Significance
Reef-building corals cannot survive without symbiotic algae, Symbiodinium, on which they depend for most of their energy. Most coral species gain symbionts from the environment early in life, and possibly after bleaching (i.e., the loss of symbionts in response to stress). However, Symbiodinium density on coral reefs is very low. Although it has long been hypothesized that corals must be able to attract free-living Symbiodinium, such a mechanism has yet to be identified. Here, we use a series of experiments to demonstrate that corals attract Symbiodinium using their endogenous GFP-related green fluorescence, revealing a biological signaling mechanism that underlies the success of this symbioses that is the building block of coral reef ecosystems.
Keywords: phototaxis, GFP, symbiosis, fluorescence, coral
Abstract
Reef-building corals thrive in nutrient-poor marine environments because of an obligate symbiosis with photosynthetic dinoflagellates of the genus Symbiodinium. Symbiosis is established in most corals through the uptake of Symbiodinium from the environment. Corals are sessile for most of their life history, whereas free-living Symbiodinium are motile; hence, a mechanism to attract Symbiodinium would greatly increase the probability of encounter between host and symbiont. Here, we examined whether corals can attract free-living motile Symbiodinium by their green fluorescence, emitted by the excitation of endogenous GFP by purple-blue light. We found that Symbiodinium have positive and negative phototaxis toward weak green and strong purple-blue light, respectively. Under light conditions that cause corals to emit green fluorescence, (e.g., strong blue light), Symbiodinium were attracted toward live coral fragments. Symbiodinium were also attracted toward an artificial green fluorescence dye with similar excitation and emission spectra to coral-GFP. In the field, more Symbiodinium were found in traps painted with a green fluorescence dye than in controls. Our results revealed a biological signaling mechanism between the coral host and its potential symbionts.
Reef-building corals form an obligate symbiotic relationship with dinoflagellates of the genus Symbiodinium. Some coral species acquire Symbiodinium via transmission from the parent to the oocyte. However, >70% of coral species acquire Symbiodinium from the environment after the propagules are released (1), and both larvae (2) and juveniles (3) have been shown to acquire symbionts in the field. Uptake of symbionts by adult corals is also thought to be possible, particularly after stress, such as bleaching (4, 5).
Free-living Symbiodinium can change morphology rapidly, transforming from a flagellated motile cell during the day to a spherical nonmotile form at night (6). In contrast, Symbiodinium within the host’s cells are always nonmotile. In general, motility in free-living Symbiodinium peaks a few hours after exposure to light (6, 7). Given that corals are sessile for most of their life-history, with the exception of a comparatively brief larval stage, the coral hosts must rely on free-living Symbiodinium to come to them. Symbiodinium densities are very low on coral reefs (8–10), and therefore some mechanism of attraction would be of great benefit to the host. One hypothesis for the acquisition of Symbiodinium is via chemo-attraction by the host (11, 12). An alternative hypothesis, whereby symbionts are attracted to green fluorescence from endogenous GFPs in the host (13), has yet to be tested.
Many coral species are bright green on exposure to the UV/blue region of light. This green color is attributed to the fluorescence from endogenous GFP (14, 15). GFP was first isolated from the jellyfish Aequorea victoria (16), and its homolog genes are found in many cnidarians (15, 17), crustaceans (18), and chordates (19). The light absorption and fluorescence emission spectra differ among the homologs, of which there are four fluorescent (cyan, green, yellow, and red) and one nonfluorescent (purple-blue color) types (20, 21). The function of these fluorescent proteins has been the focus of much research. Fluorescence proteins have been proposed to change the light environment in the coral tissue, resulting in the enhancement of light suitable for photosynthesis by Symbiodinium (14) and protection of the photosynthetic machinery from damaging light wavelengths (22).
Previous research using white light dispersed by a prism at a single intensity demonstrated that Symbiodinium accumulated in the region of green light, leading to the hypothesis that free-living Symbiodinium swim toward green fluorescence emitted by corals (13). However, the emission of green fluorescence relies on light exposure (e.g., sunlight), and sunlight includes green light that might also attract free-living Symbiodinium. Thus, the hypothesis also assumes that Symbiodinium do not swim toward the light source. Indeed, it has yet to be proven that coral’s green fluorescence attracts Symbiodinium either in the field or under controlled laboratory conditions. Here, we perform a series of experiments to test whether coral’s green fluorescence can induce directional movement (i.e., phototaxis) in free-living motile Symbiodinium. Our results demonstrate that Symbiodinium have positive phototaxis mostly toward weak green light and negative phototaxis mostly toward strong purple-blue light, with the result that they swim toward corals, but not the light source, under conditions in which corals emit green fluorescence (e.g., strong blue-containing light).
Results
Characteristics of Symbiodinium Phototaxis.
Previous research has established that Symbiodinium have phototaxis, the level of which varies throughout the day and among Symbiodinium phylotypes (6). To expand on this previous work, we first studied phototaxis using cultured Symbiodinium OTcH-1 (clade A) grown in a light (12 h)–dark (12 h) cycle. Symbiodinium cells were harvested every 2 h from between 2 and 12 h after exposure to light and were placed in a plastic container for monitoring phototaxis (Fig. 1A). The container was exposed to light at eight different light intensities from 0.28 to 40 µmol m−2⋅s−1 from one side for 10 min. The culture was then equally partitioned into proximal (P) and distal (D) halves from the light source, and the phototaxis index was calculated as [(P − D)/(P + D)]. We used green light to measure the phototaxis index because previous work suggests that Symbiodinium have positive phototaxis toward green light (13). In our experimental conditions, phototaxis was seen in samples harvested after 2–8 h from the onset of light exposure, with the maximum levels occurring after 4 h (Fig. 1B). Phototaxis was always positive (i.e., Symbiodinium moved toward green light; peak at 525 nm). A similar maximum level of activity was evident under blue light (peak at 460 nm); however, low blue light caused positive phototaxis and high blue light caused negative phototaxis (SI Appendix, Fig. S1). Further experiments were therefore carried out using cells harvested between 2 and 5 h from the onset of light exposure.
Fig. 1.
Phototaxis in Symbiodinium. (A) An illustration of the experimental set-up used for evaluating the phototaxis index used in this study. The Symbiodinium OTcH-1 culture in the container was irradiated with light (open arrows) for 10 min, followed by equal partitioning of the container (dashed square) into moieties proximal and distal to the light. The cell densities of the proximal (P) and distal (D) moieties were then used to calculate a phototaxis index, using the equation described in the text. (B) The effect of time of day on phototaxis of Symbiodinium OTcH-1 toward a green LED. The Symbiodinium cells were harvested after the onset of light exposure, from 2 to 12 h, and were placed in a plastic container for monitoring phototaxis (n = 3 biological samples). (C) Contour map of the phototaxis action spectrum of Symbiodinium OTcH-1. The phototaxis index was determined from measurements taken under 18 different monochromatic light spectra at eight different light intensities (n = 3 biological samples).
To further understand the characteristics of Symbiodinium phototaxis, we tested the effect of the light spectrum (every 20 nm from 360 to 700 nm) on the phototaxis index, using the Okazaki large spectrograph that provides monochromatic light with a half-bandwidth of 10 nm. The phototaxis index was measured at eight different light intensities in each spectrum (Fig. 1C). Symbiodinium showed significant positive phototaxis toward purple (peak at 400 nm), blue (peak at 440 nm), green (peak at 510 nm), and red (peak at 680 nm) weak light, with the highest activity toward green light. Furthermore, Symbiodinium showed significant negative phototaxis against purple-blue (375–475 nm) strong light. Our experiments clearly demonstrate that Symbiodinium phototaxis can be both positive and negative, and that the direction of movement is influenced by both wavelength and intensity.
Attraction of Motile Symbiodinium by Corals.
Next, we examined whether living corals can attract motile Symbiodinium, using the coral Echinophyllia aspera (green morph; Fig. 2A), which fluoresces bright green under blue light. The maximum excitation and emission peaks for the green fluorescence of this coral were at 492 and 505 nm, respectively (Fig. 2B), consistent with characteristics of GFP (20). We placed two coral fragments (length × width × height = 8 mm × 8 mm × 2 mm) in each container. One was taken from live coral (live), and the other from dead (i.e., skeleton only) as a control. We then counted Symbiodinium cell numbers around each fragment after 10 min of light exposure (Fig. 2C). In our experiment, the coral fragments were coated with resin plastic to eliminate the possibility of chemotaxis. In conditions in which corals emit green fluorescence (i.e., blue light), Symbiodinium cells were found in significantly higher abundance near the coral fragment (Fig. 2D and Movie S1), and the cell concentration was 10 times greater than the initial density (Fig. 2E). In contrast, there was no attraction to the coral skeleton or to the live coral in light conditions that do not cause green fluorescence (i.e., under green or red light or in darkness; Fig. 2E).
Fig. 2.
Attraction of Symbiodinium cells to a green fluorescent coral. (A) Top surface of the plate-like coral, E. aspera, used in this study. Photograph was taken under natural light conditions. (Scale bar, 1 cm.) (B) Fluorescence spectrum (blue, excitation; green, emission) of the coral body. (C) Schematic illustration of the fluorescence attraction assay. (D) Representative pictures of the Symbiodinium accumulation around the green fluorescent coral fragment (square 8 mm on a side; Lower), but not around the coral skeleton control (Upper) during the exposure to blue light (20 µmol photons · m−2⋅s−1) for 10 min. (E) Attraction of Symbiodinium cells around the coral fragments on exposure to different colors of light (20 µmol photons · m−2⋅s−1) for 10 min. The values are relative to cell density of the culture before irradiation (n = 3 biological samples; bars, ±SE).
Attraction of Motile Symbiodinium to a Green Fluorescent Dye.
To examine whether the attraction of Symbiodinium to coral fragments is directly associated with green fluorescence, we monitored the attraction of Symbiodinium using an artificial object (a 2-mm high, 8-mm diameter, dome-shaped resin plastic disk) painted with a green fluorescent dye (GFD), and a nonpainted white disk as a control. The fluorescence emission spectrum of the GFD showed a maximum peak at 504 nm (Fig. 3A), similar to the maximum peak of the coral’s GFP, at 505 nm (Fig. 2B). Under blue light, Symbiodinium cells gathered around the GFD-painted disk, but not around the nonpainted one (Fig. 3B and Movie S2). The accumulation of Symbiodinium around the disk did not happen in conditions in which GFD does not emit green fluorescence (i.e., under green or red or in darkness; Fig. 3C). These results demonstrated that GFD-associated green fluorescence attracts Symbiodinium, supporting our hypothesis that the accumulation of Symbiodinium around the coral fragment under blue light is related to GFP-associated green fluorescence. Symbiodinium also accumulated around the GFD under full-spectrum sunlight, but densities were much less than under blue light (Fig. 3C). Furthermore, Symbiodinium accumulation under full spectrum sunlight required much higher light intensity (60 µmol photons m−2⋅s−1) than under blue light (3 µmol photons m−2⋅s−1; Fig. 3C). The accumulation of Symbiodinium around the GFD-painted disk occurred under a wide range of fluorescence intensities, even when the GFD emitted only 25% of the Echinophyllia aspera fluorescence (Fig. 3D).
Fig. 3.
Attraction of Symbiodinium cells to an artificial green fluorescent object. (A) The fluorescence spectrum (blue, excitation; green, emission) of the GFD used. (B) Symbiodinium accumulation around the GFD-painted disk (8 mm in diameter; Lower), but not around the control disk (Upper), during the exposure to blue light (20 µmol photons m−2⋅s−1) for 10 min. (C) Attraction of Symbiodinium cells to the GFD-painted disk on exposure to different colors of light for 10 min. The values are relative to cell density of the culture before irradiation. *P < 0.05; **P < 0.01, Student’s t test. (D) Effect of the intensity of green fluorescence of the coral and GFD on attraction of Symbiodinium cells on the exposure to blue-light (20 µmol photons m−2⋅s−1) for 10 min. The arrow shows the GFD intensity used in experiments for Symbiodinium attraction (A–C). The value for the coral was the same as in Fig. 2E. (C and D) n = 5 biological samples for GFD-painted disk; n = 3 biological samples for the coral. Bars, ±SE.
Attraction of Symbiodinium to a GFD on the Reef.
On the basis of the results of the laboratory experiments, we next conducted field experiments to determine whether green fluorescence attracts Symbiodinium in natural light environments on the reef. We placed nine pairs of white traps, one painted with GFD and the other not painted (Fig. 4A), at depths of between 3 and 6 m on the fringing reef surrounding Sesoko Island, Okinawa, Japan, for 3 h (13:00–16:00). The seawater collected in the traps was then centrifuged, and the numbers of Symbiodinium cells were determined by real-time PCR analysis, using Symbiodinium-specific primers (23). The correlation between the cell number and the PCR signal (amount of DNA fragment amplified) was first tested using cultured Symbiodinium from clade C (SI Appendix, Fig. S2A), which is the most common Symbiodinium in corals around Okinawa (24). The Symbiodinium cell number was 2.5 times higher in the green fluorescent traps than in control traps (Fig. 4B), indicating that green fluorescence can cause accumulation of Symbiodinium on the reef.
Fig. 4.
Attraction of Symbiodinium cells to green fluorescent traps in coral reefs. (A) Seawater traps with and without green fluorescent dye. (B) Box-and-whisker plot for the density of Symbiodinium in the green fluorescent trap relative to that in the non-GDF painted (white) trap. The box, line, and square represent the quartiles, median, and average, respectively. Data were taken at nine sampling sites.
Discussion
The attraction of motile Symbiodinium by coral fragments only occurred under light conditions in which corals emit green fluorescence (i.e., blue light; Fig. 2). In our experiments, coral fragments were coated with plastic resin to eliminate the possibility of chemotaxis. Therefore, the attraction of Symbiodinium by coral fragments was not caused by signal molecules released by corals. To support this hypothesis, we showed that a green fluorescent disk also attracted motile Symbiodinium in light conditions in which the disk emitted green fluorescence (i.e., blue light and full-spectrum sunlight; Fig. 3). The attraction of Symbiodinium occurred over a wide range of fluorescence intensities, even as low as 25% of the fluorescence emitted by E. aspera, the coral used in this study (Fig. 3D). This result suggests that the attraction of Symbiodinium by green fluorescence can also occur in other host organisms that emit less green fluorescence than E. aspera. We therefore conclude that green fluorescence emitted by cnidarians can attract motile Symbiodinium. In the field, GFD-painted traps collected more Symbiodinium cells than the controls (Fig. 4B). This result suggests that the attraction of Symbiodinium by green fluorescence can also occur on the reef.
Free-living Symbiodinium potentially sense at least two different phototactic signals from opposite directions; one is the light signal from the sun, and the other is the fluorescent signal from benthic corals. Thus, the attraction of Symbiodinium to corals occurs only if the positive phototaxis toward the fluorescent signal is dominant. The fact that the extent of Symbiodinium attraction by the green-fluorescent dye increased as light intensity increased suggests that this would be the case (Fig. 3C). The attraction of Symbiodinium by fluorescent dye required 3 µmol photons m−2⋅s−1 under blue light (e.g., in deep water) and 60 µmol photons m−2⋅s−1 under sunlight (e.g., in shallow water; Fig. 3C). It is therefore likely that the light intensity required for the attraction of Symbiodinium by green fluorescence differs with light spectra and depth. Because blue light penetrates seawater to a depth of ∼50 m, the attraction of Symbiodinium by green fluorescence potentially occurs in both shallow and deep water.
Symbiodinium showed significant positive phototaxis toward weak purple (peak at 400 nm), blue (peak at 440 nm), green (peak at 510 nm), and red (peak at 680 nm) light, with the highest activity toward green light (Fig. 1C). Symbiodinium use chlorophyll a and c2, both of which have absorption peaks in the blue and red regions, and a unique carotenoid, peridinin, which has an absorption peak in the blue/green region (470–550 nm) (25), for photosynthesis (26). Thus, Symbiodinium showed positive phototaxis toward light wavelengths that match the absorption peaks of their photosynthetic antenna pigments, including chlorophylls and carotenoids. Furthermore, Symbiodinium showed negative phototaxis under purple/blue light (380–475 nm) at intensities greater than 3 µmol photons m−2⋅s−1. Purple/blue light is known to damage the photosynthetic machinery (i.e., photosystem II) in Symbiodinium (27). It is therefore likely that Symbiodinium evolved phototaxis to locate a light environment suitable for photosynthesis, as has been demonstrated in other algae (28), rather than for finding host cnidarians.
Phototaxis is initiated by the absorption of light by photoreceptors, leading to the transduction of the captured light signal to the flagella. Symbiodinium have an optical system, known as an eyespot. However, the photoreceptor for phototaxis is unknown. So far, two types of photoreceptors have been identified in algae: rhodopsin (an opsin protein in combination with the chromophore retinal) in Chlamydomonas reinhardtii (29) and photoactivated adenylate cyclase in Euglena gracilis (30). In Symbiodinium, there are no photoactivated adenylate cyclase genes, but eight opsin genes with conserved retinal binding sites occur in the genome (SI Appendix, Fig. S3) (31), and at least some are expressed (32). Thus, rhodopsin is the most likely candidate for the phototactic photoreceptor of green light, and possibly other wavelengths.
Symbiodinium showed strong positive phototaxis to green light (485–525 nm) over a wide range of light intensities (Fig. 1C). The green wavelength region includes wavelengths in which other fluorescence proteins (i.e., cyan fluorescent proteins) have emission peaks (485–495 nm) (19). It is therefore conceivable that the florescence form cyan fluorescent proteins also attract motile Symbiodinium. There was no significant positive phototaxis to light wavelengths in which yellow fluorescent proteins (emission maxima between 525–570 nm) and red fluorescent proteins (emission maxima between 576–595 nm) have emission peaks (20, 21), suggesting that they are not involved in attracting Symbiodinium, at least for the strain used in our study. Many marine organisms associated with Symbiodinium have GFP (19), suggesting that the attraction of Symbiodinium using GFP might be common. However, many nonsymbiotic marine organisms also have GFP. Because phototaxis is a common phenomenon in motile organisms (see review ref. 28), fluorescent marine organisms might use GFP or other fluorescence proteins to attract motile plankton for predation (33).
Reef-building corals are obligate symbionts: they do not survive unless symbiosis is established very early in life. Therefore, the recruitment of free-living Symbiodinium from the environment is crucial for the ∼70% of reef coral species that lack symbionts in the oocytes. Because infectivity is related to Symbiodinium density around the host (9, 10), the attraction of free-living Symbiodinium by green fluorescence helps corals recruit symbionts. However, not all Symbiodinium attracted necessarily end up in symbiosis because each host species can only associate with a limited number of Symbiodinium types (34–37). GFP-associated fluorescence is higher in larvae and juvenile coral polyps that lack symbionts compared with those that have symbionts, again suggesting a role for green fluorescence in attracting symbionts at this crucial life stage (38). The survival of corals affected by stress, such as the loss of symbionts after exposure to high temperature, might also rely on recruiting symbionts from the environment. This hypothesis is consistent with results showing that GFP-associated fluorescence is higher in bleached corals than in nonbleached ones (39). Furthermore, as bleaching sensitivity differs among symbiont Symbiodinium phylotypes, attracting a range of symbiont types might increase the chance of corals to survive bleaching (4). Our findings address a critical gap in our knowledge of the symbiosis between corals and algae, and suggest a role for GFP.
Materials and Methods
Cultures and Growth Conditions.
Symbiodinium sp. OTcH-1 (clade A) were obtained from the National Institute of Technology and Evaluation (Chiba, Japan). Symbiodinium Mf1.05b (clade B1) were from Mary Alice Coffroth (State University of New York at Buffalo, Buffalo, NY). Symbiodinium Y103 (clade C) were originally maintained in Michio Hidaka’s laboratory (University of the Ryukyus, Okinawa, Japan), and were gifted from Eiichi Shoguchi (Okinawa Institute of Science and Technology Graduate University, Okinawa, Japan). OTcH-1, Mf1.05b, and Y103 were originally isolated from Tridacna crocea, Orbicella faveolata, and Fragum sp., respectively. Symbiodinium were cultured in 200 mL of artificial seawater (sea salts no. S-9883; Sigma-Aldrich) containing Daigo’s IMK medium for marine microalgae (Wako) without shaking or air bubbling in a 500-mL Erlenmeyer flask with a silicone sponge closure at 25 °C under white fluorescent bulbs at 60 µmol photons · m−2⋅s−1 with a light/dark cycle of 12 h/12 h. Cells in their midlogarithmic growth phase (1–2 × 105 cells/mL) were used for the experiments. An automatic cell counter (TC20; Invitrogen) was used. Coral, E. aspera (green morph type), purchased from a coral supplier, was maintained in an aquarium tank with 1,100 L artificial seawater at 25 °C under white and blue LEDs at 100 µmol photons m−2⋅s−1 with a light/dark cycle of 12 h/12 h. All the laboratory experiments were carried out at room temperature (24–25 °C).
Light Sources.
For the action spectrum of phototaxis, the Okazaki Large Spectrograph (40) was used to provide 18 different monochromatic light spectra with a half-bandwidth of 10 nm. For the other experiments, LED panels (VBP-L444-W6666; Valore) were used to provide blue (460 nm), green (525 nm), and red (660 nm) light with a half-bandwidth of 16 nm (SI Appendix, Fig. S4). Spectra of the LED lights and sunlight used in the experiments are shown in SI Appendix, Fig. S4.
Evaluation of Phototaxis.
Symbiodinium cells were placed in a plastic container (width × length × height = 39 × 68 × 15 mm) that was illuminated down the length of the container (Fig. 1A). The opposite side was colored black to prevent light reflection. After 10 min light exposure, the culture was equally partitioned into halves proximal (P) and distal (D) to the light source by a silicon spacer. The cell density in each half was determined by flow cytometry (Attune; Life Technologies). The phototaxis index was calculated as [(P − D)/(P + D)], with values ranging from −1 to 1 (41). Positive and negative index values indicate positive and negative phototaxis, respectively.
Attraction of Symbiodinium by Coral Fragments or Artificial Objects.
Both coral fragments (alive) and skeletons from similar fragments (control) were cut into 8-mm squares with 2-mm height with a cast cutter and coated with a plastic resin (Sunnote). The artificial fluorescent objects and the controls were made from resin plastic with a GFD (fluorescent-green acrylic lacquer, Atom support) or a white dye (nonfluorescent white acrylic lacquer, Atom support), respectively. Coral fragments and skeletons or GFD and white plastic objects were placed in round white plastic dishes (95 mm in diameter; Fig. 2C) with cultured Symbiodinium cells, and exposed to light for 10 min. Then, Symbiodinium cells around the coral fragments or plastic objects were separated by silicon rings (21 mm in diameter) and collected for measuring the cell density. A TC20 cell counter or an Attune flow cytometer were used for cell counting in coral or plastic experiments, respectively. Paired two-tailed Student’s t tests were performed using MS Excel.
Evaluation of Fluorescence.
Excitation and emission spectra of the green fluorescent coral fragments coated with the resin and green fluorescent resin objects were measured with a FluorMax-4 spectrophotometer (Horiba Jobin Yvon). Excitation spectra were detected at an emission wavelength of 520 nm, and emission spectra were detected at an excitation wavelength of 470 nm. The relative quantification of green fluorescence of the coral fragment and the GFD-painted object was performed with the fluorescence stereo microscope M205FA (Leica microsystems) with the optical filter set LEICA 10447408 (excitation, 450–490 nm; emission, 500–550 nm).
Attraction of Free-Living Symbiodinium on a Coral Reef to a Green Fluorescent Object.
To examine whether a green fluorescent object attracted free-living Symbiodinium under natural seawater light conditions, we placed pairs of white traps, one painted with GFD and one without (Fig. 4A; 110 mm in diameter with 85 mm height), for 3 h at a depth of 3–6 m on the reef crest of Sesoko Island, Okinawa, Japan. The experiment was carried out on a sunny day between 1 and 4 PM on September 4, 2016. After 3 h on the reef, each trap was first sealed with a plastic lid and then transferred to the Sesoko Marine Station. To estimate the number of Symbiodinium cells in the traps, the seawater captured in each trap (400 mL) was centrifuged (1,600 × g for 2 min) with a Himac CT6E (Hitachi Koki), and pellets were stored at −30 °C. DNA was extracted from the pellets by using DNeasy plant-mini kit (Qiagen). Real-time PCR was performed with LightCycler (Roche) to quantify the concentration of small ribosomal subunit RNA gene fragments specific to Symbiodinium by quantification cycle (23). The primers used were ACGCAGTGCTCAGCTTCTGGAC and GATCCTTCCGCAGGTTCACCTAC. The concentrations of Symbiodinium cells in the seawater samples were estimated by using the Symbiodinium culture Y103 (clade C) as a standard (102, 103, and 104 cells/sample; SI Appendix, Fig. S2A). The PCR resulted in amplification of single ∼100-bp DNA fragments, as expected (SI Appendix, Fig. S2B). Similar PCR signal was seen in both clade B (Mf1.05b) and clad C (Y103) Symbiodinium strains, suggesting that the primers used target multiple Symbiodinium clades, as originally designed.
Phylogenetic Analysis.
Using a bacteriorhodopsin protein sequence from Halobacterium salinarum strain ATCC 700922 (BACR_HALSA, UniProtID: P02945) as a query, similarity searches against the Symbiodinium minutum genome (marinegenomics.oist.jp/symb/viewer/info?project_id=21), the Symbiodinium kawagutii genome (web.malab.cn/symka_new/index.jsp), and the GenBank database (https://www.ncbi.nlm.nih.gov/) were performed to collect homologous sequences, followed by multiple sequence alignment and phylogenetic analysis, as described previously (42). RAxML (43) and IQ-TREE (44) were used to reconstruct phylogenetic trees using LG+G model with support values based on 1,000 bootstrap resamplings.
Supplementary Material
Acknowledgments
We thank Nami Okubo for her advice on the conception of this study and Susumu Yoshizawa for discussion on rhodopsin protein evolution. We thank Yasuhiro Kamei for his advice regarding the use of the Okazaki Large Spectrograph. We thank Toshiyuki Sazi for his advice on construction of the experimental equipment. We thank the Model Plant Research Facility, National Institute for Basic Biology BioResource Center for their technical support. This work was supported by Japan Society for the Promotion of Science (JSPS) Grants-in-Aid for Scientific Research (KAKENHI) 18K19240 (to S.T.), 16K14814 (to Y.A.), and 16H06552 (to J.M.); NIBB Collaborative Research Program 15-362, 16-334, and 17-310 (to S.M.); and Gordon & Betty Moore Foundation’s Marine Microbiology Initiative 4985 (to S.M., S.T., and J.M.). Computational resources were provided by the Data Integration and Analysis Facility at the National Institute for Basic Biology. A.H.B. was supported by the Australian Research Council Centre of Excellence for Coral Reef Studies.
Footnotes
The authors declare no conflict of interest.
This article is a PNAS Direct Submission.
This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.1073/pnas.1812257116/-/DCSupplemental.
References
- 1.Baird AH, Guest JR, Willis BL. Systematic and biogeographical patterns in the reproductive biology of scleractinian corals. Annu Rev Ecol Evol Syst. 2009;40:551–571. [Google Scholar]
- 2.Cumbo VR, Baird AH, van Oppen MJH. The promiscuous larvae: Flexibility in the establishment of symbiosis in corals. Coral Reefs. 2013;32:111–120. [Google Scholar]
- 3.Abrego D, VAN Oppen MJH, Willis BL. Onset of algal endosymbiont specificity varies among closely related species of Acropora corals during early ontogeny. Mol Ecol. 2009;18:3532–3543. doi: 10.1111/j.1365-294X.2009.04276.x. [DOI] [PubMed] [Google Scholar]
- 4.Baker AC. Reef corals bleach to survive change. Nature. 2001;411:765–766. doi: 10.1038/35081151. [DOI] [PubMed] [Google Scholar]
- 5.Berkelmans R, van Oppen MJH. The role of zooxanthellae in the thermal tolerance of corals: A ‘nugget of hope’ for coral reefs in an era of climate change. Proc Biol Sci. 2006;273:2305–2312. doi: 10.1098/rspb.2006.3567. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Fitt WK, Trench RK. The relation of diel patterns of cell division to diel patterns of motility in the symbiotic dinoflagellate Symbiodinium microadriaticum freudenthal in culture. New Phytol. 1983;94:421–432. [Google Scholar]
- 7.Fitt WK, Chang SS, Trench RK. Motility patterns of different strains of the symbiotic dinoflagellate Symbiodinium (=Gymnodinium) microadriaticum (Freudenthal) in culture. Bull Mar Sci. 1981;31:436–443. [Google Scholar]
- 8.Yamashita H, Suzuki G, Hayashibara T, Koike K. Acropora recruits harbor “rare” Symbiodinium in the environmental pool. Coral Reefs. 2013;32:355–366. [Google Scholar]
- 9.Colley NJ, Trench RK. Selectivity in phagocytosis and persistence of symbiotic algae in the scyphistoma stage of the jellyfish Cassiopeia xamachana. Proc R Soc Lond B Biol Sci. 1983;219:61–82. doi: 10.1098/rspb.1983.0059. [DOI] [PubMed] [Google Scholar]
- 10.Kinzie RA, 3rd, Takayama M, Santos SR, Coffroth MA. The adaptive bleaching hypothesis: Experimental tests of critical assumptions. Biol Bull. 2001;200:51–58. doi: 10.2307/1543084. [DOI] [PubMed] [Google Scholar]
- 11.Fitt WK. The role of chemosensory behavior of Symbiodinium microadriaticum, intermediate hosts, and host behavior in the infection of coelenterates and molluscs with zooxanthellae. Mar Biol. 1984;81:9–17. [Google Scholar]
- 12.Takeuchi R, et al. Establishment of a model for chemoattraction of Symbiodinium and characterization of chemotactic compounds in Acropora tenuis. Fish Sci. 2017;83:479–487. [Google Scholar]
- 13.Hollingsworth LL, Kinzie RA, Lewis TD, Krupp DA, Leong JAC. Phototaxis of motile zooxanthellae to green light may facilitate symbiont capture by coral larvae. Coral Reefs. 2005;24:523. [Google Scholar]
- 14.Kawaguti S. Effect of the green fluorescent pigment on the productivity of the reef corals. Micronesica. 1969;5:121. [Google Scholar]
- 15.Matz MV, et al. Fluorescent proteins from nonbioluminescent Anthozoa species. Nat Biotechnol. 1999;17:969–973. doi: 10.1038/13657. [DOI] [PubMed] [Google Scholar]
- 16.Shimomura O. Structure of the chromophore of aequorea green fluorescent protein. FEBS Lett. 1979;104:220–222. [Google Scholar]
- 17.Wiedenmann J, Ivanchenko S, Oswald F, Nienhaus GU. Identification of GFP-like proteins in nonbioluminescent, azooxanthellate anthozoa opens new perspectives for bioprospecting. Mar Biotechnol (NY) 2004;6:270–277. doi: 10.1007/s10126-004-3006-4. [DOI] [PubMed] [Google Scholar]
- 18.Shagin DA, et al. GFP-like proteins as ubiquitous metazoan superfamily: Evolution of functional features and structural complexity. Mol Biol Evol. 2004;21:841–850. doi: 10.1093/molbev/msh079. [DOI] [PubMed] [Google Scholar]
- 19.Deheyn DD, et al. Endogenous green fluorescent protein (GFP) in amphioxus. Biol Bull. 2007;213:95–100. doi: 10.2307/25066625. [DOI] [PubMed] [Google Scholar]
- 20.Labas YA, et al. Diversity and evolution of the green fluorescent protein family. Proc Natl Acad Sci USA. 2002;99:4256–4261. doi: 10.1073/pnas.062552299. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Alieva NO, et al. Diversity and evolution of coral fluorescent proteins. PLoS One. 2008;3:e2680. doi: 10.1371/journal.pone.0002680. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Salih A, Larkum A, Cox G, Kühl M, Hoegh-Guldberg O. Fluorescent pigments in corals are photoprotective. Nature. 2000;408:850–853. doi: 10.1038/35048564. [DOI] [PubMed] [Google Scholar]
- 23.LaJeunesse TC, et al. Closely related Symbiodinium spp. differ in relative dominance in coral reef host communities across environmental, latitudinal and biogeographic gradients. Mar Ecol Prog Ser. 2004;284:147–161. [Google Scholar]
- 24.Koike S, Yabuki H, Kobayashi Y. Validation and application of real-time polymerase chain reaction assays for representative rumen bacteria. Anim Sci J. 2007;78:135–141. [Google Scholar]
- 25.Polívka T, Hiller RG, Frank HA. Spectroscopy of the peridinin-chlorophyll-a protein: Insight into light-harvesting strategy of marine algae. Arch Biochem Biophys. 2007;458:111–120. doi: 10.1016/j.abb.2006.10.006. [DOI] [PubMed] [Google Scholar]
- 26.Halldal P. Photosynthetic capacities and photosynthetic action spectra of endozoic algae of massive coral favia. Biol Bull. 1968;134:411–424. [Google Scholar]
- 27.Karim W, et al. Novel characteristics of photodamage to PSII in a high-light-sensitive Symbiodinium phylotype. Plant Cell Physiol. 2015;56:1162–1171. doi: 10.1093/pcp/pcv040. [DOI] [PubMed] [Google Scholar]
- 28.Jékely G. Evolution of phototaxis. Philos Trans R Soc Lond B Biol Sci. 2009;364:2795–2808. doi: 10.1098/rstb.2009.0072. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Foster KW, et al. A rhodopsin is the functional photoreceptor for phototaxis in the unicellular eukaryote Chlamydomonas. Nature. 1984;311:756–759. doi: 10.1038/311756a0. [DOI] [PubMed] [Google Scholar]
- 30.Iseki M, et al. A blue-light-activated adenylyl cyclase mediates photoavoidance in Euglena gracilis. Nature. 2002;415:1047–1051. doi: 10.1038/4151047a. [DOI] [PubMed] [Google Scholar]
- 31.Shoguchi E, et al. Draft assembly of the Symbiodinium minutum nuclear genome reveals dinoflagellate gene structure. Curr Biol. 2013;23:1399–1408. doi: 10.1016/j.cub.2013.05.062. [DOI] [PubMed] [Google Scholar]
- 32.Yamashita H, Kobiyama A, Koike K. Do uric acid deposits in zooxanthellae function as eye-spots? PLoS One. 2009;4:e6303. doi: 10.1371/journal.pone.0006303. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Haddock SHD, Dunn CW. Fluorescent proteins function as a prey attractant: Experimental evidence from the hydromedusa Olindias formosus and other marine organisms. Biol Open. 2015;4:1094–1104. doi: 10.1242/bio.012138. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Biquand E, et al. Acceptable symbiont cell size differs among cnidarian species and may limit symbiont diversity. ISME J. 2017;11:1702–1712. doi: 10.1038/ismej.2017.17. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Schoenberg DA, Trench RK. Genetic variation in Symbiodinium (=Gymnodinium) microadriaticum Freudenthal, and specificity in its symbiosis with marine invertebrates. III. Specificity and infectivity of Symbiodinium microadriaticum. Proc R Soc Lond B Biol Sci. 1980;207:445–460. [Google Scholar]
- 36.Weis VM, Reynolds WS, deBoer MD, Krupp DA. Host-symbiont specificity during onset of symbiosis between the dinoflagellates Symbodinium spp. and planula larvae of the scleractinian coral Fungia scutaria. Coral Reefs. 2001;20:301–308. [Google Scholar]
- 37.Kinzie RA. Experimental infection of aposymbiotic gorgonian polyps with zooxanthellae. J Exp Mar Biol Ecol. 1974;15:335–345. [Google Scholar]
- 38.Kenkel CD, Traylor MR, Wiedenmann J, Salih A, Matz MV. Fluorescence of coral larvae predicts their settlement response to crustose coralline algae and reflects stress. Proc Biol Sci. 2011;278:2691–2697. doi: 10.1098/rspb.2010.2344. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Ricaurte M, Schizas NV, Ciborowski P, Boukli NM. Proteomic analysis of bleached and unbleached Acropora palmata, a threatened coral species of the Caribbean. Mar Pollut Bull. 2016;107:224–232. doi: 10.1016/j.marpolbul.2016.03.068. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Watanabe M, et al. Design and performance of the Okazaki large spectrograph for photobiological research. Photochem Photobiol. 1982;36:491–498. [Google Scholar]
- 41.Hartz AJ, Sherr BF, Sherr EB. Photoresponse in the heterotrophic marine dinoflagellate Oxyrrhis marina. J Eukaryot Microbiol. 2011;58:171–177. doi: 10.1111/j.1550-7408.2011.00529.x. [DOI] [PubMed] [Google Scholar]
- 42.Maruyama S, Suzaki T, Weber APM, Archibald JM, Nozaki H. Eukaryote-to-eukaryote gene transfer gives rise to genome mosaicism in euglenids. BMC Evol Biol. 2011;11:105. doi: 10.1186/1471-2148-11-105. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Stamatakis A, Hoover P, Rougemont J. A rapid bootstrap algorithm for the RAxML Web servers. Syst Biol. 2008;57:758–771. doi: 10.1080/10635150802429642. [DOI] [PubMed] [Google Scholar]
- 44.Nguyen LT, Schmidt HA, von Haeseler A, Minh BQ. IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol Biol Evol. 2015;32:268–274. doi: 10.1093/molbev/msu300. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.




