Abstract
Objectives
This report highlights phytoconstituents present in Cissus quadrangularis (CQ) extract and examines biphasic (proliferative and anti‐proliferative) effects of its extract on bone cell proliferation, differentiation, mineralization, ROS generation, cell cycle progression and Runx2 gene expression in primary rat osteoblasts.
Materials and methods
Phytoconstituents were identified using gas chromatography–mass spectroscopy (GC‐MS). Osteoblasts were exposed to different concentrations (10–100 μg/ml) of CQ extract and cell proliferation and cell differentiation were investigated at different periods of time. Subsequently, intracellular ROS intensity, apoptosis and matrix mineralization of osteoblasts were evaluated. We performed flow cytometry for DNA content and real‐time PCR for Runx2 gene expression analysis.
Results
CQ extract's approximately 40 bioactive compounds of fatty acids, hydrocarbons, vitamins and steroidal derivatives were identified. Osteoblasts exposed to varying concentrations of extract exhibited biphasic variation in cell proliferation and differentiation as a function of dose and time. Moreover, lower concentrations (10–50 μg/ml) of extract slightly reduced ROS intensity, although they enhanced matrix mineralization, DNA content in S phase of the cell cycle, and levels of Runx2 expression. However, higher concentrations (75–100 μg/ml) considerably induced the ROS intensity and nuclear condensation in osteoblasts, while it reduced mineralization level, proportion of cells in S phase and Runx2 level of the osteogenic gene.
Conclusions
These findings suggest that CQ extract revealed concentration‐dependent biphasic effects, which would contribute notably to future assessment of pre‐clinical efficacy and safety studies.
Introduction
Metabolic bone disorders, including osteoporosis and bone fracture healing, are major public health problems that afflict hundreds of millions people worldwide, importantly post‐menopausal women 1. Although many therapeutic systems, such as chemotherapy and radiotherapy, have been developed for treatment of bone disorders, none are free from complications and side effects which limit successful outcomes in many cases 2. Accordingly, we needed to focus our study to develop a novel strategy for control and treatment of disease, free from side effects. Ethno‐traditional uses of herbal products have been a major source for discovery of potential osteogenic agents to address these problems 3.
Cissus quadrangularis L. (CQ, Family Vitaceae) is one of the most frequently used medicinal plants widely distributed in India, Africa, Arabia and Indo‐Malaysia 4. Recently, various extraction and analytical systems have been developed to study herbal components of its extract as well as its pharmacological activities. Gas chromatography coupled to mass spectrometry (GC‐MS) is an ideal technique to identify volatile and semi‐volatile components qualitatively as well as quantitatively, for rapid extraction, low solvent consumption and precise analysis of herbal components, to obtain enhanced recovery 5. A range of phytocomponents such as iridoids, stilbenes, quercitin, quercitrin, β‐sitosterol, β‐sitosterol glycoside, triterpenes, fatty acid methyl esters, glycerolipids, steroids, phytols, stigmasterol and cerebrosides have been reported in CQ plants 6, 7 and various studies have reported osteogenic activity of CQ extracts in ovariectomized rats 8, 9. CQ powder has also been clinically evaluated to reduce the intermaxillary fixation time for patients with fracture of the mandible 4, 10. Moreover, phytocomponents present in CQ extracts have demonstrated multifunctional biological effects such as antioxidant capacity, analgesia, being anti‐inflammatory, inducing apoptosis in cancer cells yet causing liver dysfunction 11, 12.
Proliferation and differentiation of osteoblasts, required for bone formation is mediated by the osteogenic Runt‐related transcription factor‐2 (Runx2) gene. Runx2 is a key transcription factor regulating premature osteogenesis and delayed mineralization of osteoblasts 13. Previously, in vitro studies have revealed that CQ extract has shown proliferative effects in osteoblastic MC3T3‐E1 and SaOS‐2 cell lines, other than anti‐proliferative and apoptotic activities in human skin carcinoma A431 cells 14, 15, 16. On the basis of these reports, we speculated that CQ might have biphasic effects (proliferative and anti‐proliferative) depending upon dose and time factors. Reactive oxygen species (ROS) also play an essential role in cell proliferation and cell cycle progression, depending upon dose and time of exposure 17, 18. Hence, considering the role of ROS and cell cycle kinetics, no reliable studies have been developed so far, to link biphasic roles of CQ extract modulating ROS generation, cell cycle progression and Runx2 expression, in primary cultures of rat osteoblasts.
Thus, this study was designed to evaluate the phytoconstituents present in CQ extract and to examine its biphasic effects, modulating osteogenic activity using MTT, ALP, mineralized nodule formation, ROS generation, apoptosis, cell cycle kinetics and Runx2 expression, in osteoblasts. The study illustrated that lower concentrations exerted stimulatory biological effects and higher concentrations resulted in inhibitory effects, which would be beneficial for future assessment of pre‐clinical efficacy and safety studies.
Materials and methods
Reagents and chemicals
Alpha‐modified minimum essential medium (α‐MEM), foetal bovine serum (FBS), MTT (3‐(4,5‐dimethylthiazol‐2‐yl)‐2,5‐diphenyltetrazolium bromide), p‐nitrophenyl phosphate (pNPP), naphthol AS−MX phosphate, fast blue BB salt and ascorbic acid were purchased from Himedia, India. Propidium iodide (PI), 4′, 6′‐diamidino‐2 phenylindole (DAPI), 2,7‐dichlorodihydrofluorescein diacetate (DCFH‐DA), β‐glycerophosphate, 17β‐estradiol (E2) and RNase A were purchased from Sigma‐Aldrich, Saint Louis, MO, USA. RNAiso Plus reagent was procured from Takara, New Delhi, India. cDNA synthesis kit was purchased from Thermo Scientific, Mumbai, Maharashtra and SYBER green kit from Roche, Mumbai, Maharashtra. All the reagents used were of high purity grade.
Ethics statement
Animal experiments were performed according to the protocol approved by the Institutional Animal Ethics Committee (IAEC), Faculty of Pharmacy, Integral University, Lucknow, India. Approval ID for this study was IU/Biotech/Project/CPCSEA/12/19.
Plant materials and extraction
Fresh cultivated CQ plants were collected from the Department of Botany, University of Lucknow, Lucknow, India in June 2012. A reference specimen (voucher No. IU/PHAR/HRB/14/06) was deposited in the herbarium of the Faculty of Pharmacy, Integral University, Lucknow. Collected areal components of plant materials were cut into small pieces, washed in double distilled water, air dried in the shade and pulverized into powder in a mechanical grinder. 95% ethanolic extract of CQ powder (400 g) was prepared with the help of Soxhlet apparatus (Borosil Glass Works Limited, India) at 60 °C using Whatman No. 1 filter paper. Filtrate obtained was concentrated under vacuum at 40 °C using a rotary evaporator (BUCHI Rotavapor R‐205, Flawil, Switzerland) to obtain approximately 10% of the final yield. Plant extract was then used for GC‐MS analysis and in vitro study.
GC‐MS analysis
Gas chromatography combined with mass spectroscopy is preferable methodology for identification of compounds. Chemical composition of 95% ethanolic extract of CQ was analysed using a GCMS‐QP2010 Plus system (Shimadzu, Tokyo, Japan). Ethanolic extract (1 μl) of CQ was injected in split ratio 10:0 on to a RTX‐5 column (60 m × 0.25 mm internal diameter, film thickness 0.25 μm). Helium was used as carrier gas at constant flow rate of 1.21 ml/min at 90.4 kPa inlet pressure. Oven temperature was programmed to 100 °C (isothermal for 3 min) with increase rate of 10 °C/min to 250 °C (isothermal for 6 min), followed by 5 °C/min increment to final temperature of 310 °C, which was held for 12 min. Injector and ion source temperatures were 260 °C and 230 °C respectively. Mass spectra were taken at 70 eV with a scan interval of 0.5 s and mass range of 40–600 (m/z). Total GC/MS running time was 42.99 min. For compound identification, CQ extract was separated into various constituents with different retention times, by mass spectrophotometry. Chromatograms of intensity against retention time were recorded by software attached to the mass spectrophotometer. Mass spectrum of unknown components was compared to spectra of known components stored in the NIST08 and WILEY8 library. Name, molecular weight and structure of the components of the CQ extract were ascertained.
Primary culture of osteoblasts
Osteoblasts – bone‐forming cells, were isolated from neonatal rat pup calvaria following the protocol of sequential digestion, with slight modification 19. In brief, calvaria were dissected from four to five neonatal (1–2 days old) rat pups. After removal of sutures and adherent mesenchymal tissues, calvaria were subjected to five sequential (10–15 min) digestions at 37 °C, in a water bath shaker at 120 rpm containing 0.1% each of dispase and type II collagenase enzyme. Supernatants were pooled from the second to fifth digestions in a tube containing 800 μl foetal bovine serum (FBS). Cells were re‐suspended in α‐MEM containing 10% FBS and 1% penicillin/streptomycin solution, and plated in T‐25 cm2 culture flasks. Cells were then incubated at 37 °C in 5% carbon dioxide in a CO2 incubator (Excella ECO‐170, Hamburg, Germany).
Cell viability assay
Cell viability effects of CQ extract was performed using MTT assay, according to a previously used protocol 20. In brief, calvarial osteoblasts were trypsinized and 2 × 103 cells were seeded in each well of 96‐well plates in 100 μl α‐MEM complete media. Cells were incubated overnight at 37 °C in 5% CO2. Stock solutions of CQ extract were prepared using α‐MEM complete media. Cells were then treated at different concentrations (10, 25, 50, 75 and 100 μg/ml) of extract for different time periods (12, 24, 48 and 72 h). E2 at the concentration of 10−9 m was used as a positive control. After each treatment period, 10 μl MTT reagent (5 mg/ml in phosphate‐buffered saline–PBS) was added to each well and the plate was further incubated at 37 °C for 3 h until formazan blue crystals developed. Supernatant was discarded from each well and 100 μl of DMSO was added (to solubilize the dark blue formazan crystals), at 37 °C for 10 min. Absorbance was recorded at 540 nm by a microplate reader (BIORAD‐680, Hercules, CA, USA) and percentage cell viability was calculated.
Alkaline phosphatase (ALP) assay
ALP activity was measured following a previously described protocol 21. Briefly, calvarial osteoblasts at 2 × 103 cells/well were seeded in 96‐well plates. At 70–80% confluence, cells were treated with different concentrations (10–100 μg/ml) of CQ extract for the periods of 12, 24, 48 and 72 h, in osteoblast differentiating medium (α‐MEM supplemented with 50 μg/ml ascorbic acid, 10 mm β‐glycerophosphate and 10% FBS). E2 at the concentration of 10−9 m was used as positive control. At the end of the incubation period, the plate was washed twice in PBS and fixed by retaining at −70 °C, for 20 min and then brought to 37 °C for freeze fracture. Chilled pNPP substrate (50 μl) was added to each well and kept at 37 °C for 30 min for colour development. Activity was measured by the colorimetric method at 405 nm.
Determination of ROS activity
ROS are a key regulator in cell proliferation and apoptosis pathways and hence, intracellular ROS generation in osteoblasts was assessed by 2′,7′‐dichlorofluorescein diacetate (DCFH‐DA) 22. In brief, osteoblasts (2 × 103 cells/well) were seeded in a 96‐well black bottom culture plate for 24 h. They were then exposed to 10–100 μg/ml concentrations of CQ extract for 48 h in triplicate. After exposure, cells were incubated in DCFH‐DA (10 mm) at 37 °C for 30 min. Then the reaction mixture was aspirated and replaced by 200 μl PBS, in each well, on a shaker for 10 min at room temperature in the dark. Fluorescence intensity was measured using a multiwell plate reader (Synergy H1 Hybrid Multi‐Mode Microplate Reader; BioTek, Seattle, WA, USA) at excitation wavelength of 485 nm and emission wavelength of 528 nm. Photomicrographs of a further set of cells seeded in 96‐well plates were taken using fluorescence microscopy (Nikon ECLIPSE Ti‐S, Tokyo, Japan) to analyse ROS intracellular fluorescence intensity.
Assay of apoptosis
Apoptotic effect of CQ extract at different concentrations (10–100 μg/ml) was analysed using nuclear fluorescent DAPI following a previously used protocol 22. Cells were seeded and treated for 48 h in a 96‐well plate. After treatment, they were washed in PBS and fixed in 4% paraformaldehyde for 10 min. Subsequently, cells were permeabilized with permeabilization buffer (3% paraformaldehyde and 0.5% Triton X‐100) and stained with DAPI. After staining, images were taken using a fluorescence microscope. Quantification of cells was performed in triplicate for each treatment and 100 cells per sample were counted in different fields (at least 10 random fields per sample) to score percentage apoptotic cells, as reported earlier using a fluorescence microscope (Nikon ECLIPSE Ti‐S) 23.
Mineralization assay
Alizarin Red S, an anthraquinone derivative, was used to identify calcium content in the osteoblast preparation, following a previously used protocol 20. Mineralization assay was performed by culturing osteoblasts at 2 × 104 cells/well in a 12‐well culture plate in differentiation medium (DM) consisting of α‐MEM with 50 μg/ml ascorbic acid and 10 mm β‐glycerophosphate. CQ treatment at various concentrations (10–100 μg/ml) was continued for 21 days and medium was changed on alternate days. At the end of experiments, cells were washed in PBS and fixed in 4% paraformaldehyde in PBS for 15 min. Fixed cells were stained with 40 mm Alizarin Red S (pH 4.5) for 30 min followed by washing in distilled water. Calcified nodules (which appeared bright red in colour) were photographed using an inverted phase contrast microscope. For quantification of staining, 100 mm cetylpyridinium chloride solution was added for 1 h to each well to solubilize and to release calcium‐bound Alizarin red into solution. 100 μl supernatant from each well was transferred to a 96‐well plate in triplicate and absorbance was recorded at 570 nm by a microplate reader.
DNA content analysis
Cell cycle phase distribution and DNA content investigation was carried out using flow cytometry 20. Osteoblasts were plated in six‐well plates at 1 × 106 cells/ml and treated with different concentrations (10–100 μg/ml) of CQ extract for 48 h. Cultured cells were then washed in cold PBS and fixed in 70% ethanol at −20 °C for 2 h. Fixed cells were treated with RNase A (10 mg/ml) and stained with PI in the dark for 30 min at room temperature. PI fluorescence of individual nuclei was measured using flow cytometry (BD FACS Calibur; Becton Dickinson, Franklin Lakes, NJ, USA). Data were analysed with the aid of Cell Quest Pro V 3.2.1 software (Becton Dickinson).
Quantitative real‐time PCR (qPCR)
Total RNA was isolated from treated and untreated cultured osteoblasts, with different concentrations (10–100 μg/ml) of CQ extract, using RNAiso Plus reagent following the manufacturer's instructions. 2.0 μg aliquots of total RNA in 10 μl reaction volume were used to synthesize cDNA using the cDNA synthesis kit. Quantitative real‐time PCR was performed in a light cycler PCR system (LightCycler 480; Roche) using SYBER green kit. Runx2 gene expression in calvarial osteoblasts was determined by qPCR using a standard protocol 3. Sequence of primer pairs of the genes were as follows: Runx2‐CCACAGAGCTATTAAAGTGACAGTG (F), AACAAACTAGGTTTAGAGTCATCAAGC (R); GAPDH (housekeeping gene)‐CAGCAAGGATACTGAGAGCAAGAG (F), GGA TGGAATTGTGAGGGAGATG (R). Data were normalized to GAPDH expression as the internal control, to study relative expression of the targeted gene.
Statistical analysis
All results are presented as mean ± SEM and differences between treatment groups compared to controls was analysed using Student's t‐test. Probability value of P < 0.05 was considered to be statistically significant.
Results
GC‐MS analysis
GC‐MS chromatogram of the alcoholic extract of native CQ had approximately 40 peaks representing presence of 40 bio‐active compounds (Fig. 1). The identified compounds, their retention time, per cent peak area and m/z (mass‐to‐charge ratio) are summarized in Table 1.
Figure 1.

GC ‐ MS chromatogram of the 95% ethanolic extract of CQ . Chemical composition of CQ extract with their retention time identified by GC‐MS.
Table 1.
Phytoconstituents of 95% ethanolic extract of CQ identified by GC‐MS
| S. No. | Compounds name | RT (min) | Area (%) | Fragmentation (m/z) |
|---|---|---|---|---|
| 1. | 5,9‐Undecadien‐2‐one, 6,10‐dimethyl‐, (Z) | 8.903 | 0.28 | 43,41,69 |
| 2. | Phenol, 2,4‐bis(1,1‐dimethylethyl) | 9.716 | 0.09 | 191,57,206 |
| 3. | Benzoic acid, 4‐ethoxy‐, ethyl ester | 9.905 | 0.15 | 121,149,138 |
| 4. | Dodecanoic acid, ethyl ester | 10.653 | 0.25 | 88,101,41 |
| 5. | Estra‐1,3,510‐trien‐17.beta.‐ol | 12.648 | 0.58 | 43,57,41 |
| 6. | 2,6,10‐trimethyl,14‐ethylene‐14‐pentadecne | 13.402 | 0.20 | 68,82,95 |
| 7. | Pentadecanoic acid | 13.723 | 0.29 | 73,43,60 |
| 8. | 1,2‐Benzenedicarboxylic acid, bis(2‐methylpropyl) ester | 13.788 | 0.16 | 149,57,41 |
| 9. | 2‐Hexadecen‐1‐ol, 3,7,11,15‐tetramethyl‐, [R‐[R*,R*‐(E)]]‐ | 13.847 | 0.12 | 68,82,43 |
| 10. | Pentadecanoic acid, ethyl ester | 13.958 | 0.93 | 88,101,43 |
| 11. | n‐Hexadecanoic acid | 14.800 | 8.57 | 60,73,43 |
| 12. | Hexadecanoic acid, ethyl ester | 14.973 | 4.40 | 88,101,41 |
| 13. | Heptadecanoic acid | 15.666 | 0.93 | 43,57,73 |
| 14. | Phytol | 16.150 | 1.02 | 71,43,57 |
| 15. | 6‐Octadecenoic acid, (Z) | 16.488 | 8.30 | 55,41,69 |
| 16. | n‐Propyl 9,12‐octadecadienoate | 16.558 | 1.20 | 67,81,55 |
| 17. | Ethyl oleate | 16.614 | 4.76 | 55,69,41 |
| 18. | Octadecanoic acid, ethyl ester | 16.822 | 2.22 | 88,101,70 |
| 19. | 4,8,12,16‐Tetramethylheptadecan‐4‐olide | 18.271 | 0.54 | 99,43,57 |
| 20. | Icosanoic acid | 18.331 | 0.76 | 43,57,73 |
| 21. | Docosanoic acid, ethyl ester | 19.536 | 0.70 | 88,43,57 |
| 22. | L‐(+)‐Ascorbic acid 2,6‐dihexadecanoate | 20.437 | 0.53 | 57,73,43 |
| 23. | Heptadecanoic acid, ethyl ester | 20.751 | 1.27 | 88,101,41 |
| 24. | Vitamin E | 27.982 | 0.60 | 165,430,205 |
| 25. | Ergost‐5‐en‐3‐ol, (3.beta.,24R) | 28.789 | 3.70 | 107,95,145 |
| 26. | Stigmasterol | 29.061 | 0.82 | 55,83,69 |
| 27. | beta.‐Sitosterol | 29.599 | 6.62 | 43,57,41 |
| 28. | Cholest‐4‐en‐3‐one | 29.953 | 0.42 | 124,43,229 |
| 29. | Lup‐20(29)‐en‐3‐one | 30.099 | 1.34 | 205,109,95 |
| 30. | 4,22‐Stigmastadiene‐3‐one | 30.204 | 0.41 | 55,69,81 |
| 31. | Lupeol | 30.340 | 0.50 | 43,68,81 |
| 32. | Lup‐20(29)‐en‐3‐yl acetate | 30.602 | 0.42 | 43,95,189 |
| 33. | Stigmast‐4‐en‐3‐one | 30.815 | 4.19 | 124,43,412 |
| 34. | Cholesta‐4,6‐dien‐3‐one | 31.099 | 0.28 | 43,136,382 |
| 35. | Friedelin | 31.731 | 0.87 | 69,109,95 |
| 36. | Cyclopropa[5,6]stigmast‐22‐en‐3‐one, 3′,6‐dihydro‐, (5.beta.,6.alpha.,22E)‐ | 31.896 | 0.07 | 55,43,69 |
| 37. | 4,4a,6b,8a,11,11,12b,14a‐octamethyl‐eicosahydro‐picen‐3‐one | 32.105 | 0.26 | 69,95,55 |
| 38. | 3.alpha.,7.beta.‐Dihydroxy‐5.beta.,6.beta.‐epoxycholestane | 32.408 | 0.04 | 123,95,55 |
| 39. | Stigmastane‐3,6‐dione, (5.alpha.) | 32.637 | 1.20 | 55,57,98 |
| 40. | Solanesol | 34.399 | 0.13 | 69,81,93 |
Cell viability assay and kinetics
MTT assay showed that at 12 h exposure, viability of the osteoblasts increased significantly (P < 0.05) in a dose‐dependent manner compared to controls. However, 75 μg/ml concentration of CQ extract increased the cell viability and 100 μg/ml extract reduced cell growth at 24 h extract exposure. Similarly, 50 μg/ml extract resulted in approximately 22.82% cell growth at 48 h, but at higher concentrations (75 and 100 μg/ml) it showed adverse effects. Greatest cell viability, approximately 28.52%, was observed at 72 h with 50 μg/ml CQ treatment. As a result, lower concentrations (10–50 μg/ml) enhanced cell activity for 72 h (Fig. 2a). Exposure of cells with 10−9 M of E2 increased the cell viability to 18.66, 20.1 and 23.12% at 24, 48 and 72 h respectively. Figure 2b and 2c represent the kinetic model of cell viability data. Equation C = C 0 + Kt was found to be the most suitable fit for data obtained in cases of lower concentrations (10–50 μg/ml). However, for higher concentrations (75 and 100 μg/ml), the best suitable fit included linear growth followed by exponential decay with equations C = C 0 + K1t and C = A exp [−K2 (t − t 0)] respectively. Here, C 0 and K are initial number and rate constant of cell viability respectively. Corresponding values of growth and decay are shown in Table 2. Regression analysis yields the value of R 2 and is found to vary between 0.999 and 0.997 for lower concentrations (Table 2a), while for higher concentrations, the value of R 2 was found to vary between 0.875 and 0.717 (Table 2b).
Figure 2.

Per cent cell viability, morphology and ALP activity of primary osteoblasts. (a) Per cent cell viability of osteoblasts treated with 10–100 μg/ml of CQ extract for the period of 12–72 h. Cells were stained with MTT dye and the absorbance was recorded at 540 nm by a microplate reader, (b, c) Kinetic model of per cent cell viability of osteoblasts treated with lower concentrations (10–50 μg/ml) and higher concentrations (75–100 μg/ml) of CQ extract respectively, (d) Morphology of osteoblasts under inverted phase contrast microscope treated with different concentrations of CQ extract at 48 h (magnification = 20x and scale bar = 0.1 mm) and (e) ALP activity of osteoblasts treated with increasing concentrations (10–100 μg/ml) of CQ extract for 24–72 h. p‐nitrophenyl phosphate (pNPP) substrate was added for colour development and values were measured by a microplate reader at 405 nm. Values were obtained from three independent experiments and expressed as mean ± SEM. *P < 0.05 compared with control.
Table 2.
Comparison of decay times of cell viability at different concentrations of CQ extract (A and B)
| CQ concentration (μg/ml) | Value of K (h−1) | Time constant (h) | R 2 a |
|---|---|---|---|
| (A) | |||
| 10 | 0.13197 | 7.577479730 | 0.99998 |
| 25 | 0.29894 | 3.345152873 | 0.99952 |
| 50 | 0.45543 | 2.195727115 | 0.99787 |
| CQ concentration (μg/ml) | Time constant t 1 (h) | Time constant t 2 (h) | R 2 b |
|---|---|---|---|
| (B) | |||
| 75 | 0.901111972 | 2.034339653 | 0.87570 |
| 100 | 1.072248075 | 1.363029196 | 0.71753 |
Equation fitted: C = C 0 + Kt, C 0 = 100.
Equation fitted: C = C 0 + K 1 t, C = A exp [−K 2 (t − t 0)].
Microscopic observation of osteoblasts
Figure 2d reveals comparative cell morphology of osteoblasts treated with different concentrations of CQ extract at 48 h. By phase contrast microscopy untreated primary osteoblasts had typical spindle shapes with fibroblastic appearance. Osteoblasts treated with lower concentrations of CQ extract elicited faster growth compared to untreated cells. At 10 μg/ml of CQ extract, osteoblasts changed their morphology and acquired slightly elongated shapes indicative of cell proliferation. Moreover, at 25 and 50 μg/ml extract treatment, cells had more rapidly fusiform appearance with increase in numbers compared to controls. On the other hand, 75 and 100 μg/ml CQ extract distorted the cells to slightly rounder shapes with loss of membrane integrity, and reduced cell growth.
ALP assay
As observed from the results, concentration range (10–100 μg/ml) of extract induced cell differentiation at both time periods of 12 (data not shown) and 24 h in a dose‐dependent manner. Higher concentrations (75–100 μg/ml) of extract tended to reduce ALP levels at 48 and 72 h (Fig. 2e). However, lower concentrations (10–50 μg/ml) significantly increased ALP levels at both 48 and 72 h (P < 0.05) compared to controls. Exposure of cells to 10−9 M E2 also significantly increased ALP activity. These data were consistent with the MTT result (Fig. 2a).
As a result of substantial increase in proliferation and differentiation of the osteoblasts, the effect of different concentrations of CQ extract on ROS generation, apoptosis, DNA content and subsequently osteogenic gene Runx2 expression were further evaluated at 48 h.
Determination of ROS activity
Fluorescence microscopy images (Fig. 3a) showed that with increasing extract concentrations (10–50 μg/ml), ROS intensity was slightly reduced without distorting cell native morphology, compared to controls. However, higher concentrations (75–100 μg/ml) induced ROS intensity and deformed morphology. Moreover, quantitative data of ROS generation revealed that 75 and 100 μg/ml extract induced significant (P < 0.05) intracellular ROS level approximately 9.57% and 21.64% respectively, compared to controls (Fig. 3b). Little change in ROS level was observed at 10 μg/ml extract, reducing only 0.32% of ROS, while 25 and 50 μg/ml concentrations of extract significantly reduced the (P < 0.05) ROS level to approximately 3.48% and 5.56% respectively, compared to controls.
Figure 3.

Measurement of intracellular ROS generation and nuclear condensation in primary osteoblasts. (a) Fluorescence microscopy images of osteoblasts showing intracellular ROS generation induced by different concentrations (10–100 μg/ml) of CQ extract, (b) Quantitative data of ROS generation expressed as the percentage of fluorescence intensity relative to the controls, (c) Fluorescence microscopy images showing nuclear condensation in osteoblasts treated with different concentrations (10–100 μg/ml) of CQ extract (magnification = 20x and scale bar = 0.1 mm) and (d) Numerical data were expressed as % apoptotic cells respective to their controls. The cells were counted manually under a fluorescence microscope in at least 10 random fields and per cent apoptotic cells were calculated as detailed under Materials and Methods. Values are obtained from three independent experiments and expressed as mean ± SEM. *P < 0.05 compared with control.
Assay of apoptosis
As observed from photomicrograph (Fig. 3c), untreated and treated cells with lower concentrations of CQ extract (10–50 μg/ml) did not show any significant fluorescence or condensed nuclei. However, fragmented and condensed nuclei were observed in osteoblasts treated with higher concentrations of CQ extract (75–100 μg/ml). Furthermore, approximately 6.33% and 10.67% apoptotic cells were observed at 75 and 100 μg/ml extract treatment respectively (Fig. 3d). These resulted in deep blue fluorescence that highlighted nuclei with abnormal margins and fragmented chromatin.
Mineralization assay
Study using inverted phase contrast microscopy revealed that proliferative osteoblasts exhibited fibroblastic monolayer morphology. Cells appeared to form mosaic‐like multiple layers at 50 μg/ml extract, but this was inhibited at 75 and 100 μg/ml (Fig. 4a). Quantitative data of mineralized bone nodule formation of osteoblasts treated with CQ extract at 21 days are shown in Fig. 4b. As observed from the graph, lower concentrations (10–50 μg/ml) increased mineralized nodules of cultured osteoblasts, showing significant osteogenic effect (P < 0.05) in a dose‐dependent manner compared to control osteoblastic media (OBM) and DM. However, higher concentrations (75–100 μg/ml) appeared to reduce the level of mineralization.
Figure 4.

Mineralization assay of osteoblasts. (a) Photomicrographs showing increased formation of mineralized nodules of osteoblastic cells in osteoblast medium (OBM, control group, no induction), osteoblast differentiation media (DM) and osteoblast differentiation media with increasing concentrations (10–100 μg/ml) of CQ extract for 21 days (magnification = 10x and scale bar = 0.2 mm) and (b) Quantitative data of Alizarin Red S extraction expressed in the form of OD. Data are represented as mean ± SEM of three independent experiments. *P < 0.05 versus OBM and DM.
DNA content analysis
As observed from the results (Fig. 5a,b), mean proportion of S phase cells of controls sharply increased from 27.5% to 34.8% at 10 μg/ml of CQ treatment. Maximal cell expansion (DNA content) in S phase was found to be 47.4% at 50 μg/ml of extract. Interestingly, no apoptotic cells were observed at lower concentrations of extract treatment. However, mean proportion of cells in S phase dramatically dropped to approximately 32.3% at 75 μg/ml extract and subsequently it was reduced at 100 μg/ml CQ treatment. Apoptotic cells also markedly increased at higher CQ concentrations. On the other hand, lower concentrations of CQ extract reduced percentage of cells in G2/M phase and higher concentrations increased those in G2/M. Little variation in G0/G1 phases was found between concentrations of CQ extract.
Figure 5.

DNA content analysis by flow cytometry. (a) Pictorial graph showing the mean proportion of cells in S phase treated with different concentrations (10–100 μg/ml) of CQ extract at 48 h. Results expressed as the % of S phase population and (b) Quantitative distribution of percentage cells in different phases of cell cycle treated with different concentrations of CQ extract. Data are representative of three independent experiments and expressed as mean ± SEM. *P < 0.05 compared with control.
Osteogenic gene Runx2 expression analysis
Effects of different concentrations of CQ extract on Runx2 expression were observed by qPCR at 48 h. As is clear from the results (Fig. 6), lower concentrations (10–50 μg/ml) of CQ extract significantly (P < 0.05) elevated Runx2 expression level compared to control. However, concentrations (75–100 μg/ml) of CQ extract reduced Runx2 level in a dose‐dependent manner compared to controls (P < 0.05).
Figure 6.

Analysis of mRNA levels of Runx2 gene by qPCR. Primary osteoblasts were treated with (10–100 μg/ml) of CQ extract for 48 h and Runx2 mRNA expression level was analysed by qPCR. Fold changes in mRNA levels are indicated by the numbers derived after normalizing with GAPDH mRNA levels used as an internal control. Values are obtained from three independent experiments in triplicate and expressed as mean ± SEM; *P < 0.05 as compared to control.
Discussion
The present study explored identification of phytoconstituents of native CQ and ability of CQ extract to modulate osteogenic induction through ROS generation, cell cycle kinetics and Runx2 expression in a primary rat osteoblast model system. In the CQ extract, approximately 40 bioactive compounds were identified by using GC‐MS, whereas approximately 3/4 of the extract was primarily composed of fatty acid, esters, phenolic compounds and phytoesteroids (Fig. 1 and Table 1). The major components, n‐hexadecanoic acid and its derivatives hexadecanoic acid ethyl ester and octadecanoic acids (rich fatty acids) play an important role in multifunctional biological processes such as being anti‐inflammatory, causing apoptotic induction of cancer cells and causing liver dysfunction 24, 25. In addition to bone healing and anti‐osteoporotic activities 4, 26, flavonoids and polyphenolic compounds are also valuable for antioxidant and anti‐microbial activities 27. Phenolic content of CQ extract has been shown to have apoptotic activity in the human skin carcinoma A431 cell line 16. Other components such as lupeol have been reported to be osteogenic compounds; however, friedelin exhibits significant loss of osteoblast viability 28. Vitamin E (α‐tocopherol) reduces tumour cell growth and viability as a result of its antioxidant activity 29.
Regarding biphasic effects of CQ extract on cell proliferation, we composed the data using a kinetic model and suggest that at lower concentrations of CQ extract, growth and percentage cell viability followed zero‐order kinetics. This means that growth was independent of concentration of cells present at any particular time. At higher concentrations >50 μg/ml, initial growth was observed, followed by a gradual decrease in cell viability. This indicated that decay followed first‐order kinetics depending on the concentration of the cells. Similar kinetic models have been seen earlier in proliferation and apoptosis of mast cells 30. Viability of lymphocytes has also been examined on activated carbon fibre/carbon nanofibre (ACFs/CNFs) where exponential decay curve followed first‐order kinetics 31. The kinetic model in our study also proved that the effect of CQ extract on cell viability depended upon dose, time and number of cells present (Table 2). Morphological data showed elongated and fusiform appearance of osteoblasts at lower concentrations (10–50 μg/ml) of CQ treatment suggesting its osteogenic activity, while spherical shapes with loss of membrane integrity at higher concentrations (75–100 μg/ml) showed its anti‐proliferative activity.
Moreover, ALP data clearly illustrated that lower concentrations of CQ extract not only stimulated proliferation but also induced differentiation of osteoblasts at all time points tested. Increase in ALP activity could be explained by the CQ extract possessing vitamin C (an antioxidant) initiating collagenous extracellular matrix formation 32. CQ and vitamin C both stimulate fracture healing, but the healing effect of CQ has been found to be faster than vitamin C 33. It appears to be a cooperative effect of other antioxidants such as phytoestrogens and polyphenolic compounds present in CQ extract. One recent study has reported that glycerolipids and squalene present in CQ extract stimulate ALP activity 7. On the other hand, decreased cell viability and ALP activity here, were observed at higher CQ concentrations (Fig. 2). In agreement with previous reports, our study also indicated that higher concentrations of CQ extract decreased osteoblast proliferation over longer exposure, suggesting that higher concentration probably reduced bone formation by reducing osteoblast differentiation, accompanied by cell proliferation 14, 15. Mineralized nodule formation is a characteristic feature of late‐stage osteoblastic differentiation 28. The mineralization data also support our findings that lower concentrations of CQ extract induce mineralization in osteoblasts at 21 days exposure (Fig. 4). A number of studies have reported concentration‐ and time‐dependent effects of Cajanus cajan and Tinospora cordifolia extract on proliferation, osteogenic differentiation and mineralization of osteoblast model systems in vitro 34, 35. Interestingly, our study also showed that effects of CQ extract on proliferation and differentiation of osteoblasts are both concentration‐ and time‐dependent.
Runx2 is a non‐collagenous, highly conserved transcription factor involved in regulation of mineralized matrix of bone. Our study suggests that low concentrations of CQ extract induced Runx2 expression, but higher concentrations reduced it (Fig. 6). Runx2 binds to osteoblast‐specific cis‐acting elements found in the promoter region of several osteoblast marker genes in osteoblasts and induces expression of osteocalcin, collagen type I alpha 1 (Col1α1), bone sialoprotein (BSP), ALP, and regulates their expression 36. Some study has reported that the flavonoid including quercetin and β‐sitosterol present in CQ extract increased transcriptional activity of Runx2 and hence induced ALP mRNA expression, collagen mRNA, and their protein levels 37, 38. In addition to matrix mineralization, Runx2 activity is functionally linked to mechanisms of the cell cycle that control proliferation and differentiation of osteoblasts 39. In a recent study, bovine collagen peptide compounds stimulated MC3T3‐E1 cell proliferation by promoting DNA synthesis in S phase of cell cycle, which led to increase in osteoblast differentiation by up‐regulating level of Runx2 expression 40. Interestingly, our study also supported results that lower concentrations of CQ extract induced cell cycle arrest at S phase, promoting cell proliferation and increasing Runx2 expression level and vice versa.
ROS also play a crucial role in cell proliferation and cell cycle progression 17, 18. Hence, we attempted to clarify cellular mechanisms modulating osteogenic effects of CQ extract, by employing ROS modulation and cell cycle progression in osteoblasts. Our data demonstrated that lower concentrations of CQ extract inhibited ROS generation and consequently, lead to encourage cell proliferation and differentiation via promoting cell cycle progression in S phase (Fig. 5). These findings support reports that low levels of ROS play a pivotal role in regulating several key physiological mechanisms, including cell proliferation, cell differentiation, apoptosis, cell cycle regulation and various signal transduction pathways such as the mitogen‐activated protein kinase (MAPK) pathway 41, 42. On the other hand, higher concentrations tended to induce excessive production of ROS, indicating that higher concentrations suppress its own promoting effect in S phase of the cell cycle, and lead to loss of cell function by inducing an apoptotic pathway (Fig. 3). One previous in vitro study agrees with our results that quercetin, a flavonoid, induced cytochrome‐c release and ROS accumulation to promote apoptosis and arrest the cell cycle in G2/M in HeLa cervical carcinoma cells 43. Antioxidants present in CQ extract at higher doses are relatively greater, thereby resulting in enhanced cytotoxicity.
Briefly, data on cell viability, ALP activity, DNA content, mineralization and Runx2 level of osteoblasts, revealed a biphasic pattern, increasing bioactivity at lower but decreasing at higher concentrations of CQ extract. In contrast, data of ROS generation and apoptosis show its reverse effect. Similar biphasic effects have also been reported on bone cells from various other plant extracts 44. Although no definitive explanation for such effect is available, our study demonstrated that these biphasic effects seem to be due to presence of more phytoconstituents (flavonoids, polyphenols) at higher concentrations resulting in inhibitory/cytotoxicity counteracting stimulatory effects of the extract when used at lower concentrations. In general, flavonoids are phenolic and pro‐oxidant or antioxidant activity intimately depends on pH and concentration 45. At low concentration, they act as antioxidants but at higher concentration they can generate free radicals and be pro‐oxidants. Interestingly, one study has shown that quercetin had antioxidant activity at low doses (0.1–20 μm), while higher concentrations (>50 μm) reduced cell survival and viability 46.
In conclusion, for the first time, the present study provided corroborative evidence that CQ extract showed biphasic effects – osteogenic and cytotoxic, by employing ROS modulation, cell cycle kinetics and Runx2 gene expression in primary osteoblasts. These analytical studies have been established to determine dose of CQ extract and time, will contribute notably to quality control of the extract for further assessment of pre‐clinical efficacy and safety studies of CQ extract in bone healing and cancer treatments.
Conflict of interest
Authors have no conflicts of interest.
Acknowledgements
The authors acknowledge support from University Grant Commission (UGC), New Delhi (No. 37/436‐2009 SR) in the form of a research grant. We express our thanks to Advanced Instrumentation Research Facility (JNU, New Delhi) for the GC‐MS analysis and to Mr. A.L. Vishwakarma, SAIF‐Division, CSIR‐CDRI for technical assistance for flow cytometry. Authors Sahabjada Siddiqui and Madu Gupta are thankful to Indian Council of Medical Research (ICMR) and Council of Scientific and Industrial Research (CSIR), New Delhi, India for the award of Senior Research Fellowship (No. 45/26/2013/BMS/TRM) and (No. 09/107(0350)/2010 EMRI) respectively.
References
- 1. Kling JM, Clarke BL, Sandhu NP (2014) Osteoporosis prevention, screening, and treatment: a review. J. Womens Health (Larchmt) 23, 563–572. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Roy M, Mukherjee A, Sarkar R, Mukherjee S, Biswas J (2014) In search of natural remediation for cervical cancer. Anticancer Agents Med. Chem. 15, 57–65. [DOI] [PubMed] [Google Scholar]
- 3. Dixit P, Chand K, Khan MP, Siddiqui JA, Tewari D, Ngueguim FT et al (2012) Phytoceramides and acylated phytosterol glucosides from Pterospermum acerifolium Willd. seed coat and their osteogenic activity. Phytochemistry 81, 117–125. [DOI] [PubMed] [Google Scholar]
- 4. Mohammad S, Pal US, Pradhan R, Singh N (2014) Herbal remedies for mandibular fracture healing. Natl. J. Maxillofac. Surg. 5, 35–38. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Tayade AB, Dhar P, Kumar J, Sharma M, Chauhan RS, Chaurasia OP et al (2013) Chemometric profile of root extracts of Rhodiola imbricata Edgew. with hyphenated gas chromatography mass spectrometric technique. PLoS ONE 8, e52797. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Singh G, Rawat P, Maurya R (2007) Constituents of Cissus quadrangularis . Nat. Prod. Res. 21, 522–528. [DOI] [PubMed] [Google Scholar]
- 7. Pathomwichaiwat T, Ochareon P, Soonthornchareonnon N, Ali Z, Khan IA, Prathanturarug S (2015) Alkaline phosphatase activity‐guided isolation of active compounds and new dammarane‐type triterpenes from Cissus quadrangularis hexane extract. J. Ethnopharmacol. 160, 52–60. [DOI] [PubMed] [Google Scholar]
- 8. Shirwaikar A, Khan S, Malini S (2003) Antiosteoporotic effect of ethanol extract of Cissus quadrangularis Linn. on ovariectomized rat. J. Ethnopharmacol. 89, 245–250. [DOI] [PubMed] [Google Scholar]
- 9. Potu BK, Nampurath GK, Rao MS, Bhat KM (2011) Effect of Cissus quadrangularis Linn on the development of osteopenia induced by ovariectomy in rats. Clin. Ter. 62, 307–312. [PubMed] [Google Scholar]
- 10. Singh V, Singh N, Pal US, Dhasmana S, Mohammad S, Singh N (2011) Clinical evaluation of Cissus quadrangularis and Moringa oleifera and osteoseal as osteogenic agents in mandibular fracture. Natl. J. Maxillofac. Surg. 2, 132–136. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Lekshmi RK, Divya BT, Mini S (2014) Cissus quadrangularis extract attenuates hyperglycaemia‐mediated oxidative stress in streptozotocin‐induced diabetic rats. Redox Rep. 19, 214–220. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Panthong A, Supraditaporn W, Kanjanapothi D, Taesotikul T, Reutrakul V (2007) Analgesic, anti‐inflammatory and venotonic effects of Cissus quadrangularis Linn. J. Ethnopharmacol. 110, 264–270. [DOI] [PubMed] [Google Scholar]
- 13. Yamaguchi A, Komori T, Suda T (2000) Regulation of osteoblast differentiation mediated by bone morphogenetic proteins, hedgehogs, and Cbfa1. Endocr. Rev. 21, 393–411. [DOI] [PubMed] [Google Scholar]
- 14. Parisuthiman D, Singhatanadgit W, Dechatiwongse T, Koontongkaew S (2009) Cissus quadrangularis extract enhances biomineralization through up‐regulation of MAPK‐dependent alkaline phosphatase activity in osteoblasts. In Vitro Cell. Dev. Biol. Anim. 45, 194–200. [DOI] [PubMed] [Google Scholar]
- 15. Muthusami S, Senthilkumar K, Vignesh C, Ilangovan R, Stanley J, Selvamurugan N et al (2011) Effects of Cissus quadrangularis on the proliferation, differentiation and matrix mineralization of human osteoblast like SaOS‐2 cells. J. Cell. Bioch. 112, 1035–1045. [DOI] [PubMed] [Google Scholar]
- 16. Bhujade A, Gupta G, Talmale S, Das SK, Patil MB (2013) Induction of apoptosis in A431 skin cancer cells by Cissus quadrangularis Linn stem extract by altering Bax‐Bcl‐2 ratio, release of cytochrome c from mitochondria and PARP cleavage. Food. Funct. 4, 338–346. [DOI] [PubMed] [Google Scholar]
- 17. Boonstra J, Post JA (2004) Molecular events associated with reactive oxygen species and cell cycle progression in mammalian cells. Gene 337, 1–13. [DOI] [PubMed] [Google Scholar]
- 18. Verbon EH, Post JA, Boonstra J (2012) The influence of reactive oxygen species on cell cycle progression in mammalian cells. Gene 511, 1–6. [DOI] [PubMed] [Google Scholar]
- 19. Faucheux C, Verron E, Soueidan A, Josse S, Arshad MD, Janvier P et al (2009) Controlled release of bisphosphonate from a calcium phosphate biomaterial inhibits osteoclastic resorption in vitro. J. Biomed. Mater. Res. A 89, 46–56. [DOI] [PubMed] [Google Scholar]
- 20. Siddiqui S, Arshad M (2014) Osteogenic potential of Punica granatum through matrix mineralization, cell cycle progression and runx2 gene expression in primary rat osteoblasts. Daru 22, 72. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Arshad M, Sengupta S, Sharma S, Ghosh R, Sawlani V, Singh MM (2004) In vitro anti‐resorptive activity and prevention of ovariectomy‐induced osteoporosis in female Sprague‐Dawley rats by ormeloxifene, a selective estrogen receptor modulator. J. Steroid Biochem. Mol. Biol. 91, 67–78. [DOI] [PubMed] [Google Scholar]
- 22. Ahamad MS, Siddiqui S, Jafri A, Ahmad S, Afzal M, Arshad M (2014) Induction of apoptosis and antiproliferative activity of naringenin in human epidermoid carcinoma cell through ROS generation and cell cycle arrest. PLoS ONE 9, e110003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Tewari‐Singh N, Jain AK, Inturi S, Agarwal C, White CW, Agarwal R (2012) Silibinin attenuates sulfur mustard analog‐induced skin injury by targeting multiple pathways connecting oxidative stress and inflammation. PLoS ONE 9, e46149. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Aleryani SL, Cluette‐Brown JE, Khan ZA, Hasaba H, Lopez de Heredia L, Laposata M (2005) Fatty acid methyl esters are detectable in the plasma and their presence correlates with liver dysfunction. Clin. Chim. Acta 359, 141–149. [DOI] [PubMed] [Google Scholar]
- 25. Aparna V, Dileep KV, Mandal PK, Karthe P, Sadasivan C, Haridas M (2012) Anti‐inflammatory property of n‐hexadecanoic acid: structural evidence and kinetic assessment. Chem. Biol. Drug Des. 80, 434–439. [DOI] [PubMed] [Google Scholar]
- 26. Kumar M, Rawat P, Dixit P, Mishra D, Gautam AK, Pandey R et al (2010) Anti‐osteoporotic constituents from Indian medicinal plants. Phytomedicine 13, 993–999. [DOI] [PubMed] [Google Scholar]
- 27. Murthy KNC, Vanitha A, Mahadeva Swamy M, Ravishankar GA (2003) Antioxidant and antimicrobial activity of Cissus quadrangularis L. J. Med. Food 6, 99–105. [DOI] [PubMed] [Google Scholar]
- 28. Omeje EO, Khan MP, Osadebe PO, Tewari D, Khan MF, Dev K et al (2014) Analysis of constituents of the eastern Nigeria mistletoe, Loranthus micranthus linn revealed presence of new classes of osteogenic compounds. J. Ethnopharmacol. 151, 643–651. [DOI] [PubMed] [Google Scholar]
- 29. Sylvester PW (2007) Vitamin E and apoptosis. Vitam. Horm. 76, 329–356. [DOI] [PubMed] [Google Scholar]
- 30. Yee NS, Paek I, Besmer P (1994) Role of kit‐ligand in proliferation and suppression of apoptosis in mast cells: basis for radiosensitivity of white spotting and steel mutant mice. J. Exp. Med. 179, 1777–1787. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Ashfaq M, Singh S, Sharma A, Verma N (2013) Cytotoxic evaluation of the hierarchal web of carbon micro‐nanofibers. Ind. Eng. Chem. Res. 52, 4672–4682. [Google Scholar]
- 32. Franceschi RT, Iyer BS, Cui Y (1994) Effects of ascorbic acid on collagen matrix formation and osteoblast differentiation in murine MC3T3‐E1 cells. J. Bone Min. Res. 9, 843–854. [DOI] [PubMed] [Google Scholar]
- 33. Udupa KN, Arnikar HJ, Singh LM (1961) Experimental studies of the use of Cissus quadrangularis in healing of fractures. II. Indian J. Med. Sci. 15, 551–557. [PubMed] [Google Scholar]
- 34. Jinchao Z, Cuilan B, Xiaoyu J, Shigang S, Mengsu Y, Shuxiang W (2009) Effects of water extract of Cajanus cajan leaves on differentiation and function of primary osteoblasts and osteoclasts in vitro. Pharm. Biol. 47, 841–846. [Google Scholar]
- 35. Abiramasundari G, Sumalatha KR, Sreepriya M (2012) Effects of Tinospora cordifolia (Menispermaceae) on the proliferation, osteogenic differentiation and mineralization of osteoblast model systems in vitro. J. Ethnopharmacol. 141, 474–480. [DOI] [PubMed] [Google Scholar]
- 36. Ducy P, Starbuck M, Priemel M, Shen J, Pinero G, Geoffroy V et al (1999) A Cbfa1‐dependent genetic pathway controls bone formation beyond embryonic development. Genes Dev. 13, 1025–1036. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37. Chen CH, Ho ML, Chang JK, Hung SH, Wang GJ (2005) Green tea catechin enhances osteogenesis in a bone marrow mesenchymal stem cell line. Osteoporos. Int. 16, 2039–2045. [DOI] [PubMed] [Google Scholar]
- 38. Qian G, Zhang X, Lu L, Wu X, Li S, Meng J (2006) Regulation of Cbfa1 expression by total flavonoids of Herba epimedii. Endocr. J. 53, 87–94. [DOI] [PubMed] [Google Scholar]
- 39. Galindo M, Pratap J, Young DW, Hovhannisyan H, Im HJ, Choi JY et al (2005) The bone‐specific expression of Runx2 oscillates during the cell cycle to support a G1‐related antiproliferative function in osteoblasts. J. Biol. Chem. 280, 20274–20285. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40. Liu J, Zhang B, Song S, Ma M, Si S, Wang Y et al (2014) Bovine collagen peptides compounds promote the proliferation and differentiation of MC3T3‐E1 pre‐osteoblasts. PLoS ONE 9, e99920. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41. Curtin JF, Donovan M, Cotter TG (2002) Regulation and measurement of oxidative stress in apoptosis. J. Immunol. Methods 265, 49–72. [DOI] [PubMed] [Google Scholar]
- 42. Weydert CJ, Cullen JJ (2010) Measurement of superoxide dismutase, catalase, and glutathione peroxidase in cultured cells and tissue. Nat. Protoc. 5, 51–66. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43. Bishayee K, Ghosh S, Mukherjee A, Sadhukhan R, Mondal J, Khuda‐Bukhsh AR (2013) Quercetin induces cytochrome‐c release and ROS accumulation to promote apoptosis and arrest the cell cycle in G2/M, in cervical carcinoma: signal cascade and drug‐DNA interaction. Cell Prolif. 46, 153–163. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44. Ososki AL, Kennelly EJ (2003) Phytoestrogens: a review of the present state of research. Phytother. Res. 17, 845–869. [DOI] [PubMed] [Google Scholar]
- 45. Bouayed J, Bohn T (2010) Exogenous antioxidants ‐ Double‐edged swords in cellular redox state: health beneficial effects at physiologic doses versus deleterious effects at high doses. Oxid. Med. Cell. Longev. 3, 228–237. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46. Robaszkiewicz A, Balcerczyk A, Bartosz G (2007) Antioxidative and prooxidative effects of quercetin on A549 cells. Cell Biol. Int. 31, 1245–1250. [DOI] [PubMed] [Google Scholar]
