Skip to main content
NCBI home page
American Journal of Translational Research logoLink to American Journal of Translational Research
. 2019 Jan 15;11(1):499–508.

Postconditioning with inhaled hydrogen attenuates skin ischemia/reperfusion injury through the RIP-MLKL-PGAM5/Drp1 necrotic pathway

Xin-Hang Dong 4,*, Hao Liu 1,*, Ming-Zi Zhang 1, Peng-Xiang Zhao 2, Shu Liu 3, Yan Hao 1, You-Bin Wang 1
PMCID: PMC6357323  PMID: 30788005

Abstract

This study explored the flap-protective effects of high concentrations of hydrogen (HCH) inhalation in a rat flap ischemia/reperfusion (I/R) injury model and the potential mechanism of necroptosis. Forty-five male Sprague-Dawley rats were randomly divided into three groups: SH, IR and HCH groups. After undergoing 3 h of I/R management, the surgery groups were treated with ambient air (SH and IR) and high concentrations of hydrogen (HCH). On the third postoperative day, blood perfusion in the flap was measured using Laser Doppler flowmeters. RIP1, RIP3, MLKL, PGAM5 and Drp1 were examined by immunological detection and RT-qPCR. Compared to the IR group, larger areas of the skin flaps from the SH and HCH groups survived and displayed more blood perfusion. RIP1, RIP3, MLKL, PGAM5 and Drp1 were expressed at high levels in the IR group, and their expression was significantly decreased in the HCH group. In the SH and HCH groups, the necrotic factors measured here showed similar expression levels, which were significantly lower than the levels in the IR group, indicating that HCH-mediated protective effects on rat skin I/R necrosis may be associated with the necrotic pathway.

Keywords: Skin flaps, ischemia/reperfusion, high concentrations of hydrogen, protective effects, necrotic pathway

Introduction

Surgical operations and various trauma often cause skin defects and deformities, and skin flap necrosis continues to be a significant problem in flap transplantation. Despite improvements in microsurgical techniques and equipment, flap loss remains the major operative complication. Ischemia/reperfusion (I/R) injury in the surgical skin flap is believed to be the pivotal factor that causes harmful changes within the tissue and vasculature, resulting in flap loss [1].

Various factors are involved in the process of I/R injury of the flap, including the activation of reactive oxygen free radicals, as well as the release of inflammatory factors and cell apoptosis. In recent years, necroptosis, an important alternative to cell death, has been increasingly mentioned as an important process in the cell life cycle. Necroptosis, which is distinct from apoptosis, autophagy, necroptosis and pyroptosis, is a special type of cellular necrosis that is regulated by a particular molecular mechanism and contributes to a range of human diseases, including I/R injury. Necroptosis plays a crucial role in heart [2], brain [3], liver [4] and kidney [5] I/R injury.

Caspase-inhibited cells may be stimulated to undergo necroptosis rather than apoptosis [6] through the initiation of the necrotic pathway. RIP (receptor-interacting protein) kinase is a member of the Ser/Thr protein kinase family and has been identified as a key enzyme that regulates necroptosis [7], particularly RIP1 and 3. The interaction of RIP1 and 3 is required for necroptosis [8]. MLKL was initially identified as an essential mediator of RIP1/RIP3 kinase-initiated necroptosis [9], and its N-terminal CC domain and phosphorylated kinase region play crucial roles in modulating downstream necrotic effectors [10]. PGAM5, a mitochondrial phosphoglycerate mutase, is anchored in the outer mitochondrial membrane [11] and plays a vital role in the transmission of necrotic signals to mitochondria. Upon induction, PGAM5 recruits the mitochondrial fission factor Drp1 and induces its GTPase activity through dephosphorylation. Mitochondrial fission follows Drp1 activation, which is an early and obligatory step for the execution of the necroptosis pathway [12-15].

The protective effect of inhaled hydrogen was initially reported to significantly attenuate cerebral I/R injury by inhibiting oxidative stress. Based on accumulating evidence, hydrogen protects against I/R injury in the liver [16,17], heart [18,19], lung [20], skin [21], retina [22] and intestine [23]. Previous studies of the protective effects of hydrogen on I/R injury in flaps have mainly focused on the scavenging of hydroxyl radicals, suppression of inflammation and inhibition of apoptosis; however, researchers have not determined whether necroptosis is involved. Recently, high concentrations of hydrogen (HCH, 66.7% hydrogen and 33.3% oxygen) have been applied to many diseases in animal models [17,22,24]. HCH is produced by an AMS-H-01 hydrogen oxygen nebulizer (Asclepius, Shanghai, China), which generates H2 and O2 by electrolyzing water. The present study aims to evaluate the inhibitory effect of hydrogen on necroptosis and its ability to regulate the expression of RIP1, RIP3, MLKL, PGAM5 and Drp1 in a rat skin flap I/R injury model following inhalation of HCH.

Materials and methods

Animals and grouping

Forty-five male Sprague-Dawley rats aged 6-8 weeks and weighing 280-320 g were housed in comfortable cages at 22-25°C with adequate food and water. All procedures were strictly performed according to the National Institutes of Health Guide for the Care and Use of Laboratory Animals. This study was performed in accordance with the Experimentation Ethics Committee on Animal Rights Protection of Peking Union Medical College Hospital. Before surgery, rats were randomly divided into three groups: SH: sham surgery group treated with ambient air (n=15), IR: 3-h I/R group treated with ambient air (n=15), and HCH: 3-h I/R group treated with HCH (n=15).

HCH management

Immediately after I/R, animals in the HCH group were placed in a comfortable 40×26×17 cm chamber equipped with a round inlet and an outlet and flushed with HCH (66.7% hydrogen and 33.3% oxygen), which was produced with the AMS-H-01 hydrogen producer (Asclepius, Shanghai, China). The AMS-H-01 hydrogen producer replaced the air inside the chamber for 5 minutes after the rat was placed in it. The HCH treatment lasted for 60 min at normal pressure.

Surgical procedure

This surgical procedure was based on the method reported by Küntscher [25], with some modifications [21,26]. Rats were intraperitoneally anesthetized with 10%, 1 ml/300 g chloral hydrate. A 6 cm×9 cm rectangular flap area on the abdomen was marked and well sterilized. In the IR and HCH groups, the right superficial epigastric artery of rats was clamped with a microvascular clamp for three hours, whereas the left superficial epigastric artery was ligated. The SH group was not subjected to ischemia, but the left superficial epigastric artery remained ligated. A 0.1-mm-thick silicone sheet was then placed between the flap and the recipient bed to prevent revascularization. Reperfusion was initiated by removing the clamp and was confirmed by the return of pulsation to the vascular arcade.

Evaluation of skin flap perfusion

Seventy-two hours after reperfusion, a laser Doppler flowmeter (LDF, Perimed AB, Stockholm, Sweden) and laser speckle contrast analysis (LSCA, Perimed AB, Stockholm, Sweden) were used to measure flap perfusion after the procedures described above. All rats were anesthetized and then fastened to the operating table to expose the entire flap. Then, capillary blood flow in the dermal layer of the rats was measured using the LDF. Perfusion in the necrotic (black areas) and surviving (red, yellow and the adjacent blue areas) areas of the abdominal flap were automatically obtained by delineating the specific area in the image using the LSCA. Vascular flow was measured as perfusion units (PUs) (ml·100 g-1·min-1).

Seventy-two hours after reperfusion, rats were sacrificed by the administration of a high-dose anesthesia, and one piece of the flap tissue (1×1 cm2 in size) was removed from the proximal area of the vascular axis of the flap for hematoxylin and eosin staining, immunohistochemical studies, western blot analysis, and RNA extraction.

Hematoxylin and eosin (H&E) staining

The specimen was embedded in paraffin, sectioned, and mounted on a slide. Then, slides were stained with H&E for histological examinations.

Immunohistochemical studies

Paraffin-embedded sections were routinely dewaxed, rehydrated and then incubated with 3% H2O2 for 10 min to block endogenous catalase activity. Antigen retrieval was performed by heating the unstained slides in citrate buffer at 95°C for 15 min. An incubation with normal goat serum at 37°C for 30 min blocked nonspecific staining. Sections were placed in a humidified chamber and incubated with anti-RIP1 (1:200, Abcam, Cambridge, UK), anti-RIP3 (1:500, Abcam, Cambridge, UK), anti-MLKL (1:200, Abcam, Cambridge, UK), anti-PGAM5 (1:200, Abcam, Cambridge, UK), or anti-Drp1 (1:100, Abcam, Cambridge, UK) antibodies for 2 h at 37°C. Horseradish peroxidase-conjugated secondary antibodies (ZSGB-BIO, Beijing, China) were used to label the primary antibodies. Then, samples were washed with PBS, stained with DAB, and counterstained with hematoxylin. A brown color implied the presence of an antibody bound to antigen and was detected by light microscopy using a computer-controlled digital camera and imaging software.

Western blot analysis

Western blotting was used to examine the levels of the RIP1, RIP3, MLKL, PGAM5 and Drp1 proteins 72 h after reperfusion. The tissue was rapidly weighed on ice and then proteins were extracted with a cell lysis kit (Bio-Rad Laboratories, Hercules, CA). Samples were homogenized on ice for 10 min in lysis buffer (246 μL of lysis buffer, 1.25 μL of phosphatase inhibitors, 0.25 μL of protease inhibitors, and 2.5 μL of PMSF) and then centrifuged at 14,000 rpm for 15 min. For western blotting, equal amounts of protein supernatants (60 μg) were separated on 10% SDS-PAGE gels and transferred to nitrocellulose membranes for immunoblotting. The membrane was blocked with blocking buffer (LI-COR, Lincoln, NE) for 2 h at room temperature and then incubated with either anti-RIP1, anti-RIP3, anti-MLKL, anti-PGAM5 or anti-Drp1 (1:500, Abcam, Cambridge, UK) antibodies for 12 hours at 4°C. Membranes were then incubated with a 1:10,000 dilution of secondary antibodies (LI-COR, Lincoln, NE) for 1 h at room temperature in the dark and then detected with a double-color infrared laser imaging system (Odyssey, Li-cor, Lincoln, NE).

RNA isolation and RT-qPCR

Total RNA was extracted using the RNeasy Fibrous Tissue Mini Kit (Qiagen, Düsseldorf, Germany), according to the manufacturer’s instructions. The concentration of the extracted RNA was determined using a UV spectrophotometer (Thermo, Waltham, MA, USA) and the integrity of the RNA was visualized by electrophoresis on 1% agarose gels. Reverse transcription of 1 μg total RNA was performed to synthesize cDNAs using the ProtoScript M-MuLV First Strand cDNA Synthesis Kit (New England Biolabs, lpswich, MA, USA) and an anchored oligo d(T) primer [d(T)23VN]. PCR was performed using a Real-Time qPCR System (Agilent, Santa Clara, CA, USA). Sequences of the specific primer sets for RIP1, RIP3, MLKL, PGAM5, Drp1 and β-actin used in this study are presented in Table 1. The expression of target genes was normalized to the levels of the β-actin gene as an internal housekeeping control. Real-time PCR cycle parameters included UDG pretreatment at 50°C for 2 min, initial denaturation at 95°C for 10 min followed by 40 cycles of denaturation at 95°C for 15 s, annealing at the Tm for 1 min and extension at 72°C for 30 s.

Table 1.

Sequences of primers used for quantitative real-time PCR

Target gene ID Forward Reverse
RIP1 306886 CCAGCCAGCCAAATCAAAGT TGGCTTACACTTGGCCCATA
RIP3 246240 CGTGGAGCAGTGTGTAACAG GGCTCAGAACTCCAGCAATG
MLKL 690743 TAGTCCTGAGGGCAGCTAGA CTGCTGATGTTTCCGTGGAG
PGAM5 288731 AGGCTGGACCACTATAAGGC TCCTTCTCCATCGAGCCATC
Drp1 114114 TGATGCCTGTGGGCTAATGA GTTCCTGACCACCATCTCCA
Open in a new tab

Statistical analysis

In this study, all data are reported as means ± standard deviation. Significant differences were determined using one-way analysis of variance (ANOVA) followed by the LSD-t test. Statistical significance was set to P < 0.05. All analyses were conducted using SPSS 24.0 software.

Results

Flap survival rate

Necrotic flap tissues were inelastic and brown, gray, or black in color on the third postoperative day. In contrast, the surviving tissues were pink and elastic (Figure 1A). Results of the statistical analysis are shown in Figure 1B. In the SH group, the flap survival rate was 90.874 ± 4.520%, which was the highest rate among the three groups. Compared with the IR group (17.580 ± 3.442%), the flap survival rates of the SH and the HCH groups (55.151 ± 4.014%) were significantly increased (IR vs. SH, P < 0.001; IR vs. HCH, P < 0.001; Figure 1B).

Figure 1.

Figure 1

Open in a new tab

The condition of the abdominal skin flaps 72 h after I/R injury. The black zones represent the areas with the lowest blood perfusion. The red, yellow and adjacent blue areas represent surviving areas with rich blood perfusion. A. Representative photographs of abdominal skin flap microcirculation in the three groups are shown. B. The survival rate of the total flap area. Markedly higher flap survival rates were observed in the SH and HCH groups. C. The average blood perfusion of total skin flaps. A greater average blood perfusion value for the total flap was observed in the HCH group than in the IR group. Values are presented as means ± SD (n=15 animals per group; ***P < 0.001 compared with the SH group; comparison of the HCH and IR groups, ###P < 0.001).

Flap perfusion

On the third day after surgery, the average blood perfusion in the SH group was 186.512 ± 29.340 PU (mL·100 g-1·min-1). The average blood perfusion was 57.040 ± 8.931 PU in the IR group and 108.451 ± 15.348 PU in the HCH group. Significant differences were observed between the IR and SH groups (P < 0.001) and between the IR and HCH groups (P < 0.001; Figure 1C).

H&E staining

H&E staining was used to assess ischemic injury (Figure 2) by evaluating inflammatory infiltration. Inflammatory infiltration was observed in all the three groups, but the number of inflammatory cells was greatest in the IR group skin tissue, which indicated that HCH may attenuate the inflammatory response.

Figure 2.

Figure 2

Open in a new tab

Images of H&E staining 72 h after IR injury. Observations (400×) of the morphology of the flap tissue in all groups using H&E staining. Fewer infiltrating cells (red arrow) were observed in the SH and HCH groups than in the IR group.

Expression of the RIP1, RIP3, MLKL, PGAM5 and Drp1 proteins after IR injury

Immunological detection studies reflect the expression of target proteins, such as RIP1, RIP3, MLKL, PGAM5 and Drp1, which have been shown to be key proteins involved in necroptosis. The RIP1, RIP3, MLKL, PGAM5 and Drp1 proteins were expressed at higher levels in the IR group than in the SH and HCH groups, as visualized by western blotting (Figure 4; Table 3). Immunohistochemical staining (Figure 3) showed similar results to the western blot assay. Table 2 shows the percentage of positively stained cells as analyzed via immunofluorescence. There is a significant difference for RIP1, RIP3, MLKL, PGAM5 and Drp1 between the HCH and IR groups (P < 0.001).

Figure 4.

Figure 4

Open in a new tab

Levels of the RIP1, RIP3, MLKL, PGAM5 and Drp1 proteins. A. Representative images of western blots for RIP1, RIP3, MLKL, PGAM5 and Drp1 are shown. B. Densitometry analysis of levels of the RIP1, RIP3, MLKL, PGAM5 and Drp1 proteins; the results are consistent with the immunohistochemical staining. Values are presented as the means ± SD (***P < 0.001 and *P < 0.05 compared with the SH group, ###P < 0.001). Levels of the RIP1, RIP3, MLKL, PGAM5 and Drp1 mRNAs in skin flap samples were analyzed. C. Compared to the IR group, levels of the RIP1, RIP3, MLKL, PGAM5 and Drp1 mRNAs were reduced in the HCH group.

Table 3.

Protein relative levels in all groups

Factor Protein relative level P value
SH IR HCH
RIP1 0.1553 ± 0.0116 0.7625 ± 0.0137 0.2835 ± 0.0129 HCH vs. IR, P < 0.001
RIP3 0.5828 ± 0.0358 0.9230 ± 0.0102 0.5403 ± 0.0142 HCH vs. IR, P < 0.001
MLKL 0.1528 ± 0.0180 0.3375 ± 0.0236 0.1873 ± 0.0099 HCH vs. IR, P < 0.001
PGAM5 0.1710 ± 0.0110 0.6365 ± 0.0591 0.1833 ± 0.0240 HCH vs. IR, P < 0.001
Drp1 0.2005 ± 0.0181 0.5465 ± 0.0258 0.1560 ± 0.0250 HCH vs. IR, P < 0.001
Open in a new tab

Values are presented as the means ± SD.

Figure 3.

Figure 3

Open in a new tab

Representative micrographs (400×) of immunohistochemical staining for RIP1, RIP3, MLKL, PGAM5 and Drp1 in the skin tissues from all groups are presented above. Brown staining indicates areas with positive expression, and the shade of the color represents the expression level of the target protein. Lower levels of RIP1, RIP3, MLKL, PGAM5 and Drp1 were detected in the skin tissues from rats in the HCH group than rats in the IR group.

Table 2.

Percentage of positive cells in immunofluorescence staining analysis

Factor Percentage of positive cells (%) P value
SH IR HCH
RIP1 0.2561 ± 0.0219 0.8589 ± 0.0257 0.3716 ± 0.0097 HCH vs. IR, P < 0.001
RIP3 0.4221 ± 0.0206 0.8932 ± 0.0127 0.6068 ± 0.0239 HCH vs. IR, P < 0.001
MLKL 0.1976 ± 0.0212 0.4521 ± 0.0213 0.2261 ± 0.0129 HCH vs. IR, P < 0.001
PGAM5 0.1533 ± 0.0166 0.5968 ± 0.0422 0.1957 ± 0.0193 HCH vs. IR, P < 0.001
Drp1 0.2114 ± 0.0156 0.6157 ± 0.0217 0.2989 ± 0.0279 HCH vs. IR, P < 0.001
Open in a new tab

Percentage of immunofluorescence staining positive cells in all groups. The highest percentages of RIP1, RIP3, MLKL, PGAM5, and Drp1 positive cells are shown in the IR group. Values are means ± SD.

Expression of the RIP1, RIP3, MLKL, PGAM5 and Drp1 mRNAs

Seventy-two hours after I/R, levels of the RIP1, RIP3, MLKL, PGAM5 and Drp1 mRNAs in HCH group were 0.7262 ± 0.0378, 0.5378 ± 0.0540, 0.7952 ± 0.1087, 0.7278 ± 0.1020 and 0.4703 ± 0.0747, respectively, compared with the IR group (Figure 4C).

Discussion

In this study, we investigated the protective effects of HCH on a rat model. After skin flap I/R injury, inhalation of hydrogen at a high concentration (66.7% H2) significantly improved the flap survival rate and inhibited the necroptosis of cells in the skin flap after I/R injury. In addition, the anti-necroptosis effect of HCH was at least partially associated with the decreased levels of RIP1, RIP3, MLKL, PGAM5 and Drp1, based on the results from immunohistochemical staining, western blot and RT-PCR analyses. Therefore, HCH shows promise as a novel anti-necroptosis agent for attenuating skin flap I/R injury.

Hydrogen is the smallest molecule, has a high diffusion speed and is non-toxic; it has also been reported to efficiently protect against I/R injury [17,21,27]. In addition, hydrogen can quickly reach relatively high concentrations due to its favorable distribution characteristics, enabling it to easily penetrate biomembranes. Moreover, excess hydrogen is eliminated from the body, leaving no side effects [28]. For security reasons, inhaled hydrogen was typically administered at a low concentration (≤ 4%) in previous studies [16,29]. The AMS-H-01 hydrogen producer, a new hydrogen generator that produces HCH (66.7% hydrogen and 33.3% oxygen) by electrolyzing water and has been verified in many experiments [22,27], was well applied in this experiment. Postconditioning with inhaled HCH attenuates I/R injury [22,27], consistent with the results our study; these findings are related to the anti-inflammatory, anti-oxidant, and anti-apoptosis effects of hydrogen. Both low and high concentrations of hydrogen have been confirmed to exert protective effects on I/R injury; however, researchers have not clearly determined whether necroptosis is involved in this process.

Regarding flap ischemia/reperfusion injury, previous studies on the role of hydrogen have mainly focused on of its ability to inhibit oxidative stress, inflammation and apoptosis, whereas necroptosis and the signal transduction pathway have rarely been examined in this field. Necroptosis is related to apoptosis [30-32]. Necroptosis is a form of regulated and programmed necrosis [9] characterized by cellular organelle swelling, a loss of integrity of the cell membrane, and leakage of cell contents. In recent years, considerable research has supported the importance of necroptosis in the development of inflammatory diseases and several forms of cancer [33-35]. The complicated mechanisms by which certain factors, including I/R injury, induce necroptosis have been illustrated in recent studies [10,12,30,31]. Upon the inhibition of caspase-8 activity, RIP3 and RIP1 interact through their respective homotypic interaction motif (RHIM) domains [36], which is located in the C-terminus of RIP1. RIP3 then undergoes auto-phosphorylation at the serine 227 site [10], an event that leads to the recruitment of a pseudokinase, MLKL [31], which interacts with RIP1/RIP3 to form a necrosome. The necrosome binds to PGAM5 and subsequently recruits and activates the mitochondrial splitting factor Drp1 [12], eventually leading to mitochondrial fragmentation and cell death.

RIP1 and 3 are two key proteins that activate necroptosis. After initiation, necroptosis requires a series of signal transmission events and the execution of death signals. RIP1 is viewed as a protein at the top of the pyramid during the process [37], and RIP3 acts as a molecular switch between TNF-induced apoptosis and necroptosis [38]. MLKL activation is mediated by receptor-interacting kinase-3 (RIPK3), a component of the necrosome. Activated MLKL forms membrane-disrupting pores that cause membrane leakage, thus extending the prototypical concept of morphological and biochemical events [9]. Mitochondria, which are interconnecting cellular organelles that undergo dynamic changes, represent the key organelle in which HCH exerts its protective effect on reducing ischemia/reperfusion injury. The mitochondria are not only a responder but also may be the trigger of many signal transduction pathways, including cell necroptosis [12,21]. Therefore, the translocation of the necrosome to mitochondria-associated membranes is essential for necroptosis signal transduction. Two isoforms of PGAM5 are located downstream of the necrosome and specifically associate with the necrosome after induction of necroptosis, resulting in PGAM5 phosphorylation and activation [12]. The recruitment of PGAM5 and Drp1 cause mitochondrial fission. Once bound to mitochondria, Drp1 assembles into spirals at division sites around the outer mitochondrial membrane and contributes to the process of mitochondrial fission [39]. As shown in our previous study, Necrostatin-1, a specific inhibitor of necroptosis [3], exerts a protective effect on I/R injury by inhibiting RIP1 in the skin island flap model [40].

Based on the abovementioned theories, our study focused on the application of HCH and revealed its distinctive effect on protecting a rat skin flap from I/R injury by inhibiting necroptosis. Based on our results, the administration of a high hydrogen concentration protected against flap ischemia/reperfusion injury, characterized by reductions in the ischemic area and the alleviation of cell necroptosis. In the presence of HCH postconditioning, the ischemic area was significantly increased, and the expression of the abovementioned factors RIP1, RIP3, MLKL, PGAM5 and Drp1 was significantly decreased, compared with IR group, suggesting that the protective effects of HCH are associated with the activation of the necroptosis signal transduction pathway. In the present study, a new theory was established to explain the mechanism by which HCH treated skin flap ischemia/reperfusion injury. This theory provides a new perspective on methods for alleviating ischemia/reperfusion injury during skin flap transplantation and the development of new treatment strategies. Regarding the limitations of our study, the detailed molecular mechanisms of the flap-protective effects of HCH on necroptosis have not been fully disclosed in this experiment, and we will explore the detailed mechanism in future studies.

Conclusions

In the present study, HCH suppressed skin ischemia/reperfusion injury and increased the skin flap survival rate by attenuating cell necroptosis. Furthermore, we provided novel evidence that the anti-necroptosis effect of hydrogen may be associated with regulatory effects on RIP1, RIP3, MLKL, PGAM5 and Drp1 expression. These results may be helpful for elaborating the therapeutic mechanism of hydrogen.

Acknowledgements

This project was supported by a grant from the National Natural Science Foundation of China (No. 81471885).

Disclosure of conflict of interest

None.

References

  • 1.Harder Y, Amon M, Laschke MW, Schramm R, Rucker M, Wettstein R, Bastiaanse J, Frick A, Machens HG, Kuntscher M, Germann G, Vollmar B, Erni D, Menger MD. An old dream revitalised: preconditioning strategies to protect surgical flaps from critical ischaemia and ischaemia-reperfusion injury. J Plast Reconstr Aesthet Surg. 2008;61:503–511. doi: 10.1016/j.bjps.2007.11.032. [DOI] [PubMed] [Google Scholar]
  • 2.Lim SY, Davidson SM, Mocanu MM, Yellon DM, Smith CC. The cardioprotective effect of necrostatin requires the cyclophilin-D component of the mitochondrial permeability transition pore. Cardiovasc Drugs Ther. 2007;21:467–469. doi: 10.1007/s10557-007-6067-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Degterev A, Huang Z, Boyce M, Li Y, Jagtap P, Mizushima N, Cuny GD, Mitchison TJ, Moskowitz MA, Yuan J. Chemical inhibitor of nonapoptotic cell death with therapeutic potential for ischemic brain injury. Nat Chem Biol. 2005;1:112–119. doi: 10.1038/nchembio711. [DOI] [PubMed] [Google Scholar]
  • 4.Shuh M, Bohorquez H, Loss GE Jr, Cohen AJ. Tumor necrosis factor-alpha: life and death of hepatocytes during liver ischemia/reperfusion injury. Ochsner J. 2013;13:119–130. [PMC free article] [PubMed] [Google Scholar]
  • 5.Linkermann A, Brasen JH, Himmerkus N, Liu S, Huber TB, Kunzendorf U, Krautwald S. Rip1 (receptor-interacting protein kinase 1) mediates necroptosis and contributes to renal ischemia/reperfusion injury. Kidney Int. 2012;81:751–761. doi: 10.1038/ki.2011.450. [DOI] [PubMed] [Google Scholar]
  • 6.Kaiser WJ, Upton JW, Long AB, Livingston-Rosanoff D, Daley-Bauer LP, Hakem R, Caspary T, Mocarski ES. RIP3 mediates the embryonic lethality of caspase-8-deficient mice. Nature. 2011;471:368–372. doi: 10.1038/nature09857. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Shindo R, Kakehashi H, Okumura K, Kumagai Y, Nakano H. Critical contribution of oxidative stress to TNFalpha-induced necroptosis downstream of RIPK1 activation. Biochem Biophys Res Commun. 2013;436:212–216. doi: 10.1016/j.bbrc.2013.05.075. [DOI] [PubMed] [Google Scholar]
  • 8.Dillon CP, Oberst A, Weinlich R, Janke LJ, Kang TB, Ben-Moshe T, Mak TW, Wallach D, Green DR. Survival function of the FADD-CASPASE-8-cFLIP(L) complex. Cell Rep. 2012;1:401–407. doi: 10.1016/j.celrep.2012.03.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Zhang J, Yang Y, He W, Sun L. Necrosome core machinery: MLKL. Cell Mol Life Sci. 2016;73:2153–2163. doi: 10.1007/s00018-016-2190-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Sun L, Wang H, Wang Z, He S, Chen S, Liao D, Wang L, Yan J, Liu W, Lei X, Wang X. Mixed lineage kinase domain-like protein mediates necrosis signaling downstream of RIP3 kinase. Cell. 2012;148:213–227. doi: 10.1016/j.cell.2011.11.031. [DOI] [PubMed] [Google Scholar]
  • 11.Takeda K, Komuro Y, Hayakawa T, Oguchi H, Ishida Y, Murakami S, Noguchi T, Kinoshita H, Sekine Y, Iemura S, Natsume T, Ichijo H. Mitochondrial phosphoglycerate mutase 5 uses alternate catalytic activity as a protein serine/threonine phosphatase to activate ASK1. Proc Natl Acad Sci U S A. 2009;106:12301–12305. doi: 10.1073/pnas.0901823106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Wang Z, Jiang H, Chen S, Du F, Wang X. The mitochondrial phosphatase PGAM5 functions at the convergence point of multiple necrotic death pathways. Cell. 2012;148:228–243. doi: 10.1016/j.cell.2011.11.030. [DOI] [PubMed] [Google Scholar]
  • 13.Han XJ, Lu YF, Li SA, Kaitsuka T, Sato Y, Tomizawa K, Nairn AC, Takei K, Matsui H, Matsushita M. CaM kinase I alpha-induced phosphorylation of Drp1 regulates mitochondrial morphology. J Cell Biol. 2008;182:573–585. doi: 10.1083/jcb.200802164. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Ding M, Dong Q, Liu Z, Liu Z, Qu Y, Li X, Huo C, Jia X, Fu F, Wang X. Inhibition of dynamin-related protein 1 protects against myocardial ischemia-reperfusion injury in diabetic mice. Cardiovasc Diabetol. 2017;16:19. doi: 10.1186/s12933-017-0501-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Dong Y, Undyala VVR, Przyklenk K. Inhibition of mitochondrial fission as a molecular target for cardioprotection: critical importance of the timing of treatment. Basic Res Cardiol. 2016;111:59. doi: 10.1007/s00395-016-0578-x. [DOI] [PubMed] [Google Scholar]
  • 16.Fukuda K, Asoh S, Ishikawa M, Yamamoto Y, Ohsawa I, Ohta S. Inhalation of hydrogen gas suppresses hepatic injury caused by ischemia/reperfusion through reducing oxidative stress. Biochem Biophys Res Commun. 2007;361:670–674. doi: 10.1016/j.bbrc.2007.07.088. [DOI] [PubMed] [Google Scholar]
  • 17.Li H, Chen O, Ye Z, Zhang R, Hu H, Zhang N, Huang J, Liu W, Sun X. Inhalation of high concentrations of hydrogen ameliorates liver ischemia/reperfusion injury through A2A receptor mediated PI3K-Akt pathway. Biochem Pharmacol. 2017;130:83–92. doi: 10.1016/j.bcp.2017.02.003. [DOI] [PubMed] [Google Scholar]
  • 18.Sun Q, Kang Z, Cai J, Liu W, Liu Y, Zhang JH, Denoble PJ, Tao H, Sun X. Hydrogen-rich saline protects myocardium against ischemia/reperfusion injury in rats. Exp Biol Med (Maywood) 2009;234:1212–1219. doi: 10.3181/0812-RM-349. [DOI] [PubMed] [Google Scholar]
  • 19.Zalesak M, Kura B, Graban J, Farkasova V, Slezak J, Ravingerova T. Molecular hydrogen potentiates beneficial anti-infarct effect of hypoxic postconditioning in isolated rat hearts: a novel cardioprotective intervention. Can J Physiol Pharmacol. 2017;95:888–893. doi: 10.1139/cjpp-2016-0693. [DOI] [PubMed] [Google Scholar]
  • 20.Shi J, Yao F, Zhong C, Pan X, Yang Y, Lin Q. Hydrogen saline is protective for acute lung ischaemia/reperfusion injuries in rats. Heart Lung Circ. 2012;21:556–563. doi: 10.1016/j.hlc.2012.05.782. [DOI] [PubMed] [Google Scholar]
  • 21.Liu YQ, Liu YF, Ma XM, Xiao YD, Wang YB, Zhang MZ, Cheng AX, Wang TT, Li JL, Zhao PX, Xie F, Zhang X. Hydrogen-rich saline attenuates skin ischemia/reperfusion induced apoptosis via regulating Bax/Bcl-2 ratio and ASK-1/JNK pathway. J Plast Reconstr Aesthet Surg. 2015;68:e147–156. doi: 10.1016/j.bjps.2015.03.001. [DOI] [PubMed] [Google Scholar]
  • 22.Wang R, Wu J, Chen Z, Xia F, Sun Q, Liu L. Postconditioning with inhaled hydrogen promotes survival of retinal ganglion cells in a rat model of retinal ischemia/reperfusion injury. Brain Res. 2016;1632:82–90. doi: 10.1016/j.brainres.2015.12.015. [DOI] [PubMed] [Google Scholar]
  • 23.Wu MJ, Chen M, Sang S, Hou LL, Tian ML, Li K, Lv FQ. Protective effects of hydrogen rich water on the intestinal ischemia/reperfusion injury due to intestinal intussusception in a rat model. Med Gas Res. 2017;7:101–106. doi: 10.4103/2045-9912.208515. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Peng Z, Chen W, Wang L, Ye Z, Gao S, Sun X, Guo Z. Inhalation of hydrogen gas ameliorates glyoxylate-induced calcium oxalate deposition and renal oxidative stress in mice. Int J Clin Exp Pathol. 2015;8:2680–2689. [PMC free article] [PubMed] [Google Scholar]
  • 25.Kuntscher MV, Schirmbeck EU, Menke H, Klar E, Gebhard MM, Germann G. Ischemic preconditioning by brief extremity ischemia before flap ischemia in a rat model. Plast Reconstr Surg. 2002;109:2398–2404. doi: 10.1097/00006534-200206000-00034. [DOI] [PubMed] [Google Scholar]
  • 26.Karaaslan O, Ulusoy MG, Kankaya Y, Tiftikcioglu YO, Kocer U, Kankaya D, Karaaslan GM, Tuncer S, Berktas M. Protective effect of grape seed extract against ischaemia/reperfusion injury in a rat epigastricflap model. J Plast Reconstr Aesthet Surg. 2010;63:705–710. doi: 10.1016/j.bjps.2009.01.018. [DOI] [PubMed] [Google Scholar]
  • 27.Chen O, Cao Z, Li H, Ye Z, Zhang R, Zhang N, Huang J, Zhang T, Wang L, Han L, Liu W, Sun X. High-concentration hydrogen protects mouse heart against ischemia/reperfusion injury through activation of the PI3K/Akt1 pathway. Sci Rep. 2017;7:14871. doi: 10.1038/s41598-017-14072-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Chen H, Sun YP, Hu PF, Liu WW, Xiang HG, Li Y, Yan RL, Su N, Ruan CP, Sun XJ, Wang Q. The effects of hydrogen-rich saline on the contractile and structural changes of intestine induced by ischemia-reperfusion in rats. J Surg Res. 2011;167:316–322. doi: 10.1016/j.jss.2009.07.045. [DOI] [PubMed] [Google Scholar]
  • 29.Ohsawa I, Ishikawa M, Takahashi K, Watanabe M, Nishimaki K, Yamagata K, Katsura K, Katayama Y, Asoh S, Ohta S. Hydrogen acts as a therapeutic antioxidant by selectively reducing cytotoxic oxygen radicals. Nat Med. 2007;13:688–694. doi: 10.1038/nm1577. [DOI] [PubMed] [Google Scholar]
  • 30.Han J, Zhong CQ, Zhang DW. Programmed necrosis: backup to and competitor with apoptosis in the immune system. Nat Immunol. 2011;12:1143–1149. doi: 10.1038/ni.2159. [DOI] [PubMed] [Google Scholar]
  • 31.Sun L, Wang X. A new kind of cell suicide: mechanisms and functions of programmed necrosis. Trends Biochem Sci. 2014;39:587–593. doi: 10.1016/j.tibs.2014.10.003. [DOI] [PubMed] [Google Scholar]
  • 32.Lalaoui N, Lindqvist LM, Sandow JJ, Ekert PG. The molecular relationships between apoptosis, autophagy and necroptosis. Semin Cell Dev Biol. 2015;39:63–69. doi: 10.1016/j.semcdb.2015.02.003. [DOI] [PubMed] [Google Scholar]
  • 33.He S, Wang L, Miao L, Wang T, Du F, Zhao L, Wang X. Receptor interacting protein kinase-3 determines cellular necrotic response to TNF-alpha. Cell. 2009;137:1100–1111. doi: 10.1016/j.cell.2009.05.021. [DOI] [PubMed] [Google Scholar]
  • 34.Bonnet M, Preukschat D, Welz P, van Loo G, Ermolaeva M, Bloch W, Haase I, Pasparakis M. The adaptor protein FADD protects epidermal keratinocytes from necroptosis in vivo and prevents skin inflammation. Immunity. 2011;35:572–582. doi: 10.1016/j.immuni.2011.08.014. [DOI] [PubMed] [Google Scholar]
  • 35.Zhang Q, Niu Q, Niu P, Ji X, Zhang C, Wang L. Novel interventions targeting on apoptosis and necrosis induced by aluminum chloride in neuroblastoma cells. J Biol Regul Homeost Agents. 2010;24:137–148. [PubMed] [Google Scholar]
  • 36.Li J, McQuade T, Siemer AB, Napetschnig J, Moriwaki K, Hsiao YS, Damko E, Moquin D, Walz T, McDermott A, Chan FK, Wu H. The RIP1/RIP3 necrosome forms a functional amyloid signaling complex required for programmed necrosis. Cell. 2012;150:339–350. doi: 10.1016/j.cell.2012.06.019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Holler N, Zaru R, Micheau O, Thome M, Attinger A, Valitutti S, Bodmer JL, Schneider P, Seed B, Tschopp J. Fas triggers an alternative, caspase-8-independent cell death pathway using the kinase RIP as effector molecule. Nat Immunol. 2000;1:489–495. doi: 10.1038/82732. [DOI] [PubMed] [Google Scholar]
  • 38.McQuade T, Cho Y, Chan FK. Positive and negative phosphorylation regulates RIP1- and RIP3-induced programmed necrosis. Biochem J. 2013;456:409–415. doi: 10.1042/BJ20130860. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Smirnova E, Griparic L, Shurland DL, van der Bliek AM. Dynamin-related protein Drp1 is required for mitochondrial division in mammalian cells. Mol Biol Cell. 2001;12:2245–2256. doi: 10.1091/mbc.12.8.2245. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Zhu L, Zhang M, Liu Y, Wang Y, Ma X. Necrostatin-1 protects against ischemia/reperfusion injury by inhibition of RIP-1 (Receptor-Interacting Protein 1) in a rat flap model. Plast Reconstr Surg. 2015;136:33. [Google Scholar]

Articles from American Journal of Translational Research are provided here courtesy of e-Century Publishing Corporation

RESOURCES