified in the upstream region of the MUC5AC gene in A549 lung carcinoma cells (duplicate) and MCF7 breast adenocarcinoma cells (triplicate). Chr, chromosome. F (forward) and R (reverse) arrows indicate the primer locations to amplify the genome region that is bound by SPDEF. Bottom panel, two sgRNAs were designed to delete the SPDEF binding region.
- The non‐coding upstream region of MUC5AC that harbors different transcription factor‐binding sites. Red scissors indicate the locations where CRISPR/Cas9 made DNA double‐strand breaks.
- Three independent clones where precise deletion of the region (*) occurred. F (forward) and R (reverse) primers based on (A) were used to amplify the region that was bound by SPDEF.
- Only MUC5AC mRNA, but not other mucus‐related gene mRNAs, was significantly reduced in the three clones compared to the control (vector only) A549 cells. Gene expression was normalized by comparison with the constitutive expression of GAPDH. Results are expressed as mean ± SEM of biological replicates for each group. P < 0.05 versus control was considered significant (Student's t‐test). Untreated, no transfection (7 clones); control, vector only (eight clones); deleted, vector with sgRNAs (three clones).
Figure 8. The upstream region of MUC5B bound by SPDEF is required for the expression of MUC5B in human lung cancer cells.

- Top panel, ChIP‐seq was performed twice using SPDEF antibody and chromatin from A549 cells as described in Materials and Methods. The SPDEF binding site was identified in the upstream region of the MUC5B gene in A549 lung carcinoma cells (duplicate) and MCF7 breast adenocarcinoma cells (triplicate). Chr, chromosome. F (forward) and R (reverse) arrows indicate the primer locations to amplify the genome region that is bound by SPDEF. Bottom panel, two sgRNAs were designed to delete the SPDEF binding region.
- The non‐coding upstream region of MUC5B that harbors different transcription factor‐binding sites. Red scissors indicate the locations where CRISPR/Cas9 made DNA double‐strand breaks. The SNP rs35705950 is seen in idiopathic pulmonary fibrosis patients who hypersecrete MUC5B (Seibold et al, 2011).
- Four independent clones that have precise deletion of the region (*) were obtained. F (forward) and R (reverse) primers based on (A) were used to amplify the region that was bound by SPDEF.
- Only MUC5B mRNA, but not other mucus‐related gene mRNAs, was significantly reduced in the four replicate clones compared to the control (vector only) A549 cells. Gene expression was normalized by comparison with the constitutive expression of GAPDH. Results are expressed as mean ± SEM of biological replicates for each group. P < 0.05 versus control was considered significant (Student's t‐test). Untreated, no transfection (seven clones); control, vector only (eight clones); deleted, vector with sgRNAs (four clones).
Figure EV5. ChIP‐seq analysis identifying SPDEF binding sites in A549 human lung carcinoma cells.

- Distribution of SPDEF binding sites in genome (genome in general vs. SPDEF ChIP). SPDEF binding sites are located in promoter and 5′‐UTR.
- Shown is a UCSC genome browser view of ChIP‐seq indicating SPDEF binding sites (A549‐SPDEF_IP) along with Input (A549_SPDEF_Input) at the locus of MUC5AC. The data of two biological replicates are shown. ChIP‐seq was performed using SPDEF antibody and chromatin from A549 cells infected with SPDEF‐expressing lentivirus as described in Materials and Methods. Chr, chromosome.
- UCSC genome browser view is shown as described in (C) except ChIP‐seq indicating SPDEF binding sites (A549_SPDEF_IP) along with Input (A549_SPDEF_Input) at the locus of MUC5B. ChIP‐seq was performed as described above. Chr, chromosome.
- ChIP‐qPCR showing SPDEF or IgG fold enrichment in A549 cells infected with SPDEF‐expressing lentivirus as described in Materials and Methods. Results are expressed as mean ± SEM of experimental triplicates for each group. P < 0.05 versus IgG control was considered significant (Student's t‐test). Two independent experiments were performed. The SPDEF binding to the loci of MUC5AC and MUC5B but not that of ACTB was confirmed.
Discussion
Using gene expression profiles from mouse models and human IMA specimens, we determined a Mucinous Lung Tumor Signature of genes for human IMA. Our analysis led to the identification of “druggable” molecular targets, including an immune checkpoint VTCN1, that are expressed in human IMA. We further determined that the transcription factor FOXA3 or SPDEF in the presence of mutant KRAS produced mucinous lung tumors in vivo. We investigated the molecular mechanisms by which mucin gene expression is regulated in human IMA and demonstrated that the upstream regions of MUC5AC and MUC5B, which are bound by SPDEF, were required for the expression of MUC5AC and MUC5B in A549 cells that harbor a KRAS mutation. The Mucinous Lung Tumor Signature and mouse models that we developed will be useful to identify therapeutic targets and for preclinical testing of novel strategies to treat human IMA.
Multiple reports suggest that treatment success using therapeutic antibodies targeting an immune checkpoint PD‐L1 or PD‐1 depends on the expression of PD‐L1 in lung tumors, including tumor cells and/or tumor‐associated cells (Herbst et al, 2014; Garon et al, 2015; Hirsch et al, 2016). In our analysis using RNA‐seq data from six human IMA specimens and immunohistochemistry from 24 human IMA specimens, PD‐L1 was rarely expressed in human IMA (Figs 1, 3, and 4). We further investigated the expression of PD‐L1 at the mRNA level using RNA‐seq data from the 105 human NSCLC cell lines (Klijn et al, 2015) and the 230 TCGA LUAD cases (Cancer Genome Atlas Research Network, 2014). We used these two datasets in order to compensate for the limitations of the individual datasets. The datasets from the 105 human NSCLC cell lines represent gene expression profiles of isolated lung tumor cells; however, these might be different from lung tumor cells in an intact tumor microenvironment since these cell lines were established after multiple passages on plastic dishes. The datasets from the 230 TCGA LUAD cases represent gene expression profiles of intact lung tumors; hence, they are the combined gene expression profiles of not only lung tumor cells but also tumor‐associated fibroblasts, endothelial, and immune cells. This mixture of expression profiles from tumor and tumor‐associated cells makes it difficult to assess whether the association of PD‐L1 with genes expressed in human IMA occurs in lung tumor cells and/or other tumor‐associated cells. Thus, analysis using the two datasets provides a more comprehensive assessment of gene‐to‐gene correlation than that using only one dataset. In our analysis, PD‐L1 was not correlated with genes expressed in human IMA in either dataset compared to another immune checkpoint VTCN1 (Fig 3). These results suggest that PD‐L1 is rarely expressed in human IMA. Transcription factors such as STAT1, NF‐κB, IRF1, STAT3, AP‐1, and MYC have been shown to activate PD‐L1 (Liang et al, 2003; Loke & Allison, 2003; Lee et al, 2006; Marzec et al, 2008; Green et al, 2012; Casey et al, 2016); however, such transcription factors are ubiquitously expressed, which does not explain the mechanism by which PD‐L1 is rarely expressed in human IMA. Our present data show that NKX2‐1, which is absent in IMA (Travis et al, 2011), induced PD‐L1 in mucinous lung cancer cells in vitro (Fig 4), suggesting that the lack of PD‐L1 in IMA may be due to the absence of NKX2‐1.
Contrary to the lack of expression of PD‐L1 (B7‐H1) in IMA, another immune checkpoint VTCN1 (B7‐H4) was highly expressed in a portion of IMA at the mRNA and protein levels (Figs 1, 3, EV1, and EV2), which suggests that VTCN1 but not PD‐L1 may be a better therapeutic immune checkpoint to target IMA. Though VTCN1 was more correlated with mucous gene markers than PD‐L1 (Fig 3C), VTCN1 was not regulated by the transcription factor SPDEF, FOXA3, or NKX2‐1 in A549 lung carcinoma cells (Dataset EV7; Maeda et al, 2012; of note, A549 cells do not express endogenous VTCN1). SPDEF did not bind to the locus of VTCN1 in A549 cells (Appendix Fig S2A), further suggesting that SPDEF does not regulate the expression of VTCN1 in A549 cells. In addition, regardless of the expression of FOXA3, VTCN1 was expressed in human IMA (Appendix Fig S2B), also suggesting that FOXA3 may not regulate the expression of VTCN1. The transcriptional regulation of VTCN1 is not well understood compared to that of PD‐L1. Recently, HIF1A has been shown to induce VTCN1 in multiple myeloma, cervical, and breast cancer cell lines (Jeon et al, 2015), which may be a part of the mechanism by which VTCN1 is regulated in IMA. As shown in Fig 3C, a transcription factor ELF3, which is expressed in human IMA, was highly correlated with VTCN1 in both the 105 human NSCLC cell lines (Klijn et al, 2015) and the 230 TCGA LUAD cases (Cancer Genome Atlas Research Network, 2014), suggesting that ELF3 may be a regulator of VTCN1. Further studies using additional IMA cell lines other than A549 cells are required to elucidate the mechanism by which VTCN1 is regulated in IMA.
In the present study, we determined that SPDEF or FOXA3 along with mutant KRAS induces autochthonous mucinous lung tumors in transgenic mice. SPDEF has been reported to be overexpressed and to promote tumor growth in breast, ovarian, and prostate cancers (Ghadersohi & Sood, 2001; Gunawardane et al, 2005; Rodabaugh et al, 2007; Sood et al, 2007; Buchwalter et al, 2013), while paradoxically SPDEF has also been reported to function as a tumor suppressor in breast, ovarian, prostate, and colon cancers (Feldman et al, 2003; Gu et al, 2007; Ghadersohi et al, 2008; Turner et al, 2008; Noah et al, 2013; Cheng et al, 2014). The inconsistent results in breast, ovarian, and prostate cancers might be the result of using various models with different tumor cell types harboring distinct tumorigenic pathways in those cancer groups. In our study, SPDEF was highly expressed in human IMA (Figs 1 and EV1). Transgenic mice that conditionally express SPDEF along with mutant KRAS (KRASG12D) in lung epithelium had a shorter survival time than the mice that express only KRASG12D (Fig EV3C, right panel). SPDEF along with KRASG12D induced malignant mucinous lung tumors (tubulopapillary‐like carcinoma; Fig EV3B), while KRASG12D itself induced benign non‐mucinous lung tumors (Fig EV3B). These results indicate that SPDEF promotes mutant KRAS lung tumorigenesis. On the contrary, FOXA3 was reported to inhibit the growth of hepatocellular carcinoma cells in vitro (Ding et al, 2014). In our study, FOXA3 was highly expressed in human IMA (Figs 1, 5, and EV1); however, transgenic mice that conditionally express FOXA3 along with KRASG12D in lung epithelium survived longer than the mice that express only KRASG12D (Fig EV3C). FOXA3 along with KRASG12D induced benign mucinous lung tumors (Fig EV3B). These results suggest that FOXA3 itself may not promote the progression of mutant KRAS lung tumors. Although either SPDEF or FOXA3 along with mutant KRAS induces mucinous lung tumors in vivo, their roles in mutant KRAS‐driven lung tumorigenesis (e.g., invasiveness) might be different. Further studies including development of transgenic mice expressing both SPDEF and FOXA3 simultaneously along with mutant KRAS may be required to determine the in vivo function of SPDEF and FOXA3 in human IMA. In addition, our study shows the importance of assessing IMA in a transgenic mouse model that develops autochthonous mucinous lung tumors in an intact lung structure rather than in a xenograft model in which the consequences of tumor growth and invasion on lung function cannot be assessed.
To our knowledge, there are at least seven different types of mouse models that develop mucinous lung tumors: (i) Kras G12D/Cdkn2a −/− (Fisher et al, 2001); (ii) transgenic Tle1 (Allen et al, 2006); (iii) Kras G12D/Nkx2‐1 +/− or Kras G12D/Nkx2‐1 flox/flox (Maeda et al, 2012; Snyder et al, 2013); (iv) Kras G12D/Runx3 flox/flox (Lee et al, 2013); (v) Kras G12D/Tp53 flox/flox/Eed flox/flox (Serresi et al, 2016); (vi) Kras G12D/transgenic Foxa3 (present study); and (vii) Kras G12D/transgenic Spdef (present study). In human IMA, the co‐occurrence of KRAS mutation and inactivation of CDKN2A is frequently seen (Fig 1D and E; Skoulidis et al, 2015), which suggests that the Kras G12D/Cdkn2a −/− (Fisher et al, 2001) model indeed recapitulates human IMA pathogenesis; however, the mechanism by which this co‐occurrence induces mucinous lung tumors is not known. The model with reduced expression of Nkx2‐1 along with a Kras mutation, which recapitulates the human IMA pathogenesis, was independently developed by ourselves and others (Maeda et al, 2012; Snyder et al, 2013). We induced mutant KRAS in lung epithelial cells of Nkx2‐1 heterozygous mice by a tet‐on system using doxycycline (Maeda et al, 2012), which recapitulates a genetic alteration seen in some human IMA cases (KRAS mutation and NKX2‐1 heterozygous loss but not NKX2‐1 amplification; Fig 1D and E), while others induced mutant KRAS in lung cells (probably not specific to lung epithelial cells due to the adenovirus‐mediated induction) and reduced NKX2‐1 (Nkx2‐1 flox/flox) by a Cre‐loxP system using intratracheal injection of adenovirus carrying Cre (Snyder et al, 2013). The difference in gene expression profiles between the two model systems (Figs 1B and EV2) may be derived from the different mouse model systems. Nevertheless, the gene expression profile of either mouse model did not fully overlap with that of human IMA (Figs 1B and EV2), indicating the limitation of these mouse models. However, in order to leverage both mouse models, we included genes induced in both mouse models (along with the genes induced in human IMA) as the signature genes. These results indicate that additional mouse models are required to model human IMA. Our present models expressing FOXA3 or SPDEF along with mutant KRAS also recapitulate human IMA pathogenesis (Figs 5 and 6), collectively suggesting that airway goblet cells that are proficient in SPDEF and FOXA3 and deficient in NKX2‐1 (Chen et al, 2009) may acquire a KRAS mutation, which in turn may transform the goblet cells into mucinous lung tumor cells. Induction of TLE1 or reduction of RUNX3 or EED was not seen in our RNA‐seq data using human IMA (Dataset EV2), suggesting other mouse models may not directly recapitulate human IMA pathogenesis; however, the expression level of TLE1, RUNX3, and/or EED at the protein level may be critical in human IMA.
ChIP‐seq has been used to identify transcription factor‐binding sites and potential enhancer/silencer regions; however, it does not always indicate the functional significance of the sites/elements unless the site/elements are genetically modified or deleted at a genomic level. Such modification/deletions to determine their significance in human cancer cells are now technically feasible using CRISPR/Cas9. For example, CRISPR/Cas9‐mediated deletion (191 bp) of −7.5 kb upstream regions of TAL1, which is bound by the transcription factor MYB, reduced the expression of TAL1 by ~85% in human Jurkat leukemia cells (Mansour et al, 2014). CRISPR/Cas9‐mediated deletion (1,555–1,727 bp) of a part of the super‐enhancer region of MYC, which is bound by the transcriptional co‐activator EP300, reduced the expression of MYC by ~30% in human H2009 lung adenocarcinoma cells (Zhang et al, 2016). CRISPR/Cas9‐mediated deletion (4–13 bp) of the insulator CTCF binding site in the PDGFRA locus induced the expression of PDGFRA by 1.6‐fold in human glioblastoma cells (Flavahan et al, 2016). These studies indicate that the degree of significance of the enhancer/insulator regions influencing the expression of associated genes is varied. In our study, CRISPR/Cas9‐mediated deletions (535 or 746 bp) of −7 kb or −3.5 kb upstream regions of MUC5AC or MUC5B, which was bound by the transcription factor SPDEF, reduced the expression of MUC5AC or MUC5B by ~90% in human A549 lung carcinoma cells (Figs 7 and 8), which indicates that the upstream enhancer regions are indispensable for the expression of MUC5AC or MUC5B in human IMA. SPDEF binding to the upstream regions of MUC5AC and MUC5B was also shown by ChIP‐seq in a MCF7 breast adenocarcinoma cell line (Figs 7A, 8A, and EV5C and D; Fletcher et al, 2013). MUC5AC and/or MUC5B are highly induced in breast and pancreatic cancers (Sóñora et al, 2006; Kaur et al, 2013), and MUC5B was shown to promote tumorigenesis of breast cancer (Valque et al, 2012). Genetic and/or epigenetic analysis of the upstream enhancer regions in breast and pancreatic cancers, which were functionally validated in this study, may lead to the understanding of the mechanism by which MUC5AC and/or MUC5B is induced in those cancers.
In summary, we identified a novel gene signature for human IMA, which includes therapeutically targetable genes. Our two novel mouse models, in addition to previous models of IMA, will be useful to test potential therapeutics in vivo. We identified critical enhancers that are required for the gene expression of two major mucins in human IMA, which may also provide the mechanisms of mucin hypersecretion in other cancers such as gastrointestinal, pancreatic, and breast cancers and chronic lung diseases, including idiopathic pulmonary fibrosis (IPF), cystic fibrosis (CF), chronic obstructive pulmonary disease (COPD), and asthma.
Materials and Methods
Human specimens
RNA samples for invasive mucinous adenocarcinoma of the lung (IMA) and adjacent normal lung tissues from six patients who were enrolled in this study were obtained in accordance with institutional guidelines for use of human tissue for research purposes from the Lungen‐Biobank Heidelberg, Germany, which is a member of the Biomaterial Bank Heidelberg (BMBH) and the biobank platform of the German Centre for Lung Research (DZL; approval # S 270/2001 V2.0). Paraffin sections for invasive mucinous (IMA; n = 24) and non‐mucinous (non‐IMA; n = 116) adenocarcinomas of the lung were obtained in accordance with institutional guidelines for use of human tissue for research purposes from the University of Cincinnati Cancer Institute Tumor Bank, Cincinnati, Ohio (approval # TB0049), Japan; Kawasaki Medical School, Okayama, Japan (approval # 1310); Nagasaki University Graduate School of Biomedical Sciences, Nagasaki, Japan (approval # 05062433‐2); and US Biomax (Rockville, MD). Written informed consent was obtained from all participants. Patients' information is summarized in Dataset EV1.
RNA‐seq analysis of human specimens
RNA‐seq was performed at the CCHMC DNA Sequencing and Genotyping Core. RNA‐sequencing libraries were produced using the Illumina TruSeq preparation kit and subsequently sequenced on the Illumina HiSeq 2500, using paired‐end, 100‐bp reads. Data analysis was performed in GeneSpring NGS. First, sequenced reads were aligned to the human genome build hg19. Only high‐quality reads were included in the analysis, following removal of multiply‐mapped reads, reads with base quality ≤ 30, and zero “N's” allowed per read. Aligned reads were quantified in order to produce FPKM (fragments per kilobase of transcript per million mapped reads) for each transcript in each sample. Further, FPKM values were normalized using the quantile normalization procedure and baselined to the median of all samples. A final filtration was applied, requiring ≥ 10 reads in 100% of samples in at least one of the experimental groups. Expression values of each transcript were compared between IMA and adjacent normal lung tissues using a paired t‐test in order to remove maximum inter‐individual variations. Differentially expressed genes (n = 2,621) were identified using the following criteria: Benjamini–Hochberg‐adjusted P < 0.05 and fold change requirement of 2.0. Clustering analysis of differentially expressed genes was performed in GENE‐E (http://www.broadinstitute.org/cancer/software/GENE-E/) using hierarchical clustering algorithm with Pearson's correlation‐based distance and complete linkage.
Gene Set Enrichment Analysis
In the GSEA analyses (Figs 1 and 2), the identified Mucinous Lung Tumor Signature was used as a gene set. Genes with normalized expression greater than 1 in at least 1 sample in the datasets were selected as the background. Permutation type was “phenotype”. The number of permutations was set to 1,000. “Signal2Noise” was used for ranking genes, and the enrichment statistic was “weighted”. In the GSEA analysis of the signature using The Cancer Genome Atlas (TCGA) human lung adenocarcinoma (LUAD) data (Fig 1C), nine human IMA cases (Dataset EV4) were identified based on the “Pathology” annotation in the supplemental table of the original paper (Cancer Genome Atlas Research Network, 2014). For comparison, we randomly selected nine normal lung cases (Dataset EV4) from the available TCGA LUAD normal cases since the RNA‐seq data of the adjacent normal lung tissue with eight out of nine human IMA cases were not available. The RNA‐seq data of the human IMA and normal lung cases were downloaded through the Genomic Data Commons (GDC) Legacy Archive (https://gdc-portal.nci.nih.gov/legacy-archive) using the following filter: Center Name is “University of North Carolina”, Data Category is “Gene Expression”, and Data Type is “Gene Expression Quantification”. The expression was quantile‐normalized and log2‐transformed. The minimum of the log2‐transformed expression was set to 0. In the GSEA analysis of the signature using the human cancer cell line data (Fig 2B), 598 cell lines of 20 tissue groups and diseases (Dataset EV4) were selected based on the “Characteristics[tissue supergroup]” and “Characteristics[disease]” annotations in the supplemental table of the original paper (Klijn et al, 2015). The RNA‐seq data of selected cell lines were downloaded from ArrayExpress using accession code E‐MTAB‐2706 (https://www.ebi.ac.uk/arrayexpress/experiments/E-MTAB-2706). The expression values were quantile‐normalized using the “normalize.quantiles” function in the Bioconductor package preprocessCore (http://bioconductor.org/packages/release/bioc/html/preprocessCore.html) and log2‐transformed. The minimum of the log2‐transformed expression was set to 0.
Analysis of TCGA‐human lung adenocarcinoma (LUAD) samples (n = 230)
The RNA‐seq data of human LUAD samples (n = 230) were downloaded from the TCGA data portal (https://tcga-data.nci.nih.gov/docs/publications/luad_2014/tcga.luad.rnaseq.20121025.csv.zip). Gene expression was quantified using RSEM (Li & Dewey, 2011) and normalized within‐sample to a fixed upper quartile. Expression values of zero were set to the overall minimum value, and all data were log2‐transformed. For details on the original processing of the data, refer to the supplemental information in the original paper (Cancer Genome Atlas Research Network, 2014). The correlations of genes with VTCN1 (B7‐H4) and CD274 (PD‐L1/B7‐H1) were measured using Pearson's correlation. Genes expressed (log2‐transformed expression > 0) in at least 10% of LUAD samples were included in the correlation analysis. The clustering analyses of the expression and correlation of the selected cell type markers in LUAD samples (Fig 3F and G) were performed in GENE‐E (http://www.broadinstitute.org/cancer/software/GENE-E/) using hierarchical clustering algorithm with Pearson's correlation‐based distance and complete linkage. The clustering analyses of the expression of the Mucinous Lung Tumor Signature genes (n = 141; MUC5AC and MUC3A/B were not detected in the 230 TCGA LUAD dataset) in all the 230 TCGA LUAD samples (Fig 1D) and in the nine IMA samples (Fig 1E) were performed in GENE‐E (http://www.broadinstitute.org/cancer/software/GENE-E/) using hierarchical clustering algorithm with Pearson's correlation‐based distance and complete linkage.
Analysis of human non‐small cell lung cancer (NSCLC) cell lines (n = 105)
The RNA‐seq data of human cancer cell lines (n = 675) were downloaded from ArrayExpress using accession code E‐MTAB‐2706. 105 out of 675 samples were selected as non‐small cell lung cancer (NSCLC) cell lines for analysis based on the following sample annotations; “OrganismPart” is lung and “Disease” is lung carcinoma, lung adenocarcinoma, lung anaplastic carcinoma, non‐small cell lung carcinoma, squamous cell lung carcinoma, large cell lung carcinoma, lung mucoepidermoid carcinoma, lung papillary adenocarcinoma, lung adenosquamous carcinoma, bronchioloalveolar adenocarcinoma, or squamous cell carcinoma. Correlation and clustering analyses in Fig 3 were performed using variance‐stabilized gene expression data downloaded from ArrayExpress using accession code E‐MTAB‐2706. For details on the original processing of the data, refer to the original paper (Klijn et al, 2015). The correlations of genes with VTCN1 (B7‐H4) and CD274 (PD‐L1/B7‐H1) were measured using Pearson's correlation. The clustering analyses of the expression and correlation of the selected cell type markers in NSCLC cell lines (Fig 3D and E) were performed in GENE‐E (http://www.broadinstitute.org/cancer/software/GENE-E/) using the hierarchical clustering algorithm with Pearson's correlation‐based distance and complete linkage.
Analysis of the expression of the Mucinous Lung Tumor Signature genes in 20 groups of human cancer cell lines
In the analysis of the expression of the Mucinous Lung Tumor Signature genes in different cancer types (Fig 2A), 598 cell lines of 20 tissue groups and diseases (Dataset EV4) were selected based on the “Characteristics[tissue supergroup]” and “Characteristics[disease]” annotations in the supplemental table of the original paper (Klijn et al, 2015). The RNA‐seq data of selected cell lines were downloaded from ArrayExpress using accession code E‐MTAB‐2706 (https://www.ebi.ac.uk/arrayexpress/experiments/E-MTAB-2706). Expression values were measured in RPKM. For details on the original processing of the data, refer to the original paper (Klijn et al, 2015). The expression values were quantile‐normalized using the “normalize.quantiles” function in the Bioconductor package preprocessCore (http://bioconductor.org/packages/release/bioc/html/preprocessCore.html) and log2‐transformed. The minimum of the log2‐transformed expression was set to 0. The expression of the signature genes in a group of the cell lines was measured by the mean normalized expression of the gene in all the cell lines in the group. The clustering analysis of the expression of the signature genes (n = 143) in 20 different cell line groups (Fig 2A) was performed in GENE‐E (http://www.broadinstitute.org/cancer/software/GENE-E/) using hierarchical clustering algorithm with Pearson's correlation‐based distance and average linkage.
Histology and immunohistochemistry
Staining (H&E, Alcian blue and immunohistochemistry) was performed using 5‐μm paraffin‐embedded lung sections as previously described (Chen et al, 2009) except EDTA antigen retrieval was performed for PD‐L1 staining. Antibodies used were rabbit anti‐VTCN1 (1:100; clone D1M8I; cat# 14572, Cell Signaling Technology, Danvers, MA; validated by immunoblotting; see Appendix Fig S3), rabbit anti‐PD‐L1 (1:100; clone E1L3N; cat# 13684, Cell Signaling Technology), goat anti‐FOXA3 (1:100; cat# sc‐5361, Santa Cruz Biotechnology), mouse anti‐NKX2‐1/TTF‐1 (1:500; cat# WRAB‐1231; Seven Hills Bioreagents, Cincinnati, OH), and guinea pig anti‐SPDEF (1:500; a gift from J. Whitsett; Park et al, 2007). Blind assessment of staining was performed by three investigators (K.T., I.M.F‐B., and Y.M.).
Cell culture, Taqman gene expression analysis, lentivirus infection, siRNA transfection, RNA‐seq, and immunoblotting (IB)
A549 lung carcinoma cells (Lot# F‐10600), H2122 lung adenocarcinoma cells (Lot# 59399669), Calu‐3 lung adenocarcinoma cells (Lot# 57814093), and H292 lung mucoepidermoid carcinoma cells (Lot# 3895200) were obtained directly from ATCC (Manassas, VA). Mycoplasma contamination was not detected by the Universal Mycoplasma Detection Kit (cat # 30‐1012, ATCC). A549 cells expressing NKX2‐1, SPDEF, or FOXA3 were made using lentiviral vectors as previously described (Chen et al, 2009, 2014; Maeda et al, 2012). Transfection of siRNAs (cat# 4390843 for Negative Control #1, cat# 4390846 for Negative Control #2, and cat# 4392420 for FOXA3 siRNA [s6695] and VTCN1 siRNA [#1, s36082; #2, s36083; #3, s36084], Thermo Fisher Scientific, Waltham, MA) was performed using Lipofectamine® RNAiMAX Transfection Reagent (cat# 13778075, Thermo Fisher Scientific). RNA was extracted using Trizol Reagent (cat# 15596018, Thermo Fisher Scientific) and purified using RNeasy MinElute Cleanup Kit (cat# 74204, Qiagen, Valencia, CA). Taqman gene expression analysis with high‐quality RNA was performed as previously described (Maeda et al, 2011) with Taqman probes (Hs00873651_mH for MUC5AC; Hs00861595_m1 for MUC5B; Hs03649367_mH for MUC3A/B; Hs00171942_m1 for SPDEF; Hs00270130_m1 for FOXA3; Hs00230853_m1 for HNF4A; Hs00968940_m1 for NKX2‐1; Hs01552471_g1 for VTCN1; Hs01125301_m1 for PD‐L1 [CD274]; Hs00180702_m1 for AGR2; Hs99999903_m1 for ACTB; and Hs02758991_g1 for GAPDH). Number of replicates is described in legends. RNA‐seq was performed at the CCHMC DNA Sequencing and Genotyping Core. RNA‐sequencing libraries were produced using the Illumina TruSeq preparation kit and subsequently sequenced on the Illumina HiSeq 2500, using single‐end, 75‐bp reads. For each read, five left and five right end bases were trimmed. Reads were further trimmed if more than 10% of bases with a quality score < 20. The remaining reads were aligned to the human genome build hg19. Differential expression analysis of RNA‐seq was performed using DESeq2 (Love et al, 2014) with default parameterization. Differentially expressed genes were identified using the following criteria: Benjamini–Hochberg‐adjusted P < 0.05 and fold change requirement of 2.0. A549 cells expressing HNF4A were made by infecting Hnf4a‐expressing lentiviral vector made by inserting rat Hnf4 cDNA (a gift from F. Sladek at the University of California, Riverside, CA) into the PGK‐IRES‐EGFP lentiviral vector as previously described (Maeda et al, 2011). Immunoblot assays were performed using rabbit anti‐NKX2‐1/TTF‐1 (1:5,000, cat# WRAB‐1231; Seven Hills Bioreagents, Cincinnati, OH), rabbit anti‐SPDEF (1:5,000, cat# sc‐67022X; Santa Cruz Biotechnology), goat anti‐FOXA3 (1:5,000, cat# sc‐5361X, Santa Cruz Biotechnology), goat anti‐HNF4A (1:5,000, cat# sc‐6556X, Santa Cruz Biotechnology), rabbit anti‐PD‐L1 antibody (1:5,000; clone E1L3N; cat# 13684, Cell Signaling Technology; cat# M4420, Spring Bioscience, Pleasanton, CA or cat# 10084‐R015‐50, Sino Biological, Beijing, China), rabbit anti‐VTCN1 (1:5,000; clone D1M8I; cat# 14572, Cell Signaling Technology), and rabbit anti‐ACTA1 (1:5,000; cat# A2066, Sigma‐Aldrich) as described previously (Maeda et al, 2006). Statistical differences were determined using Mann–Whitney test or Student's t‐test (two‐tailed and unpaired). The difference between two groups was considered significant when the P‐value was < 0.05.
Mice
[tetO]‐Foxa3 and [tetO]‐Spdef mice were provided by J. Whitsett at Cincinnati Children's Hospital Medical Center and the University of Cincinnati College of Medicine, Cincinnati, OH (Park et al, 2007; Chen et al, 2014) and crossed with Scgb1a1‐rtTA;[tetO]‐Kras4b G12D (Maeda et al, 2012) to develop Scgb1a1‐rtTA;[tetO]‐Kras4b G12D ;[tetO]‐Foxa3 and Scgb1a1‐rtTA;[tetO]‐Kras4b G12D ;[tetO]‐Spdef mice. All mice are FVB/N background. Transgenic mice were provided chow containing doxycycline (625 mg/kg chow) beginning at 4–5 weeks of age. Mouse maintenance and procedures were done in accordance with the institutional protocol guidelines of Cincinnati Children's Hospital Medical Center (CCHMC) Institutional Animal Care and Use Committee. Mice were housed in a pathogen‐free barrier facility in humidity and temperature‐controlled rooms on a 12:12‐h light/dark cycle and were allowed food and water ad libitum. Since all transgenic mice were healthy before doxycycline administration, all of them were enrolled for the study. For the survival study, at least eight mice in each genotype were enrolled. For the histological study, at least five mice in each genotype that develop lung tumors were enrolled (at least three mice in each genotype that did not develop lung tumors were enrolled to minimize animal use). See Dataset EV6 for further mouse information.
ChIP‐seq and ChIP‐qPCR
ChIP‐seq was performed twice as previously described (Maeda et al, 2012) using A549 cells expressing NKX2‐1 and/or SPDEF by lentivirus with rabbit anti‐NKX2‐1/TTF‐1 (cat# WRAB‐1231; Seven Hills Bioreagents) or rabbit anti‐SPDEF (cat# sc‐67022X; Santa Cruz Biotechnology; previously used for ChIP‐seq by Fletcher et al, 2013). Illumina‐sequencing libraries were prepared as previously described (Maeda et al, 2012). DNA sequencing was performed at the CCHMC DNA Sequencing and Genotyping Core. For each sequenced read, five end bases were trimmed. Reads were further trimmed if more than 10% of bases with a quality score < 20. The remaining reads were aligned against human genome build hg19. Alignments with MAPping Quality (MAPQ) quality score ≥ 10 were included in the peak calling. Peaks were called using MACS2 callpeak v2.1.0 (Zhang et al, 2008; https://github.com/taoliu/MACS/) with the following parameters “–gsize 2451960000 –bw = 300 –ratio 1.0 –slocal 1000 –llocal 10000 –keep‐dup 1 –bdg –qvalue 0.05″. The DNA sequences of peaks were retrieved using RSAT “fetch sequences from UCSC” tool (http://rsat.sb-roscoff.fr/). The genome distribution of ChIP‐seq peaks was analyzed using CEAS v1.0.0 (Shin et al, 2009; http://liulab.dfci.harvard.edu/CEAS/) in Cistrome (http://cistrome.org/ap/). Motif analysis was performed using RSAT peak‐motifs (Thomas‐Chollier et al, 2012a,b; http://floresta.eead.csic.es/rsat/peak-motifs_form.cgi). For ChIP‐qPCR, DNA was quantified after ChIP using SYBR Green (cat# 4385612, Thermo Fisher Scientific) on StepOnePlus Real‐Time PCR System (Thermo Fisher Scientific) with primers (forward: 5′‐CCCCTGGTAAAGTCGGGAAG‐3′; reverse: 5′‐GTGGCAGAATCAGGAAGCCT‐3′ for the MUC5AC locus, forward: 5′‐GCTGTGTCCCTTTCCTTCCT‐3′; reverse: 5′‐GGCACACAGTGACACCAAAC‐3′ for the MUC5B locus and forward: 5′‐GTGCCAGATAGTGCGGGTAT‐3′; reverse: 5′‐CACAGCAGGCCCAATTAGAT‐3′ for the ACTB locus).
CRISPR/Cas9 experiments
CRISPR/Cas9 vectors targeting the MUC5AC and MUC5B loci were made by inserting single‐guide RNAs into pCas‐Guide‐EF1a‐GFP vector (Origene Rockville, MD). The vectors were transiently transfected into A549 cells using Lipofectamine 3000 (Thermo Fisher Scientific). GFP‐positive cells were sorted and plated at one cell per well on 96‐well plates by the Research Flow Cytometry Core at CCHMC. DNA was extracted from each cell. The deletion of the MUC5AC locus was confirmed by PCR using primers (forward: 5′‐CCCGGGAAGATGAAGATGGA‐3′; reverse: 5′‐TGTTCTGCCATTTCTGCCAC‐3′). The deletion of the MUC5B locus was confirmed by PCR using primers (forward: 5′‐GGCTCTGAGCAGACCAAGAG‐3′; reverse: 5′‐AGCCTAGTGTCTCCCCTGCT‐3′). Deletion of the locus was further confirmed by Sanger sequencing at the CCHMC DNA Sequencing and Genotyping Core using the same PCR primers.
Data availability
The RNA‐seq and ChIP‐seq data from this publication have been deposited in Gene Expression Omnibus (GEO) database (http://www.ncbi.nlm.nih.gov/geo/) under accession code GSE86959. See Dataset EV8 for the summary of the datasets.
Statistical analysis
Sample sizes were designed to give statistical power. For the study using human specimens, a minimum of six patient specimens was used for RNA sample analysis. A minimum of 14 patient specimens was used for histological analysis. Assessment of histology was performed by three investigators to avoid subjective bias (K.T., I.M.F‐B., and Y.M.). For the mouse study while minimizing animal use, a minimum of eight mice in each genotype was enrolled for the survival study. For the histological study, a minimum of five mice in each genotype that developed lung tumors was enrolled and a minimum of three mice in each genotype that did not develop lung tumors was enrolled. All of the double‐transgenic mice were littermates from the triple transgenic mouse development and co‐housed with the triple transgenic mice. See Dataset EV6 for further mouse information. Biological triplicates were used for the RNA‐seq study using the A549 cell line. Biological duplicates were used for the ChIP‐seq study of each transcription factor. Statistical differences were determined using two‐tailed paired Student's t‐test (RNA‐seq gene expression study using human specimens and ChIP‐qPCR), Mann–Whitney test (Taqman gene expression qPCR study using human specimens), two‐tailed unpaired Student's t‐test (Taqman gene expression qPCR study using cell lines), Wald test in DESeq2 (Love et al, 2014; RNA‐seq differential expression study using the A549 cell line), statistical test in MACS2 (Zhang et al, 2008; ChIP‐seq peak calling study), or log‐rank (Mantel–Cox) test (Kaplan–Meier survival mouse study by Prism 6 [GraphPad Software, La Jolla, CA]). The difference between two groups was considered significant when the P‐value was < 0.05 and Benjamini–Hochberg‐adjusted P‐value < 0.05 when multiple comparisons were performed.
Author contributions
YM designed experiments. MG and YX designed bioinformatics analytic approaches. MG and RK performed bioinformatical analysis. KT, IMF‐B, and YM performed experiments. MMe, TM, TF, TT, AW, TN, YN, and MMa provided human specimens. All authors contributed to experimental interpretation and manuscript writing.
Conflict of interest
The authors declare that they have no conflict of interest.
The paper explained.
Problem
Invasive mucinous adenocarcinoma of the lung (IMA) is pathologically well defined as a lung tumor with goblet cell morphology containing excessive intracytoplasmic mucins. However, the molecular pathway driving IMA is not well understood, thereby few therapeutics have been identified to treat IMA. Recent advances in mouse models have identified genes involved in causing IMA in mice; however, their relevance with human IMA is not known.
Results
Using gene expression profiles from the mouse models and human IMA specimens, we determined a gene signature of 143 genes common in mouse and human IMA. The signature includes therapeutic targets, including an immune checkpoint VTCN1/B7‐H4. Key transcription factors FOXA3 and SPDEF in the signature were sufficient to induce mucinous lung tumors in the presence of a KRAS mutation. ChIP‐seq analysis determined that SPDEF bound to the non‐coding upstream regions of the mucin genes MUC5AC and MUC5B that are highly expressed in human IMA. Deletion of the SPDEF binding regions by CRISPR/Cas9 significantly reduced the expression of the mucin genes.
Impact
Human IMA is a lung tumor that is so far only pathologically defined. This study has determined a gene signature to define human IMA at the molecular level in addition to the pathological definition. The signature includes novel genes expressed in human IMA, which were not previously reported. The signature also includes therapeutic targets and genes driving IMA. The novel mouse models that we have developed will be useful as preclinical models for testing therapeutic drugs. The identification of the gene regulatory mechanisms inducing mucin genes will also contribute to the understanding of other mucin‐producing diseases such as breast cancer and idiopathic pulmonary fibrosis (IPF).
Supporting information
Appendix
Expanded View Figures PDF
Dataset EV1
Dataset EV2
Dataset EV3
Dataset EV4
Dataset EV5
Dataset EV6
Dataset EV7
Dataset EV8
Review Process File
Source Data for Figure 4
Source Data for Figure 6
Acknowledgements
We thank J. Whitsett, F. Sladek, M. Durbin, I. Mitsui, H. Hao, P. Dexheimer, D. Fletcher, K. Dillehay McKillip, M. Fallenbüchel, G. Chen, Y‐C. Hu, H. Miyoshi, F. Accornero, T. Suzuki and A. Perl for materials, technical support, and discussions. This work was supported by the American Lung Association (RG309608), Trustee Award Grant, CF‐RDP Pilot & Feasibility Grant, Cincinnati Children's Hospital Medical Center (Y.M.), the Rotary Foundation Global Grant (K.T.), and the Ministry of Education, Science and Culture, Japan (T.T., T.N., Y.N., and T.F.).
EMBO Mol Med (2017) 9: 462–481
References
- Ahn SH, Shah YM, Inoue J, Morimura K, Kim I, Yim S, Lambert G, Kurotani R, Nagashima K, Gonzalez FJ et al (2008) Hepatocyte nuclear factor 4alpha in the intestinal epithelial cells protects against inflammatory bowel disease. Inflamm Bowel Dis 14: 908–920 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Allen T, van Tuyl M, Iyengar P, Jothy S, Post M, Tsao MS, Lobe CG (2006) Grg1 acts as a lung‐specific oncogene in a transgenic mouse model. Cancer Res 66: 1294–1301 [DOI] [PubMed] [Google Scholar]
- Buchwalter G, Hickey MM, Cromer A, Selfors LM, Gunawardane RN, Frishman J, Jeselsohn R, Lim E, Chi D, Fu X et al (2013) PDEF promotes luminal differentiation and acts as a survival factor for ER‐positive breast cancer cells. Cancer Cell 23: 753–767 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cancer Genome Atlas Research Network (2014) Comprehensive molecular profiling of lung adenocarcinoma. Nature 511: 543–550 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Casey SC, Tong L, Li Y, Do R, Walz S, Fitzgerald KN, Gouw AM, Baylot V, Gütgemann I, Eilers M et al (2016) MYC regulates the antitumor immune response through CD47 and PD‐L1. Science 352: 227–231 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chen G, Korfhagen TR, Xu Y, Kitzmiller J, Wert SE, Maeda Y, Gregorieff A, Clevers H, Whitsett JA (2009) SPDEF is required for mouse pulmonary goblet cell differentiation and regulates a network of genes associated with mucus production. J Clin Invest 119: 2914–2924 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chen G, Korfhagen TR, Karp CL, Impey S, Xu Y, Randell SH, Kitzmiller J, Maeda Y, Haitchi HM, Sridharan A et al (2014) Foxa3 induces goblet cell metaplasia and inhibits innate antiviral immunity. Am J Respir Crit Care Med 189: 301–313 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cheng XH, Black M, Ustiyan V, Le T, Fulford L, Sridharan A, Medvedovic M, Kalinichenko VV, Whitsett JA, Kalin TV (2014) SPDEF inhibits prostate carcinogenesis by disrupting a positive feedback loop in regulation of the Foxm1 oncogene. PLoS Genet 10: e1004656 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Choi YH, Lee SN, Aoyagi H, Yamasaki Y, Yoo JY, Park B, Shin DM, Yoon HG, Yoon JH (2011) The extracellular signal‐regulated kinase mitogen‐activated protein kinase/ribosomal S6 protein kinase 1 cascade phosphorylates cAMP response element‐binding protein to induce MUC5B gene expression via D‐prostanoid receptor signaling. J Biol Chem 286: 34199–34214 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ding X, Yang Y, Han B, Du C, Xu N, Huang H, Cai T, Zhang A, Han ZG, Zhou W et al (2014) Transcriptomic characterization of hepatocellular carcinoma with CTNNB1 mutation. PLoS One 9: e95307 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Feldman RJ, Sementchenko VI, Gayed M, Fraig MM, Watson DK (2003) Pdef expression in human breast cancer is correlated with invasive potential and altered gene expression. Cancer Res 63: 4626–4631 [PubMed] [Google Scholar]
- Fernandez‐Cuesta L, Plenker D, Osada H, Sun R, Menon R, Leenders F, Ortiz‐Cuaran S, Peifer M, Bos M, Daßler J et al (2014) CD74‐NRG1 fusions in lung adenocarcinoma. Cancer Discov 4: 415–422 [DOI] [PubMed] [Google Scholar]
- Fisher GH, Wellen SL, Klimstra D, Lenczowski JM, Tichelaar JW, Lizak MJ, Whitsett JA, Koretsky A, Varmus HE (2001) Induction and apoptotic regression of lung adenocarcinomas by regulation of a K‐Ras transgene in the presence and absence of tumor suppressor genes. Genes Dev 15: 3249–3262 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Flavahan WA, Drier Y, Liau BB, Gillespie SM, Venteicher AS, Stemmer‐Rachamimov AO, Suvà ML, Bernstein BE (2016) Insulator dysfunction and oncogene activation in IDH mutant gliomas. Nature 529: 110–114 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Fletcher MN, Castro MA, Wang X, de Santiago I, O'Reilly M, Chin SF, Rueda OM, Caldas C, Ponder BA, Markowetz F et al (2013) Master regulators of FGFR2 signalling and breast cancer risk. Nat Commun 4: 2464 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Garon EB, Rizvi NA, Hui R, Leighl N, Balmanoukian AS, Eder JP, Patnaik A, Aggarwal C, Gubens M, Horn L et al (2015) Pembrolizumab for the treatment of non‐small‐cell lung cancer. N Engl J Med 372: 2018–2028 [DOI] [PubMed] [Google Scholar]
- Ghadersohi A, Sood AK (2001) Prostate epithelium‐derived Ets transcription factor mRNA is overexpressed in human breast tumors and is a candidate breast tumor marker and a breast tumor antigen. Clin Cancer Res 7: 2731–2738 [PubMed] [Google Scholar]
- Ghadersohi A, Odunsi K, Zhang S, Azrak RG, Bundy BN, Manjili MH, Li F (2008) Prostate‐derived Ets transcription factor as a favorable prognostic marker in ovarian cancer patients. Int J Cancer 123: 1376–1384 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Green MR, Rodig S, Juszczynski P, Ouyang J, Sinha P, O'Donnell E, Neuberg D, Shipp MA (2012) Constitutive AP‐1 activity and EBV infection induce PD‐L1 in Hodgkin lymphomas and posttransplant lymphoproliferative disorders: implications for targeted therapy. Clin Cancer Res 18: 1611–1618 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gu X, Zerbini LF, Otu HH, Bhasin M, Yang Q, Joseph MG, Grall F, Onatunde T, Correa RG, Libermann TA (2007) Reduced PDEF expression increases invasion and expression of mesenchymal genes in prostate cancer cells. Cancer Res 67: 4219–4226 [DOI] [PubMed] [Google Scholar]
- Gunawardane RN, Sgroi DC, Wrobel CN, Koh E, Daley GQ, Brugge JS (2005) Novel role for PDEF in epithelial cell migration and invasion. Cancer Res 65: 11572–11580 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hata A, Katakami N, Fujita S, Kaji R, Imai Y, Takahashi Y, Nishimura T, Tomii K, Ishihara K (2010) Frequency of EGFR and KRAS mutations in Japanese patients with lung adenocarcinoma with features of the mucinous subtype of bronchioloalveolar carcinoma. J Thorac Oncol 5: 1197–1200 [DOI] [PubMed] [Google Scholar]
- Herbst RS, Soria JC, Kowanetz M, Fine GD, Hamid O, Gordon MS, Sosman JA, McDermott DF, Powderly JD, Gettinger SN et al (2014) Predictive correlates of response to the anti‐PD‐L1 antibody MPDL3280A in cancer patients. Nature 515: 563–567 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hirsch FR, Suda K, Wiens J, Bunn PA Jr (2016) New and emerging targeted treatments in advanced non‐small‐cell lung cancer. Lancet 388: 1012–1024 [DOI] [PubMed] [Google Scholar]
- Jeon YK, Park SG, Choi IW, Lee SW, Lee SM, Choi I (2015) Cancer cell‐associated cytoplasmic B7‐H4 is induced by hypoxia through hypoxia‐inducible factor‐1α and promotes cancer cell proliferation. Biochem Biophys Res Commun 459: 277–283 [DOI] [PubMed] [Google Scholar]
- Kaur S, Kumar S, Momi N, Sasson AR, Batra SK (2013) Mucins in pancreatic cancer and its microenvironment. Nat Rev Gastroenterol Hepatol 10: 607–620 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Klijn C, Durinck S, Stawiski EW, Haverty PM, Jiang Z, Liu H, Degenhardt J, Mayba O, Gnad F, Liu J et al (2015) A comprehensive transcriptional portrait of human cancer cell lines. Nat Biotechnol 33: 306–312 [DOI] [PubMed] [Google Scholar]
- Kreda SM, Davis CW, Rose MC (2012) CFTR, mucins, and mucus obstruction in cystic fibrosis. Cold Spring Harb Perspect Med 2: a009589 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kufe DW (2009) Mucins in cancer: function, prognosis and therapy. Nat Rev Cancer 9: 874–885 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kunii R, Jiang S, Hasegawa G, Yamamoto T, Umezu H, Watanabe T, Tsuchida M, Hashimoto T, Hamakubo T, Kodama T et al (2011) The predominant expression of hepatocyte nuclear factor 4α (HNF4α) in thyroid transcription factor‐1 (TTF‐1)‐negative pulmonary adenocarcinoma. Histopathology 58: 467–476 [DOI] [PubMed] [Google Scholar]
- Lee SJ, Jang BC, Lee SW, Yang YI, Suh SI, Park YM, Oh S, Shin JG, Yao S, Chen L et al (2006) Interferon regulatory factor‐1 is prerequisite to the constitutive expression and IFN‐gamma‐induced upregulation of B7‐H1 (CD274). FEBS Lett 580: 755–762 [DOI] [PubMed] [Google Scholar]
- Lee YS, Lee JW, Jang JW, Chi XZ, Kim JH, Li YH, Kim MK, Kim DM, Choi BS, Kim EG et al (2013) Runx3 inactivation is a crucial early event in the development of lung adenocarcinoma. Cancer Cell 24: 603–616 [DOI] [PubMed] [Google Scholar]
- Leong SR, Liang WC, Wu Y, Crocker L, Cheng E, Sampath D, Ohri R, Raab H, Hass PE, Pham T et al (2015) An anti‐B7‐H4 antibody‐drug conjugate for the treatment of breast cancer. Mol Pharm 12: 1717–1729 [DOI] [PubMed] [Google Scholar]
- Li B, Dewey CN (2011) RSEM: accurate transcript quantification from RNA‐Seq data with or without a reference genome. BMC Bioinformatics 12: 323 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Liang SC, Latchman YE, Buhlmann JE, Tomczak MF, Horwitz BH, Freeman GJ, Sharpe AH (2003) Regulation of PD‐1, PD‐L1, and PD‐L2 expression during normal and autoimmune responses. Eur J Immunol 33: 2706–2716 [DOI] [PubMed] [Google Scholar]
- Loke P, Allison JP (2003) PD‐L1 and PD‐L2 are differentially regulated by Th1 and Th2 cells. Proc Natl Acad Sci USA 100: 5336–5341 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Love MI, Huber W, Anders S (2014) Moderated estimation of fold change and dispersion for RNA‐seq data with DESeq2. Genome Biol 15: 550 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Maeda Y, Hunter TC, Loudy DE, Davé V, Schreiber V, Whitsett JA (2006) PARP‐2 interacts with TTF‐1 and regulates expression of surfactant protein‐B. J Biol Chem 281: 9600–9606 [DOI] [PubMed] [Google Scholar]
- Maeda Y, Chen G, Xu Y, Haitchi HM, Du L, Keiser AR, Howarth PH, Davies DE, Holgate ST, Whitsett JA (2011) Airway epithelial transcription factor NK2 homeobox 1 inhibits mucous cell metaplasia and Th2 inflammation. Am J Respir Crit Care Med 184: 421–429 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Maeda Y, Tsuchiya T, Hao H, Tompkins DH, Xu Y, Mucenski ML, Du L, Keiser AR, Fukazawa T, Naomoto Y et al (2012) Kras (G12D) and Nk2–1 haploinsufficiency induce mucinous adenocarcinoma of the lung. J Clin Invest 122: 4388–4400 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mansour MR, Abraham BJ, Anders L, Berezovskaya A, Gutierrez A, Durbin AD, Etchin J, Lawton L, Sallan SE, Silverman LB et al (2014) Oncogene regulation. An oncogenic super‐enhancer formed through somatic mutation of a noncoding intergenic element. Science 346: 1373–1377 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Marzec M, Zhang Q, Goradia A, Raghunath PN, Liu X, Paessler M, Wang HY, Wysocka M, Cheng M, Ruggeri BA et al (2008) Oncogenic kinase NPM/ALK induces through STAT3 expression of immunosuppressive protein CD274 (PD‐L1, B7‐H1). Proc Natl Acad Sci USA 105: 20852–20857 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Nakaoku T, Tsuta K, Ichikawa H, Shiraishi K, Sakamoto H, Enari M, Furuta K, Shimada Y, Ogiwara H, Watanabe S et al (2014) Druggable oncogene fusions in invasive mucinous lung adenocarcinoma. Clin Cancer Res 20: 3087–3093 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Noah TK, Lo YH, Price A, Chen G, King E, Washington MK, Aronow BJ, Shroyer NF (2013) SPDEF functions as a colorectal tumor suppressor by inhibiting β‐catenin activity. Gastroenterology 144: 1012–1023.e6 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Park KS, Korfhagen TR, Bruno MD, Kitzmiller JA, Wan H, Wert SE, Khurana Hershey GK, Chen G, Whitsett JA (2007) SPDEF regulates goblet cell hyperplasia in the airway epithelium. J Clin Invest 117: 978–988 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Perl AK, Zhang L, Whitsett JA (2009) Conditional expression of genes in the respiratory epithelium in transgenic mice: cautionary notes and toward building a better mouse trap. Am J Respir Cell Mol Biol 40: 1–3 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rodabaugh KJ, Mhawech‐Fauceglia P, Groth J, Lele S, Sood AK (2007) Prostate‐derived Ets factor is overexpressed in serous epithelial ovarian tumors. Int J Gynecol Pathol 26: 10–15 [DOI] [PubMed] [Google Scholar]
- Seibold MA, Wise AL, Speer MC, Steele MP, Brown KK, Loyd JE, Fingerlin TE, Zhang W, Gudmundsson G, Groshong SD et al (2011) A common MUC5B promoter polymorphism and pulmonary fibrosis. N Engl J Med 364: 1503–1512 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Serresi M, Gargiulo G, Proost N, Siteur B, Cesaroni M, Koppens M, Xie H, Sutherland KD, Hulsman D, Citterio E et al (2016) Polycomb repressive complex 2 is a barrier to KRAS‐driven inflammation and epithelial‐mesenchymal transition in non‐small‐cell lung cancer. Cancer Cell 29: 17–31 [DOI] [PubMed] [Google Scholar]
- Shin H, Liu T, Manrai AK, Liu XS (2009) CEAS: cis‐regulatory element annotation system. Bioinformatics 25: 2605–2606 [DOI] [PubMed] [Google Scholar]
- Skoulidis F, Byers LA, Diao L, Papadimitrakopoulou VA, Tong P, Izzo J, Behrens C, Kadara H, Parra ER, Canales JR et al (2015) Co‐occurring genomic alterations define major subsets of KRAS‐mutant lung adenocarcinoma with distinct biology, immune profiles, and therapeutic vulnerabilities. Cancer Discov 5: 860–877 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Smyth MJ, Ngiow SF, Ribas A, Teng MW (2016) Combination cancer immunotherapies tailored to the tumour microenvironment. Nat Rev Clin Oncol 13: 143–158 [DOI] [PubMed] [Google Scholar]
- Snyder EL, Watanabe H, Magendantz M, Hoersch S, Chen TA, Wang DG, Crowley D, Whittaker CA, Meyerson M, Kimura S et al (2013) Nk2–1 represses a latent gastric differentiation program in lung adenocarcinoma. Mol Cell 50: 185–199 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sóñora C, Mazal D, Berois N, Buisine MP, Ubillos L, Varangot M, Barrios E, Carzoglio J, Aubert JP, Osinaga E (2006) Immunohistochemical analysis of MUC5B apomucin expression in breast cancer and non‐malignant breast tissues. J Histochem Cytochem 54: 289–299 [DOI] [PubMed] [Google Scholar]
- Sood AK, Saxena R, Groth J, Desouki MM, Cheewakriangkrai C, Rodabaugh KJ, Kasyapa CS, Geradts J (2007) Expression characteristics of prostate‐derived Ets factor support a role in breast and prostate cancer progression. Hum Pathol 38: 1628–1638 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA, Paulovich A, Pomeroy SL, Golub TR, Lander ES et al (2005) Gene set enrichment analysis: a knowledge‐based approach for interpreting genome‐wide expression profiles. Proc Natl Acad Sci USA 102: 15545–15550 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sugano M, Nagasaka T, Sasaki E, Murakami Y, Hosoda W, Hida T, Mitsudomi T, Yatabe Y (2013) HNF4α as a marker for invasive mucinous adenocarcinoma of the lung. Am J Surg Pathol 37: 211–218 [DOI] [PubMed] [Google Scholar]
- Sutherland KD, Song JY, Kwon MC, Proost N, Zevenhoven J, Berns A (2014) Multiple cells‐of‐origin of mutant K‐Ras‐induced mouse lung adenocarcinoma. Proc Natl Acad Sci USA 111: 4952–4957 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Thomas‐Chollier M, Darbo E, Herrmann C, Defrance M, Thieffry D, van Helden J (2012b) A complete workflow for the analysis of full‐size ChIP‐seq (and similar) data sets using peak‐motifs. Nat Protoc 7: 1551–1568 [DOI] [PubMed] [Google Scholar]
- Thomas‐Chollier M, Herrmann C, Defrance M, Sand O, Thieffry D, van Helden J (2012a) RSAT peak‐motifs: motif analysis in full‐size ChIP‐seq datasets. Nucleic Acids Res 40: e31 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Travis WD, Brambilla E, Noguchi M, Nicholson AG, Geisinger KR, Yatabe Y, Beer DG, Powell CA, Riely GJ, Van Schil PE et al (2011) International association for the study of lung cancer/american thoracic society/european respiratory society international multidisciplinary classification of lung adenocarcinoma. J Thorac Oncol 6: 244–285 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Turner DP, Findlay VJ, Kirven AD, Moussa O, Watson DK (2008) Global gene expression analysis identifies PDEF transcriptional networks regulating cell migration during cancer progression. Mol Biol Cell 19: 3745–3757 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Valque H, Gouyer V, Gottrand F, Desseyn JL (2012) MUC5B leads to aggressive behavior of breast cancer MCF7 cells. PLoS One 7: e46699 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhang Y, Liu T, Meyer CA, Eeckhoute J, Johnson DS, Bernstein BE, Nusbaum C, Myers RM, Brown M, Li W et al (2008) Model‐based analysis of ChIP‐Seq (MACS). Genome Biol 9: R137 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhang X, Choi PS, Francis JM, Imielinski M, Watanabe H, Cherniack AD, Meyerson M (2016) Identification of focally amplified lineage‐specific super‐enhancers in human epithelial cancers. Nat Genet 48: 176–182 [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Appendix
Expanded View Figures PDF
Dataset EV1
Dataset EV2
Dataset EV3
Dataset EV4
Dataset EV5
Dataset EV6
Dataset EV7
Dataset EV8
Review Process File
Source Data for Figure 4
Source Data for Figure 6
Data Availability Statement
The RNA‐seq and ChIP‐seq data from this publication have been deposited in Gene Expression Omnibus (GEO) database (http://www.ncbi.nlm.nih.gov/geo/) under accession code GSE86959. See Dataset EV8 for the summary of the datasets.
