Skip to main content
PLOS One logoLink to PLOS One
. 2018 Feb 7;13(2):e0192301. doi: 10.1371/journal.pone.0192301

Equid herpesvirus 8: Complete genome sequence and association with abortion in mares

Marie Garvey 1, Nicolás M Suárez 2, Karen Kerr 2, Ralph Hector 2,¤, Laura Moloney-Quinn 1, Sean Arkins 3, Andrew J Davison 2,*, Ann Cullinane 1,*
Editor: Joanne M Devlin4
PMCID: PMC5802896  PMID: 29414990

Abstract

Equid herpesvirus 8 (EHV-8), formerly known as asinine herpesvirus 3, is an alphaherpesvirus that is closely related to equid herpesviruses 1 and 9 (EHV-1 and EHV-9). The pathogenesis of EHV-8 is relatively little studied and to date has only been associated with respiratory disease in donkeys in Australia and horses in China. A single EHV-8 genome sequence has been generated for strain Wh in China, but is apparently incomplete and contains frameshifts in two genes. In this study, the complete genome sequences of four EHV-8 strains isolated in Ireland between 2003 and 2015 were determined by Illumina sequencing. Two of these strains were isolated from cases of abortion in horses, and were misdiagnosed initially as EHV-1, and two were isolated from donkeys, one with neurological disease. The four genome sequences are very similar to each other, exhibiting greater than 98.4% nucleotide identity, and their phylogenetic clustering together demonstrated that genomic diversity is not dependent on the host. Comparative genomic analysis revealed 24 of the 76 predicted protein sequences are completely conserved among the Irish EHV-8 strains. Evolutionary comparisons indicate that EHV-8 is phylogenetically closer to EHV-9 than it is to EHV-1. In summary, the first complete genome sequences of EHV-8 isolates from two host species over a twelve year period are reported. The current study suggests that EHV-8 can cause abortion in horses. The potential threat of EHV-8 to the horse industry and the possibility that donkeys may act as reservoirs of infection warrant further investigation.

Introduction

Nine herpesviruses have been identified in the family Equidae, which includes horses, ponies, donkeys and zebras. It is understood that the horse (Equus ferus caballus) is the natural host of five of these viruses (equid herpesvirus (EHV) 1 (EHV-1), EHV-2, EHV-3, EHV-4 and EHV-5), and the donkey (Equus africanus asinus) the natural host of three (EHV-6, EHV-7 and EHV-8, the last formerly known as asinine herpesvirus 3 (AHV-3)) [1, 2]. It has been suggested that the natural host for the ninth virus (EHV-9), which was isolated originally from gazelle [3], is the zebra, but serological prevalence points to the African rhinoceros as at least an additional potential natural host [4]. The EHVs are classified into species Equid alphaherpesvirus 1 to Equid alphaherpesvirus 9, and five (EHV-1, EHV-3, EHV-4, EHV-8 and EHV-9) belong to genus Varicellovirus in subfamily Alphaherpesvirinae of the family Herpesviridae [5]. Alphaherpesviruses are characterized by lytic infection, and can establish a lifelong latent infection that may be interrupted by periodic reactivation [6]. EHV-1 is globally ubiquitous, and is considered the most economically significant EHV because it is associated with abortion and neurological disease, including myeloencephalopathy [7].

AHV-3 was first isolated in 1987 from the nasal cavity of donkeys in Australia following experimental administration of high doses of corticosteroid [2, 8]. Based on sequence analysis of gene ORF70 (encoding glycoprotein G) and serological cross reactivity of AHV-3 antibodies with EHV-1 and EHV-4 glycoproteins, AHV-3 was categorised as an alphaherpesvirus [9] and subsequently designated EHV-8 [5, 10]. In 2010, the ostensibly complete genome sequence of EHV-8 strain Wh, which was isolated from horses in China, was published [11]. The sequences of gene ORF30 (encoding the DNA polymerase catalytic subunit) and the partial sequence of gene ORF70 of the Australian donkey strain 804/87 [9] are the only EHV-8 data additional to strain Wh that are available in GenBank.

The pathogenesis of EHV-8 is not well understood, and to date the virus has been associated only with respiratory disease. On experimental intranasal infection of naïve weanling donkeys, strain 804/87 induced afebrile rhinitis [9]. EHV-8 strain Wh was isolated from horses with fever and nasal discharge. The present study contains the first report of EHV-8-associated abortion in horses. In addition, the complete genome sequences of four EHV-8 strains isolated in Ireland between 2003 and 2015 are presented, two originating from horses and two from donkeys, with one of the latter from a neurological case.

Materials and methods

Viral isolation and identification by PCR

The tissues of two horse foetuses aborted in the third trimester were diagnosed by pathological examination as originating from EHV-associated abortions. Post mortem tissues were received by the Virology Unit for identification of the causal agent as EHV-1 or EHV-4. The abortions occurred in 2003 and 2010 in two different counties in Ireland (Co. Kerry and Co. Kildare). Viral DNA was initially detected in both samples by PCR using primers specific for EHV-1 ORF16 (encoding glycoprotein C) [12]. The viruses were isolated from tissue homogenates by a single passage in rabbit kidney (RK13) cell monolayers [13]. EHV-4 and equine arteritis virus were not detected in the tissue samples by PCR.

PCR of a sequence of approximately 500 bp in EHV-1 ORF30 that contains a putative neurological marker [14] in the DNA polymerase catalytic subunit was carried out by using primers 30.2141.F (5’-TGGTTGTGTTTGACTTCGCT-3’) and 30.2655.R (5’-GTAGATAACCCTGACGGAGTA-3’). The sequence of the PCR product showed a high level of similarity to EHV-1 for both isolates. However, BLAST analysis [15] carried out at this stage (prior to deposition into GenBank in 2012 of the genome sequence of EHV-8 strain Wh; accession no. JQ343919 [11]) showed that the closest relative was EHV-9 rather than EHV-1. To enable comparison with EHV-8, PCR products were generated and sequenced by using primers AHV3.gG. 915.F (5’-CTTACGGAGACATCAACG-3’) and AHV3.gG.1200.R (5’-GCCTGAGCCAAGATTCT-3’), which target a 286 bp region of ORF70 in the only EHV-8 sequence available at the time [9] (from an Australian strain; GenBank accession U24184, 1585 bp).

In addition to these two isolates from horses, which were designated EHV-8/IR/2003/19 and EHV-8/IR/2010/47, viruses were obtained from two nasal swabs taken from donkeys in Co. Cork, one of which was exhibiting respiratory signs and the other neurological signs. These samples were submitted for virus detection in 2010 and 2015, and AHV-3 was detected with the AHV-3 ORF70 primers. The viruses were then isolated by a single passage in RK13 cell monolayers. These isolates were designated EHV-8/IR/2010/16 and EHV-8/IR/2015/40, respectively.

The characterisation of archived isolates from diagnostic specimens was approved by the Board of Governors of the Irish Equine Centre.

ORF30 sequencing

The subsequent availability of the EHV-8 strain Wh genome sequence and of the ORF30 sequence from EHV-8 strain 804/87 [16] allowed sets of overlapping primers to be designed by using Primer3 [17], in order to facilitate the amplification and sequencing of the whole of ORF30. Viral DNA from the four viruses was isolated on first passage from the RK13 cell culture supernatant by using a QIAamp DNA mini kit (QIAGEN, Hilden, Germany). The amplified PCR products were purified by using a QIAquick gel extraction kit (QIAGEN) and sequenced commercially (QIAGEN Genomic Services, Hilden, Germany). The sequences were assembled by using BioEdit sequence alignment editor version 7.2.5 [18] and aligned by using ClustalW [19].

Genome sequencing

Each virus was passaged a further three times in RK13 cells. DNA was then extracted from infected cells by using a Hi-Pure PCR purification kit (Roche Diagnostics, Indianapolis, IN, USA) and quantified by using a Nanodrop 1000 spectrophotometer (Thermo Scientific, Wilmington, DE, USA).

Sequencing libraries were prepared from 5 μg DNA as described previously [20], and sequenced on a NextSeq instrument (Illumina, San Diego, CA, USA) to generate paired-end reads of 150 nucleotides (nt). The numbers of reads trimmed of adapters and low quality data are listed in Table 1. The reads for EHV-8/IR/2003/19 and EHV-8/IR/2010/47 were assembled de novo by using SPAdes version 3.5.0 [21], and the resulting contigs were ordered against the sequence of EHV-8 strain Wh in order to produce draft genome sequences. The draft genome sequences of EHV-8/IR/2010/16 and EHV-8/IR/2015/40 were produced by mapping the read data to the draft EHV-8/IR/2003/19 genome by reference-based assembly using Bowtie 2 version 2.2.6 [22]. Alignments of the respective data sets against the four draft genome sequences were visualised by using Tablet version 1.14.11.07 [23], and the consensus sequences were corrected manually. No major variants were noted in any of the sequences. The sizes of 16 tandem reiterations in each genome were determined by generating eight PCR products and sequencing them using internal primers (Sigma-Aldrich). The genome termini were mapped by identifying sets of sequence reads that shared a common end in the regions corresponding to the EHV-1 and EHV-4 genome termini [2426]. Locating the genome termini led to the construction of the complete genome sequences. The numbers of reads mapping to each sequence, the coverage depths and the GenBank accessions are listed in Table 1.

Table 1. Summary of sequencing and genome data for the four Irish EHV-8 strains.

EHV-8/IR/2003/19 EHV-8/IR/2010/47 EHV-8/IR/2010/16 EHV-8/IR/2015/40
Total trimmed reads (no.) 3,281,110 4,231,272 3,624,440 2,810,830
EHV-8 reads (no.) 237,890 1,207,021 886,413 175,652
Coverage depth (reads/nt) 237 1195 878 175
Genome size (bp) 149,600 149,800 149,405 149,667
 UL size (bp) 112,966 113,368 112,917 113,337
 US size (bp) 12,148 12,316 12,358 12,346
 TRL/IRL size (bp) 32 32 32 32
 TRS/IRS size (bp) 12,211 12,026 12,033 11,960
GenBank accession no. MF431611 MF431612 MF431613 MF431614
European Nucleotide Archive study accession no. PRJEB24126 PRJEB24126 PRJEB24126 PRJEB24126

Abbreviations: EHV-8, equid herpesvirus 8, UL, unique long region; US, unique short region; TRL/IRL and TRS/IRS, terminal and internal inverted repeats flanking UL and US, respectively.

Protein-coding regions were assigned on the basis of the EHV-1 model [24]. Comparative analysis of predicted amino acid sequences was carried out by using ClustalW implemented in Bioedit. The genomes of EHV-1 strain V592 (N752 strain, GenBank accession AY464052), EHV-1 hypervirulent strain AB4 (D752 strain, GenBank accession AY665713) and EHV-9 strain P19 (GenBank accession AP010838) were included in these comparisons. The corresponding amino acid sequences for each strain were generated as Fasta files, pairs of sequences were aligned for each protein, and pairwise identity values were calculated by using the BLOSUM62 similarity matrix. Pairwise identity range values were calculated for each alignment from the minimal and maximal identity values of the four EHV-8 strains in comparison with EHV-1 and EHV-9.

Phylogenetic analysis

An alignment containing the four Irish EHV-8 genome sequences and that of EHV-8 strain Wh was created by using Gap4 [27], and used as the basis for comparison. Multiple sequence alignments of the predicted amino acid sequences of individual EHV-8 genes and of related genomes (S1 Table) were created by using Clustal implemented in Bioedit. Phylogenetic trees were computed by implementing the maximum likelihood method [28] in MEGA7 version 7.0.14 [29]. The optimal model for each tree was chosen on the basis of the lowest Bayesian information criterion (BIC) score. Further investigations of phylogenetic relationships were carried out by aligning the concatenated amino acid sequences of 74 of the 76 viral genes, implementing the JTT matrix-based model [30] with 1000 bootstrap replicates. ORF1 and ORF2 were omitted from this analysis because the genome of EHV-1 strain T529 10/84 lacks the 1,611 bp region containing these coding regions [31]. EHV-8 strain Wh was also omitted because of the presence of frameshifted genes.

Results

Detection of EHV-8

Prior to the availability of the EHV-8 strain Wh genome sequence, analysis of the 287 bp portion of ORF70 of the two viruses from horse foetuses revealed differences of only 1–2 nt in comparison with the Australian EHV-8 strain. The two isolates from donkeys were identical to EHV-8/IR/2003/19 in ORF70. These results identified the four Irish viruses as being isolates of EHV-8. The levels of identity of the corresponding regions in the closest related genomes (those of EHV-1 and EHV-9) were approximately 95% (i.e. differences of up to 15 nt).

ORF30 sequences

Comparison of the nucleotide sequences of ORF30 for the four Irish strains showed that they share 99.67–99.97% identity. The sequences obtained through Sanger sequencing using overlapping PCR products were identical to those obtained during the whole genome/Ilumina read assembly. Horse strain EHV-8/IR/2003/19 is more closely related to asinine strain EHV-8/IR/2010/16 than to horse strain EHV-8/IR/2010/47. The levels of identity to EHV-8 strains Wh and 804/87 are 99.5–99.7% and 99.5–99.6%, respectively. The four Irish strains are slightly more closely related to EHV-9 (approximately 95%) than they are to EHV-1 (approximately 93%).

At the level of predicted amino acid sequences, the four Irish strains are 99.51–99.92% identical to each other, 99.51–99.75% identical to EHV-8 strain Wh and 99.34–99.67% identical to EHV-8 strain 804/87. All EHV-8 strains have an aspartic acid (D) residue at position 752 in the ORF30 protein, which corresponds to the putative D752 hypervirulence marker (formerly identified as a marker of neuropathogenicity) in EHV-1. The level of identity to EHV-9 strain P19 is approximately 97%, and those to EHV-1 strains AB4 and V592 are slightly lower, at 96% and 95%, respectively. To illustrate the relationship between the viruses, a phylogenetic tree was constructed (Fig 1). The four new Irish strains, EHV-8 strain Wh and EHV-8 strain 804/87 form a separate clade that is more closely related to EHV-9 than EHV-1.

Fig 1. Maximum likelihood phylogenetic tree of ORF30 amino acid sequences based on the JTT matrix-based model.

Fig 1

Details of the sequences are in S1 Table of the Supporting Information. The scale bar represents the number of substitutions per site. Bootstrap values after 1000 replications are indicated at major nodes.

Genome sequences

The linear genome of EHV-8 consists of unique long and short regions (UL and US) flanked by inverted terminal and internal repeats (TRL/IRL and TRS/IRS) in an arrangement (TRL-UL-IRL-IRS-US-TRS) that is typical of other varicelloviruses, including EHV-1 and EHV-9. The genome has the same complement and arrangement of 80 open reading frames (ORFs) predicted to encode functional proteins as EHV-1 and EHV-9, of which 76 are unique and four are duplicated in TRS/IRS (Fig 2). The size of the four Irish EHV-8 genomes ranges from 149405 to 149800 bp (Table 1). The component sizes are: UL (113 kbp), US (12 kbp), TRL/IRL (32 bp) and IRS/TRS (12 kbp). The average nucleotide composition of the whole genome is 54.5–54.6% G+C, and that of IRS/TRS is substantially higher (64.61–64.75% G+C).

Fig 2. Map of the equid herpesvirus 8 (EHV-8) genome.

Fig 2

The coordinates are based on the 149600 bp sequence of EHV-8/IR/2003/19. Predicted protein-coding regions are shown by coloured arrows with names below. Red open reading frames (ORFs) were inherited from the ancestor of family Herpesviridae and blue ORFs from the ancestor of subfamily Alphaherpesvirinae. Orange ORFs are specific to certain lineages within subfamily Alphaherpesvirinae. Inverted repeats TRS/IRS flanking US are coloured yellow, and inverted repeats TRL/IRL flanking UL are shown by green vertical lines at 1–32 and 112999–113030 bp. A third green vertical line marks a third copy of the TRL/IRL sequence that is part of a more extensive inverted repeat at 1–87 and 547–633 bp. Tandem reiterations are marked by grey shading, and origins of DNA replication by vertical red lines.

The four Irish EHV-8 genome sequences are 98.42–99.03% identical to each other. EHV-8/IR/2003/19 and EHV-8/IR/2010/16, which were isolated from a horse and donkey, respectively, share the highest level of identity to each other (99.03%; 1461 substitutions and indels), and the two viruses isolated from aborted horse foetuses (EHV-8/IR/2003/19 and EHV-8/IR/2010/47) share the lowest (98.42%; 2377 substitutions and indels). Levels of identity to EHV-8 strain Wh are lower (approximately 97%) for all four strains, and those to EHV-9 and EHV-1 are lower still, at approximately 92% and 89%, respectively. Many of the differences between the Irish strains and EHV-8 strain Wh are located in ORF64 (in TRS/IRS) and ORF71 (in US).

Alignment of sequences near the termini of the four Irish EHV-8 genomes with those of other varicelloviruses demonstrated the conservation of sequence elements (AnTn and γ) [32] that are required for the maturation of unit-length genomes from replicated concatemers (Fig 3). Compared with the Irish EHV-8 genomes, the EHV-8 strain Wh genome lacks a region of 398–601 bp at the left terminus and has an extra region of 1304 bp at the right terminus that corresponds to the region at the right end of UL.

Fig 3. Conserved sequences near the genome termini of equid varicelloviruses.

Fig 3

An alignment of sequences from the four Irish equid herpesvirus (EHV) 8 (EHV-8) strains, EHV-9 P19 (AP010838.1), EHV-1 AB4 (AY665713.1) and EHV-4 NS80567 (AF030027.1) is shown. In each sequence, TRL is boxed, the terminal nucleotides are shaded black, and conserved regions AnTn and γ (which are present near the left and right termini, respectively) are underlined. Ellipses denote the remainder of the genome.

Tandem reiterations

Sixteen tandem reiterations consisting of multiple copies of short, G+C-rich sequences (plus a partial copy) were identified in the genomes of the sequenced EHV-8 strains. Five are duplicated in TRS/IRS and seven form parts of protein-coding regions (four in ORF24 and three in ORF71) (Table 2). The number of repeat units differs among isolates, and three reiterations exhibit minor sequence variations in the unit sequence. EHV-8 strain Wh lacks four of the reiterations, three being part of ORF71 in the Irish strains and the other being located in the region near the left genome terminus that is not represented in the strain Wh sequence. The number of repeat units in some reiterations was substantially fewer in EHV-8 strain Wh than in the Irish strains.

Table 2. Tandem reiterations in EHV-8 genomes.

Number of units
Location (bp)1 Protein-coding region Unit size (bp) Partial unit size (bp) Unit sequence (5’-3’) EHV-8/IR/2003/19 EHV-8/IR/2010/47 EHV-8/IR/2010/16 EHV-8/IR/2015/40 EHV-8 Wh
97–199 / 2 17 5 CACCGGGAGGCCACGCC 6 18 (1+173) 9 (3+63) 13 _4
43719–43743 ORF24 63 4 TCCTTCCACCCTTCCACCCGCTTCCCCTCTACC
CCAACCCCCTTCAAAAGCCGCCAGCGGCAC
2 4 2 5 5
44338–44718 ORF24 33 18 GCCGCGGCCCCGGCCAAATCTGCGGCGGCCCCC 11 18 10 6 1
44754–44915 ORF24 12 6 GGCCAAGGACCA 13 9 11 14 7
44995–45165 ORF24 45 36 GAAAACACTCCCCTACCAGATGACTCGCCCATTG
GAGCTGTCCCC
3 3 2 3 2
73593–73868 / 32 20 GCGGGAGCGAGGGCTGCTGCGGCGGCGGTGCG 8 9 7 12 1
108616–108855 / 18 6 TAGCGCTAACGCTAGGGC 13 12 21 28 11
112183–112582 / 14 7 TGCCATAGTCCCCC 28 16 20 15 15
113199–113499
(149134–149432) 5
/ 15 _4 GGAAGGGGAGGAGCA 20 13 (6+73) 19 19 14
113500–13795
(148836–149131) 5
/ 12 _4 CCATCAACCCGC 24 18 8 11 12
120998–121049
(141582–141633) 5
/ 14 10 GTGGTCGGTGGTCG 3 10 3 5 6 11
121096–121257
(141374–141535) 5
/ 20 2 CCCAGCTCCAGCGACCCCAG 8 2 4 5 2
1213625–123802
(138829–139006) 5
/ 22 2 CAGAGCTGGGAGCCGAGTGGGG 8 9 12 6 8
129291–129481 ORF71 15 11 GCGGCTACCACCACA 12 17 18 17 _4
129594–129632 ORF71 15 7 ACCACATCTACCCCT 2 9 3 5 _4
129631–129855 ORF71 15 4 CTGAGACATCAACAG 15 13 22 19 _4

Abbreviations: EHV-8, equid herpesvirus 8; bp, base pair; ORF, open reading frame.

1 In EHV-8/IR/2003/19.

2 Not located in a predicted protein coding region.

3 Repeat units exhibiting sequence variation.

4 Not present.

5 Inverted sequence in TRS (terminal inverted repeat flanking US (unique short sequence)).

Origins of DNA replication

Three potential origins of DNA replication were identified in the Irish EHV-8 genomes, each being partially palindromic and containing inverted copies of a diagnostic 9 bp sequence (CGTTCGCAC) separated by an A+T-rich sequence [33]. OriS is located in IRS/TRS between ORF64 and ORF65, and OriL is located in the centre of UL between ORF39 and ORF40 (Fig 2).

Conservation of protein-coding regions among EHV-8 strains

The predicted amino acid sequences of 73 of the 76 predicted protein-coding regions are ≥99% identical among the Irish strains, the exceptions being ORF24, ORF64 and ORF71. The numbers of predicted amino acid differences in relation to EHV-8/IR/2003/19 (excluding regions encoded by tandem reiterations) are summarised in S2 Table. A total of 24 ORFs are completely conserved among the Irish strains, and 16 of these are also completely conserved in EHV-8 strain Wh. Among the Irish strains, the largest number of amino acid differences from EHV-8/IR/2003/19 was recorded for EHV-8/IR/2010/47 (87 differences across 32 proteins). Strain EHV-8/IR/2015/40, isolated from a donkey with neurological signs, has 86 amino acid differences from EHV-8/IR/2003/19 in 42 proteins.

The level of identity among the Irish strains in ORF24 (encoding the large tegument protein) is 95.61–99.03%. These lower values are largely due to differences in the lengths of tandem reiterations (3499–3602 residues). Likewise, the levels of identity between the Irish strains and EHV-8 strain Wh is lower (93.65–97.75%) because the latter has shorter tandem reiterations in ORF24 (3445 residues).

The level of identity among the Irish strains in ORF64 (encoding transcriptional regulator ICP4) is 97.08–99.93%. EHV-8/IR/2010/47 is the most divergent, having 33 differences from EHV-8/IR/2003/19, with the majority of these located at the N terminus. Isolate EHV-8/IR/2015/40 has 14 differences from EHV-8/IR/2003/19, with all but one of these being common to EHV-8 strain Wh. However, the EHV-8 strain Wh protein has a much lower overall level of identity (87.80–90.58%) to the Irish EHV-8 proteins. This is due to a frameshift in the EHV-8 strain Wh gene that results in a C-terminally truncated protein. This truncation leads to the absence of conserved amino acid sequence motifs that are required for gene regulation in other alphaherpesviruses [34].

ORF71 (encoding gp2, which is equivalent to herpes simplex virus type 1 (HSV-1) glycoprotein J) is the least conserved of the 76 predicted proteins, having a level of identity among the Irish strains of 92.42–97.60%. Most differences are due to three tandem reiterations that differ in length among strains. Strain Wh shares only 62.10–69.60% identity to the Irish strains, due in part to the absence of two of the reiterations that are common to the Irish strains and in part to a frameshift-induced truncation of the strain Wh protein to 544 residues, compared to 853–923 residues in the Irish strains.

Conservation of EHV-9 and EHV-1 protein-coding regions in EHV-8

Pairwise sequence alignments indicate that the level of amino acid sequence divergence between the Irish EHV-8 strains and EHV-1 strain V592 ranges from 73.18 (ORF71) to 99.18% (ORF44) (Table 3), with 34, 28 and 14 proteins exhibiting >95, 90–94 and <90% identity, respectively, to their EHV-1 equivalents. In contrast, the levels of identity between the EHV-8 strains and EHV-9 strain P19 range from 74.89 (ORF71) to 99.45% (ORF44), with 46, 21 and 9 proteins sharing >95, 90–94 and <90% identity, respectively, to the corresponding EHV-9 proteins (Table 3). In addition, the majority of ORFs (74 out of 76) share a higher level of identity to EHV-9 strain P19 than EHV-1 V592, the exceptions being ORF41 and ORF75.

Table 3. Amino acid sequence identity of genes of the Irish EHV-8 strains to their homologues in EHV-1 and EHV-9.

ORF HSV-1 equivalent 1 Protein Identity to EHV-1 strain V592 (range, %) Identity to EHV-9 strain P19 (range, %)
1 UL56 Membrane protein UL56 91.08 93.06 2
2 _ Membrane protein V1 85.85–86.34 88.72–89.21
3 _ Myristylated tegument protein CIRC 90.27–90.66 93.77–94.16
4 UL55 Nuclear protein UL55 92.50 95.50–95.55
5 UL54 Multifunctional expression regulator 93.40–93.61 95.53–95.74
6 UL53 Envelope glycoprotein K 97.95 97.95
7 UL52 Helicase-primase primase subunit 93.06–93.24 95.46–95.64
8 UL51 Tegument protein UL51 95.91–96.32 97.55–97.95
9 UL50 Deoxyuridine triphosphatase 96.62–97.23 96.62–97.23
10 UL49A Envelope glycoprotein N 94.0–95.0 97.0–98.0
11 UL49 Tegument protein VP22 91.47 95.40
12 UL48 Transactivating tegument protein VP16 92.20–92.43 93.10–93.31
13 UL47 Tegument protein VP13/14 84.73–84.95 85.30–85.55
14 UL46 Tegument protein VP11/12 91.86–92.0 95.29–95.43
15 UL45 Membrane protein UL45 85.38–85.84 91.63–92.07
16 UL44 Envelope glycoprotein C 93.06–93.27 93.48–93.69
17 UL43 Envelope protein UL43 96.25 97.75
18 UL42 DNA polymerase processivity subunit 96.05–96.31 97.78–98.02
19 UL41 Tegument host shut-off protein 94.36 97.58
20 UL40 Ribonucleotide reductase subunit 2 96.26–96.57 96.88–97.19
21 UL39 Ribonucleotide reductase subunit 1 96.32 97.59
22 UL38 Capsid triplex subunit 1 95.05–95.26 98.28–98.49
23 UL37 Tegument protein UL37 93.43–93.53 94.22–94.31
24 UL36 Large tegument protein 86.95–89.66 88.8–90.55
25 UL35 Small capsid protein 95.79–96.63 96.63–97.47
26 UL34 Nuclear egress membrane protein 94.54–94.90 97.81–98.18
27 UL33 DNA packaging protein
UL33
88.54–89.31 93.84–94.61
28 UL32 DNA packaging protein UL32 89.69–89.85 94.68–94.85
29 UL31 Nuclear egress lamina protein 97.85 98.46
30 UL30 DNA polymerase catalytic subunit 95.81–96.06 97.04–97.29
31 UL29 Single stranded DNA- binding protein 97.35–97.43 97.76–97.84
32 UL28 DNA packaging terminase subunit 2 96.64 96.9
33 UL27 Envelope glycoprotein B 96.22–96.32 97.16–97.38
34 _ Protein V32 87.50–88.12 90.62–91.25
35 UL26 Capsid maturation protease 96.59–96.74 97.36–97.52
35.5 UL26.5 Capsid scaffold protein 96.35 96.35
36 UL25 DNA packaging tegument protein UL25 95.74–96.08 96.93–97.27
37 UL24 Nuclear protein UL24 94.5 94.74
38 UL23 Thymidine kinase 97.15 98.01
39 UL22 Envelope glycoprotein H 95.65 96.47
40 UL21 Tegument protein UL21 96.98 97.73
41 UL20 Envelope protein UL20 97.07 96.58
42 UL19 Major capsid protein 99.05–99.12 99.20–99.27
43 UL18 Capsid triplex subunit 2 97.77 98.72
44 UL15 DNA packaging terminase subunit 1 99.04–99.18 99.32–99.45
45 UL17 DNA packaging tegument protein UL17 96.17–96.31 96.74–96.88
46 UL16 Tegument protein UL16 95.13–95.40 97.28–97.56
48 UL14 Tegument protein UL14 90.53 93.71
49 UL13 Tegument serine/threonine protein kinase 94.61–94.78 96.30–96.49
50 UL12 Deoxyribonuclease 95.04 96.1
51 UL11 Myristylated tegument protein 90.54 94.52
52 UL10 Envelope glycoprotein M 97.11 98.22
53 UL9 DNA replication origin-binding protein 97.51 98.13
54 UL8 Helicase-primase subunit 92.27–92.41 95.87–96.0
55 UL7 Tegument protein UL7 94.38–95.04 97.02
56 UL6 Capsid portal protein 95.21–95.48 96.81–97.10
57 UL5 Helicase-primase helicase subunit 96.14–96.36 96.93–97.16
58 UL4 Nuclear protein UL4 90.66–91.11 93.75–94.19
59 _ Protein V57 82.96–83.51 90.65–91.20
60 UL3 Nuclear protein UL3 96.69 97.64
61 UL2 Uracil- DNA glycosylase 91.05 96.11–96.60
62 UL1 Envelope glycoprotein L 88.24 89.83
63 RL2 Ubiquitin E3 ligase ICP0 86.13–86.66 87.29–87.82
64 RS1 Transcriptional regulator ICP4 90.37–91.52 94.37–95.87
65 US1 Regulatory protein ICP22 94.53–94.88 96.56–96.90
66 US10 Virion protein US10 93.22–93.64 94.44–94.87
67 _ Virion protein V67 92.7 94.89
68 US2 Virion protein US2 84.15–84.48 89.86–90.54
69 US3 Serine/threonine protein kinase US3 93.19 93.73
70 US4 Envelope glycoprotein G 91.97–92.21 92.21–92.45
71 US5 Envelope glycoprotein J 73.18–75.83 74.89–77.33
72 US6 Envelope glycoprotein D 90.79–91.04 91.29
73 US7 Envelope glycoprotein I 90.56 92
74 US8 Envelope glycoprotein E 95.63–95.81 97.09–97.27
75 US8A Membrane protein US8A 84.61–85.38 83.84–84.61
76 US9 Membrane protein US9 82.64 86.30

Abbreviations: EHV-8, equid herpesvirus 8; EHV-1, equid herpesvirus 1; EHV-9, equid herpesvirus 9; HSV-1, herpes simplex virus type 1; ORF, open reading frame; UL, US, RL and RS, genes located in UL, US, TRL/IRL, TRS/IRS, respectively (UL, unique long region; US, unique short region; TRL/IRL and TRS/IRS, terminal and internal inverted repeats flanking UL and US, respectively); VP, viral protein; ICP, infected cell protein

1 Nomenclature of HSV-1 homologues or positional counterparts. Genes lacking HSV-1 positional counterparts are indicated by hyphens.

2 The higher identity range in each row is in bold type.

An additional evolutionary comparison was generated by constructing a phylogenetic tree based on a concatenation of the amino acid sequences of 74 ORFs (Fig 4). This demonstrated that the four Irish EHV-8 strains cluster separately from EHV-9 and EHV-1 strains.

Fig 4. Phylogenetic tree of concatenated amino acid sequences of ORF3-ORF76 from the Irish equid herpesvirus 8 (EHV-8) strains, EHV-8 strain Wh and other equid alphaherpesvirus strains.

Fig 4

The tree was constructed by using the maximum likelihood method based on the JTT matrix-based model [30], and is drawn to scale. Bootstrap values from 1000 replicates are shown as percentages at major nodes.

Discussion

The complete genome sequences of four EHV-8 strains isolated in Ireland between 2003 and 2015 were determined. Two of the strains were isolated from the aborted foetuses of horses, which on the basis of gross post mortem findings and histopathological examination had been diagnosed as EHV-associated abortions. A further two strains were isolated from nasal swabs from donkeys, one exhibiting neurological signs and the other respiratory disease. The sequences were determined by Illumina sequencing and compared with that of EHV-8 strain Wh, which was determined by Sanger technology [11], and those of other equid alphaherpesviruses. EHV-8 shares a common genome structure with other equid alphaherpesviruses in the genus Varicellovirus, whereas the EHV-8 strain Wh sequence lacks the accurate identification of the genome termini [32] and is apparently incomplete at the left terminus. In addition, frameshifts are apparent in two genes (ORF64 and ORF71) of EHV-8 strain Wh, and at least the former is likely to represent sequencing errors. The sequences of the four Irish strains thus represent the first complete EHV-8 genome sequences to be reported.

Phylogenetic analysis indicates that the Irish EHV-8 strains exhibit minimal diversity. They cluster together and are closely related to, but distinct from, EHV-9 and EHV-1. Sequence alignments revealed a low degree of heterogeneity among strains isolated from two host species over a 12 year period. EHV-8/IR/2003/19 and EHV-8/IR/2010/16 show the highest similarity of the Irish EHV-8 isolates at both the nucleotide and amino acid levels, despite having been isolated from a horse and donkey, respectively. In contrast, EHV-1 strains isolated from gazelle, onager and Grevy’s zebra form a separate genetic group from EHV-1 strains isolated from horses [35].

Although donkeys have been reported to be the natural hosts for EHV-8 [9], our data demonstrate that the virus has the capability to cross host species and cause abortion in horses. Cases of natural infection by EHV-9, which is closely related to EHV-8, have been reported in multiple species including gazelles [3], zebras [36] and giraffes [37], and the virus has been isolated from an aborted Persian onager in a zoo [36]. Infections caused by cross-species transmission of herpesviruses can result in increased virulence and cause severe or fatal diseases. For example, EHV-9 has been associated with meningoencephalitis in a polar bear that necessitated euthanasia [38], and fatal acute encephalitis has been induced by experimental infection in goats [39] and pigs [40]. EHV-9-inoculated horses exhibited mild encephalitis but lacked vasculitis, which is one of the main pathological lesions of EHV-1 neurologic disease [41]. EHV-1 has been isolated from non-equid species including cattle [42], deer [43], antelope [44], alpacas and llamas [45]. Wohlsein et al. [46] identified D752 EHV-1 in Thomson’s gazelles, black bear and guinea pigs in two different zoo epizootics that were associated with abortion, severe neurological signs and high mortality rates.

It is possible that EHV-8 is under-diagnosed in horses because of its close relationship to other equid alphaherpesviruses. Indeed, the EHV-8 strains isolated from two aborted foetuses of horses in this study were identified incorrectly as EHV-1 during initial testing, due to cross reactivity of the PCR assay. Viral causes of abortion in horses have only been attributed to EHV-1, and less frequently EHV-4 and equine viral arteritis [47]. In future, EHV- 8 will need to be included in the differential diagnosis. The availability of EHV-8 genome sequences will facilitate the development of a specific PCR assay for EHV-8 in aborted foetuses and neonatal foal deaths, and will also enable further investigation into the putative of role of EHV-8 in equid neurological disease. In this study, we report the first isolation of EHV-8 from a donkey with neurological disease. The number of outbreaks of neurological disease in horses attributed to the EHV-1 hypervirulent phenotype may be inflated, as may the increased prevalence of this phenotype in EHV-1 abortions [48], due to the inclusion of EHV-8 cases. The ORF30 variation (D752/N752) has been applied to the development of PCR tests to discriminate between EHV-1 hypervirulent and non-hypervirulent strains [4951]. All sequenced EHV-8 strains have the D752 genotype, and the specificity of the EHV-1 allelic discrimination test has not been assessed for EHV-8 [49]. Given the high level of sequence identity to EHV-8 at the primer-binding sites used in this assay [49], with one mismatch in the forward primer and none in the reverse primer or the probe (G2254), there is a strong likelihood of misidentified detections. Furthermore, an assessment of the EHV-1 gC primers used initially in this study [12] showed that there were only two mismatches in the forward primer and one in the reverse primer.

The EHV-8 strains isolated from the two horse abortions originated in two distinct provinces approximately 7 years apart. The source of infection in either case was unknown. Donkeys and horses occasionally share pasture in Ireland, but neither mare had a history of contact with donkeys during the gestation period. Moreover, cross-species transmission of EHV-1 and EHV-9 has been reported in animals that do not have direct contact. It has been hypothesised that water can act as a source of herpesvirus infections, and EHV-1 has been shown to remain infectious in water for up to three weeks [52]. However, there is currently no evidence to support the survival of EHV-8 in water as a basis for cross-species transmission to horses. As an alternative, the possibility that EHV-8 circulates continuously in horses, even at a low level, merits investigation. One potentially useful corollary to the availability of the EHV-8 genome sequences would be the development of an EHV-8-specific peptide-based ELISA similar to that developed for the detection and differentiation of EHV-1- and EHV-9-specific antibodies [53]. This ELISA could be used to determine the seroprevalence of EHV-8 infections in donkeys and horses. Alternatively, the available sequence information makes it possible to develop PCR assays to investigate, by examination of existing or latent virus populations in horses, whether these viruses represent sporadic events in which the donkey virus has crossed into individual horses, or whether EHV-8 is circulating in some horse populations. This approach has been employed previously when trying to detect co-infections with neuropathogenic versus abortigenic strains [54] or in a wider range of equids [4].

The co-occurrence of EHV-1 and EHV-8 also needs to be monitored because EHVs have the potential to diversify rapidly by recombination. Recombinant EHV-1/EHV-9 infections that originated in asymptomatic zebras were reported to cause non-fatal and fatal encephalitis in polar bears [55] and abortion and neurological disease in Indian rhinoceroses [56].

In conclusion, the current study suggests that EHV-8 can cause abortion in horses. The potential threat of EHV-8 to the horse industry and the possibility that donkeys may act as reservoirs of infection warrant further investigation. The determination of complete genome sequences of EHV-8 strains will serve as a key reference for the development of specific assays for diagnosis and epidemiological research.

Supporting information

S1 Table. GenBank accession numbers of equid alphaherpesvirus sequences used in phylogenetic analyses.

(DOCX)

S2 Table. Number of amino acid sequence differences among the Irish equid herpesvirus (EHV-8) strains.

(DOCX)

Data Availability

The EHV-8/IR/2003/19, EHV-8/IR/2010/47, EHV-8/IR/2010/16 and EHV-8/IR/2015/40 genome sequences are deposited in GenBank (https://www.ncbi.nlm.nih.gov/genbank/) under accession numbers MF431611, MF431612, MF431613 and MF431614, respectively. The sequence read datasets are deposited in the European Nucleotide Archive under accession numbers ERS2068140, ERS2068141, ERS2068142 and ERS2068143 in study number PRJEB24126 (http://www.ebi.ac.uk/ena/data/view/PRJEB24126).

Funding Statement

This work was funded by the Irish Research Council (grant number EBPPG/2014/62 to MG; http://research.ie) and the Medical Research Council (grant number MC_UU_12014/3 to AD; http://www.mrc.ac.uk). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Patel JR, Heldens J. Equine herpesviruses 1 (EHV-1) and 4 (EHV-4)–epidemiology, disease and immunoprophylaxis: A brief review. Vet J. 2005;170: 14–23. 10.1016/j.tvjl.2004.04.018 [DOI] [PubMed] [Google Scholar]
  • 2.Browning GF, Ficorilli N, Studdert MJ. Asinine herpesvirus genomes: comparison with those of the equine herpesviruses. Arch Virol. 1988;101: 183–190. [DOI] [PubMed] [Google Scholar]
  • 3.Fukushi H, Tomita T, Taniguchi A, Ochiai Y, Kirisawa R, Matsumura T, et al. Gazelle herpesvirus 1: a new neurotropic herpesvirus immunologically related to equine herpesvirus 1. Virology. 1997;227: 34–44. 10.1006/viro.1996.8296 [DOI] [PubMed] [Google Scholar]
  • 4.Abdelgawad A, Damiani A, Ho SYW, Strauss G, Szentiks CA, East ML, et al. Zebra Alphaherpesviruses (EHV-1 and EHV-9): Genetic Diversity, Latency and Co-Infections. Viruses. 2016;8: 262 10.3390/v8090262 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Davison AJ, Eberle R, Ehlers B, Hayward GS, McGeoch DJ, Minson AC, et al. The order Herpesvirales. Arch Virol. 2009;154: 171–177. 10.1007/s00705-008-0278-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Bloom DC. Alphaherpesvirus Latency: A Dynamic State of Transcription and Reactivation. Adv Virus Res. 2016;94: 53–80. 10.1016/bs.aivir.2015.10.001 [DOI] [PubMed] [Google Scholar]
  • 7.Lunn DP, Davis-Poynter N, Flaminio MJ, Horohov DW, Osterrieder K, Pusterla N, et al. Equine herpesvirus-1 consensus statement. J Vet Intern Med. 2009;23: 450–461. 10.1111/j.1939-1676.2009.0304.x [DOI] [PubMed] [Google Scholar]
  • 8.Crabb BS, Studdert MJ. Comparative studies of the proteins of equine herpesviruses 4 and 1 and asinine herpesvirus 3: antibody response of the natural hosts. J Gen Virol. 1990;71: 2033–2041. 10.1099/0022-1317-71-9-2033 [DOI] [PubMed] [Google Scholar]
  • 9.Ficorilli N, Studdert MJ, Crabb BS. The nucleotide sequence of asinine herpesvirus 3 glycoprotein G indicates that the donkey virus is closely related to equine herpesvirus 1. Arch Virol. 1995;140: 1653–1662. [DOI] [PubMed] [Google Scholar]
  • 10.Virus taxonomy, 6th report of the International Committee on Taxonomy of Viruses. Arch Virol Suppl. 1995;10: 1–586. [PubMed] [Google Scholar]
  • 11.Liu C, Guo W, Lu G, Xiang W, Wang X. Complete genomic sequence of an equine herpesvirus type 8 Wh strain isolated from China. J Virol. 2012;86: 5407 10.1128/JVI.00445-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Lawrence GL, Gilkerson J, Love DN, Sabine M, Whalley JM. Rapid, single-step differentiation of equid herpesviruses 1 and 4 from clinical material using the polymerase chain reaction and virus-specific primers. J Virol Methods. 1994;47: 59–72. 10.1016/0166-0934(94)90066-3 [DOI] [PubMed] [Google Scholar]
  • 13.Allen GP Slater JD, Smith KC K JH. Equid herpesvirus 1 and equid herpesvirus 4 infections In: Coetzer JAW T RC, editor. Infectious Diseases of Livestock. Newmarket: Oxford University Press; 2004. p. 829–859. [Google Scholar]
  • 14.Nugent J, Birch-Machin I, Smith KC, Mumford JA, Swann Z, Newton JR, et al. Analysis of equid herpesvirus 1 strain variation reveals a point mutation of the DNA polymerase strongly associated with neuropathogenic versus nonneuropathogenic disease outbreaks. J Virol. 2006;80: 4047–4060. 10.1128/JVI.80.8.4047-4060.2006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol. 1990;215: 403–410. 10.1016/S0022-2836(05)80360-2 [DOI] [PubMed] [Google Scholar]
  • 16.Cuxson JL, Hartley CA, Ficorilli NP, Symes SJ, Devlin JM, Gilkerson JR. Comparing the genetic diversity of ORF30 of Australian isolates of 3 equid alphaherpesviruses. Vet Microbiol. 2014;169: 50–57. 10.1016/j.vetmic.2013.12.007 [DOI] [PubMed] [Google Scholar]
  • 17.Rozen S, Skaletsky H. Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol. 2000;132: 365–386. [DOI] [PubMed] [Google Scholar]
  • 18.Hall. BioEdit: A user-friendly sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. 1999;41: 95–98. [Google Scholar]
  • 19.Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, et al. Clustal W and Clustal X version 2.0. Bioinformatics. 2007;23: 2947–2948. 10.1093/bioinformatics/btm404 [DOI] [PubMed] [Google Scholar]
  • 20.Wilkie GS, Davison AJ, Kerr K, Stidworthy MF, Redrobe S, Steinbach F, et al. First fatality associated with elephant endotheliotropic herpesvirus 5 in an Asian elephant: pathological findings and complete viral genome sequence. Sci Rep. 2014;4: 6299 10.1038/srep06299 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Bankevich A, Nurk S, Antipov D, Gurevich AA, Dvorkin M, Kulikov AS, et al. SPAdes: a new genome assembly algorithm and its applications to single-cell sequencing. J Comput Biol. 2012;19: 455–477. 10.1089/cmb.2012.0021 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Langmead B, Salzberg SL. Fast gapped-read alignment with Bowtie 2. Nat Methods. 2012;9: 357–359. 10.1038/nmeth.1923 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Milne I, Bayer M, Cardle L, Shaw P, Stephen G, Wright F, et al. Tablet—next generation sequence assembly visualization. Bioinformatics. 2010;26: 401–402. 10.1093/bioinformatics/btp666 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Telford EA, Watson MS, McBride K, Davison AJ. The DNA sequence of equine herpesvirus-1. Virology. 1992;189: 304–316. [DOI] [PubMed] [Google Scholar]
  • 25.Cullinane AA, Rixon FJ, Davison AJ. Characterization of the genome of equine herpesvirus 1 subtype 2. J Gen Virol. 1988;69: 1575–1590. 10.1099/0022-1317-69-7-1575 [DOI] [PubMed] [Google Scholar]
  • 26.Telford EA, Watson MS, Perry J, Cullinane AA, Davison AJ. The DNA sequence of equine herpesvirus-4. J Gen Virol. 1998;79: 1197–1203. 10.1099/0022-1317-79-5-1197 [DOI] [PubMed] [Google Scholar]
  • 27.Staden R. The Staden sequence analysis package. Mol Biotechnol. 1996;5: 233–241. [DOI] [PubMed] [Google Scholar]
  • 28.Felsenstein J. Evolutionary trees from DNA sequences: a maximum likelihood approach. J Mol Evol. 1981;17: 368–376. [DOI] [PubMed] [Google Scholar]
  • 29.Kumar S, Stecher G, Tamura K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol Biol Evol. 2016;33: 1870–1874. 10.1093/molbev/msw054 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Jones DT, Taylor WR, Thornton JM. The rapid generation of mutation data matrices from protein sequences. Comput Appl Biosci. 1992;8: 275–282. [DOI] [PubMed] [Google Scholar]
  • 31.Guo X, Izume S, Okada A, Ohya K, Kimura T, Fukushi H. Full genome sequences of zebra-borne equine herpesvirus type 1 isolated from zebra, onager and Thomson’s gazelle. J Vet Med Sci. 2014;76: 1309–1312. 10.1292/jvms.14-0183 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Chowdhury SI, Buhk HJ, Ludwig H, Hammerschmidt W. Genomic termini of equine herpesvirus 1. J Virol. 1990;64: 873–880. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Baumann RP, Yalamanchili VR, O’Callaghan DJ. Functional mapping and DNA sequence of an equine herpesvirus 1 origin of replication. J Virol. 1989;63: 1275–1283. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Wagner LM, Lester JT, Sivrich FL, DeLuca NA. The N terminus and C terminus of herpes simplex virus 1 ICP4 cooperate to activate viral gene expression. J Virol. 2012;86: 6862–6874. 10.1128/JVI.00651-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Ghanem YM, Fukushi H, Ibrahim ES, Ohya K, Yamaguchi T, Kennedy M. Molecular phylogeny of equine herpesvirus 1 isolates from onager, zebra and Thomson’s gazelle. Arch Virol. 2008;153: 2297–2302. 10.1007/s00705-008-0247-y [DOI] [PubMed] [Google Scholar]
  • 36.Schrenzel MD, Tucker TA, Donovan TA, Busch MD, Wise AG, Maes RK, et al. New hosts for equine herpesvirus 9. Emerg Infect Dis. 2008;14: 1616–1619. 10.3201/eid1410.080703 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Kasem S, Yamada S, Kiupel M, Woodruff M, Ohya K, Fukushi H. Equine herpesvirus type 9 in giraffe with encephalitis. Emerg Infect Dis. 2008;14: 1948–1949. 10.3201/eid1412.080801 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Donovan TA, Schrenzel MD, Tucker T, Pessier AP, Bicknese B, Busch MD, et al. Meningoencephalitis in a polar bear caused by equine herpesvirus 9 (EHV-9). Vet Pathol. 2009;46: 1138–1143. 10.1354/vp.09-VP-0007-D-CR [DOI] [PubMed] [Google Scholar]
  • 39.Taniguchi A, Fukushi H, Yanai T, Masegi T, Yamaguchi T, Hirai K. Equine herpesvirus 9 induced lethal encephalomyelitis in experimentally infected goats. Arch Virol. 2000;145: 2619–2627. 10.1007/s007050070011 [DOI] [PubMed] [Google Scholar]
  • 40.Narita M, Uchimura A, Kimura K, Tanimura N, Yanai T, Masegi T, et al. Brain Lesions and Transmission of Experimental Equine Herpesvirus Type 9 in Pigs. Vet Pathol. 2000;37: 476–479. 10.1354/vp.37-5-476 [DOI] [PubMed] [Google Scholar]
  • 41.Taniguchi A, Fukushi H, Matsumura T, Yanai T, Masegi T, Hirai K. Pathogenicity of a New Neurotropic Equine Herpesvirus 9 (Gazelle Herpesvirus 1) in Horses. J Vet Med Sci. 2000;62: 215–218. 10.1292/jvms.62.215 [DOI] [PubMed] [Google Scholar]
  • 42.Crandell RA, Ichimura H, Kit S. Isolation and comparative restriction endonuclease DNA fingerprinting of equine herpesvirus-1 from cattle. Am J Vet Res. 1988;49: 1807–1813. [PubMed] [Google Scholar]
  • 43.Kinyili JH, Thorsen J. Antigenic comparisons between herpesviruses isolated from fallow deer in Alberta and the viruses of infectious bovine rhinotracheitis, equine rhinopneumonitis and DN-599, a non-IBR bovine herpesvirus. J Wildl Dis. 1979;15: 339–341. [DOI] [PubMed] [Google Scholar]
  • 44.Chowdhury SI, Ludwig H, Buhk HJ. Molecular biological characterization of equine herpesvirus type 1 (EHV-1) isolates from ruminant hosts. Virus Res. 1988;11: 127–139. [DOI] [PubMed] [Google Scholar]
  • 45.Rebhun WC, Jenkins DH, Riis RC, Dill SG, Dubovi EJ, Torres A. An epizootic of blindness and encephalitis associated with a herpesvirus indistinguishable from equine herpesvirus I in a herd of alpacas and llamas. J Am Vet Med Assoc. 1988;192: 953–956. [PubMed] [Google Scholar]
  • 46.Wohlsein P, Lehmbecker A, Spitzbarth I, Algermissen D, Baumgärtner W, Böer M, et al. Fatal epizootic equine herpesvirus 1 infections in new and unnatural hosts. Vet Microbiol. 2011;149: 456–460. 10.1016/j.vetmic.2010.11.024 [DOI] [PubMed] [Google Scholar]
  • 47.Bażanów BA, Jackulak NA, Frącka AB, Staroniewicz ZM. Abortogenic viruses in horses. Equine Vet Educ. 2014;26: 48–55. 10.1111/eve.12084 [DOI] [Google Scholar]
  • 48.Smith KL, Allen GP, Branscum AJ, Frank Cook R, Vickers ML, Timoney PJ, et al. The increased prevalence of neuropathogenic strains of EHV-1 in equine abortions. Vet Microbiol. 2010;141: 5–11. 10.1016/j.vetmic.2009.07.030 [DOI] [PubMed] [Google Scholar]
  • 49.Smith KL, Li Y, Breheny P, Cook RF, Henney PJ, Sells S, et al. New Real-Time PCR Assay Using Allelic Discrimination for Detection and Differentiation of Equine Herpesvirus-1 Strains with A(2254) and G(2254) Polymorphisms. J Clin Microbiol. 2012;50: 1981–1988. 10.1128/JCM.00135-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Allen GP. Development of a real-time polymerase chain reaction assay for rapid diagnosis of neuropathogenic strains of equine herpesvirus-1. J Vet Diagn Invest. 2007;19: 69–72. 10.1177/104063870701900110 [DOI] [PubMed] [Google Scholar]
  • 51.Balasuriya UB, Crossley BM, Timoney PJ. A review of traditional and contemporary assays for direct and indirect detection of Equid herpesvirus 1 in clinical samples. J Vet Diagn Invest. 2015. 27:673–87. 10.1177/1040638715605558 [DOI] [PubMed] [Google Scholar]
  • 52.Dayaram A, Franz M, Schattschneider A, Damiani AM, Bischofberger S, Osterrieder N, et al. Long term stability and infectivity of herpesviruses in water. Sci Rep. 2017;7: 46559 10.1038/srep46559 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Abdelgawad A, Hermes R, Damiani A, Lamglait B, Czirjak GA, East M, et al. Comprehensive Serology Based on a Peptide ELISA to Assess the Prevalence of Closely Related Equine Herpesviruses in Zoo and Wild Animals. PLoS One. 2015;10: e0138370 10.1371/journal.pone.0138370 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Allen GP, Bolin DC, Bryant U, Carter CN, Giles RC, Harrison LR, et al. Prevalence of latent, neuropathogenic equine herpesvirus-1 in the Thoroughbred broodmare population of central Kentucky. Equine Vet J. 2008;40: 105–110. 10.2746/042516408X253127 [DOI] [PubMed] [Google Scholar]
  • 55.Greenwood AD, Tsangaras K, Ho SYW, Szentiks CA, Nikolin VM, Ma G, et al. A Potentially Fatal Mix of Herpes in Zoos. Curr Biol. 2012;22: 1727–1731. 10.1016/j.cub.2012.07.035 [DOI] [PubMed] [Google Scholar]
  • 56.Abdelgawad A, Azab W, Damiani AM, Baumgartner K, Will H, Osterrieder N, et al. Zebra-borne equine herpesvirus type 1 (EHV-1) infection in non-African captive mammals. Vet Microbiol. 2014;169: 102–106. 10.1016/j.vetmic.2013.12.011 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Table. GenBank accession numbers of equid alphaherpesvirus sequences used in phylogenetic analyses.

(DOCX)

S2 Table. Number of amino acid sequence differences among the Irish equid herpesvirus (EHV-8) strains.

(DOCX)

Data Availability Statement

The EHV-8/IR/2003/19, EHV-8/IR/2010/47, EHV-8/IR/2010/16 and EHV-8/IR/2015/40 genome sequences are deposited in GenBank (https://www.ncbi.nlm.nih.gov/genbank/) under accession numbers MF431611, MF431612, MF431613 and MF431614, respectively. The sequence read datasets are deposited in the European Nucleotide Archive under accession numbers ERS2068140, ERS2068141, ERS2068142 and ERS2068143 in study number PRJEB24126 (http://www.ebi.ac.uk/ena/data/view/PRJEB24126).


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES