Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2020 Aug 1.
Published in final edited form as: Cell Microbiol. 2019 May 9;21(8):e13032. doi: 10.1111/cmi.13032

Disulfide bond of Mycoplasma pneumoniae community acquired respiratory distress syndrome toxin is essential to maintain the ADP-ribosylating and vacuolating activities

Sowmya Balasubramanian 1,#, Lavanya Pandranki 1,#, Suzanna Maupin 1,#, Kumaraguruparan Ramasamy 1, Alexander B Taylor 2,3, P John Hart 2,3, Joel B Baseman 1, T R Kannan 1,*
PMCID: PMC6612593  NIHMSID: NIHMS1526761  PMID: 30977272

SUMMARY

Mycoplasma pneumoniae is the leading cause of bacterial community acquired pneumonia among hospitalized children in United States and worldwide. Community acquired respiratory distress syndrome (CARDS) toxin is a key virulence determinant of M. pneumoniae. The N-terminus of CARDS toxin exhibits ADP-ribosyltransferase (ADPRT) activity, and the C-terminus possesses binding and vacuolating activities. Thiol-trapping experiments of wild-type (WT) and cysteine-to-serine mutated CARDS toxins with alkylating agents identified disulfide bond formation at the amino terminal cysteine residues C230 and C247. Compared to WT and other mutant toxins, C247S was unstable and unusable for comparative studies. Although there were no significant variations in binding, entry and retrograde trafficking patterns of WT and mutated toxins, C230S did not elicit vacuole formation in intoxicated cells. In addition, the ADPRT domain of C230S was more sensitive to all tested proteases when compared to WT toxin. Despite its in vitro ADPRT activity, the reduction of C230S CARDS toxin-mediated ADPRT activity-associated IL-1β production in U937 cells, and the recovery of vacuolating activity in the protease-released carboxy region of C230S indicated that the disulfide bond was not only essential to maintain the conformational stability of CARDS toxin but also to properly execute its cytopathic effects.

Keywords: Disulfide bond, CARDS toxin, ADP-ribosylation, Vacuolation, Mycoplasma

1. INTRODUCTION

Mycoplasma pneumoniae is an atypical bacterial pathogen that causes a wide spectrum of airway diseases in humans, including community-acquired pneumonia, pharyngitis and tracheobronchitis (Baseman et al., 1996, Waites et al., 2004, Atkinson et al., 2014). Persistent M. pneumoniae infection also causes reactive airway pathologies, including asthma and chronic obstructive pulmonary disease (Biscardi et al., 2004, Nisar et al., 2007, Yeh et al., 2016).Current studies revealed that M. pneumoniae airway infection is the leading cause of bacterial-associated community acquired pneumonia in the US, especially among children (Jain et al., 2015a, Jain et al., 2015b). Apart from respiratory tract infections, M. pneumoniae is frequently associated with extrapulmonary manifestations including hematopoietic, exanthematic, joint, central nervous system, liver, pancreas, and cardiovascular syndromes (Narita, 2016). Despite the wide range of clinical manifestations, the mechanisms by which mycoplasmas mediate host cell injury is still obscure. In our search to uncover virulence determinants of M. pneumoniae, we identified a surfactant protein-A binding protein with ADP-ribosyl transferase (ADPRT) and vacuolating activities, which we designated community acquired respiratory distress syndrome (CARDS) toxin (Kannan et al., 2005, Kannan et al., 2006).

CARDS toxin is a 68 kDa protein that is expressed in high amounts during M. pneumoniae infection and localizes to the airway of infected animals and humans (Kannan et al., 2010, Techasaensiri et al., 2010, Kannan et al., 2011, Muir et al., 2011, Peters et al., 2011, Kannan et al., 2012, Maselli et al., 2018). In non-human primates and murine models, a single exposure of purified CARDS toxin in the airway recapitulates the inflammation and pathologies associated with M. pneumoniae infection (Hardy et al., 2009, Maselli et al., 2018). Three dimensional structures of CARDS toxin revealed the presence of three distinct domains (Becker et al., 2015). The N-terminal region or domain1, which is homologous to the pertussis toxin S1 subunit (PTX) from Bordetella pertussis, includes the catalytic ADP-ribosylating region (Kannan et al., 2005, Kannan et al., 2014, Becker et al., 2015). The C-terminal region of CARDS toxin (domains 2 and 3) contains the cell receptor binding and vacuolating activities (Kannan et al., 2014). The triggering of the ADPRT activity in human cell lysates requires the presence of reducing agents like dithiothreitol (DTT) and strongly hints that reduction of disulfide bonds is a crucial step in activation of CARDS toxin (Kannan et al., 2006). In vulnerable target cells, CARDS toxin traffics along the retrograde pathway utilizing a unique KELED amino acid sequence that mediates translocation of CARDS toxin to the endoplasmic reticulum (ER) followed by activation of ADPRT and vacuolating activities (Ramasamy et al., 2018).

Many bacterial toxins use disulfide bonds to stabilize their domains in proper conformation (Collier et al., 1971, de Paiva et al., 1993, Falnes et al., 1994). However, upon host entry, these same bonds are broken to allow toxin disassembly and activation, enabling the catalytic domain to induce cytotoxicity. As in the case of diphtheria toxin, the endosomal breach and translocation of the catalytic ADPRT domain to the cytosol are facilitated by the reduction of the disulfide bond that links the catalytic domain and cell binding domain together (Falnes et al., 1994). The catalytic domains of other ADPRT toxins including cholera toxin, pertussis toxin and Pseudomonas aeruginosa exotoxin A are all stabilized by disulfide bonds (Mekalanos et al., 1979, Moss et al., 1983, Ogata et al., 1990). In mammalian cells, disruption of disulfide bonds by ER redox factors is functionally related to the translocation of proteins from the ER to the cytosol via ER-associated degradation. Toxins that follow the retrograde pathway hijack ER redox factors to gain entry into the cytosol from the ER and execute their cytopathic effects (Tsai et al., 2001, Tsai et al.,2002).

To answer questions regarding the role of disulfide bonds in influencing structural and functional properties of CARDS toxin, we generated cysteine mutants of CARDS toxin and tested them for their altered properties relative to WT toxin. Our results identified the key cysteine residues of CARDS toxin involved in intramolecular disulfide bond formation and determined their essential role in toxin binding, intracellular transport, stability and toxin-associated cytotoxicity.

2. RESULTS

2.1. CARDS Toxin Forms an Intramolecular Disulfide Bond

CARDS toxin has six cysteine residues located at positions 230, 247, 324, 406, 425 and 548 (Fig 1A). Using purified recombinant CARDS toxin, we performed thiol trapping assays to assess the presence and absence of disulfide bond formation. AMS (4-acetamido-4’-maleimidylstilbene- 2,2’-disulfonate) alkylates free thiol groups and increases the molecular mass of proteins by 490 daltons (Fig 1B). AMS-treated non-reduced CARDS toxin (Fig 1C, first panel, lane 2) migrated significantly slower than untreated WT CARDS toxin (Fig 1C, first panel, lane 1), indicating the presence of cysteine residues with free thiol groups in non-reduced CARDS toxin. AMS-treated ‘reduced’ [DTT pretreated] CARDS toxin migrated slower (Fig 1C, first panel, lane 3) than AMS-treated ‘non-reduced’ CARDS toxin (Fig 1C, first panel, lane 2), further indicating the existence of a disulfide bond in non-reduced CARDS toxin.

Figure 1. Disulfide bond formation in CARDS toxin.

Figure 1.

Open in a new tab

A) Diagrammatic representation of the domains and distribution of cysteine residues within CARDS toxin. All three domains (D1, D2 and D3) of CARDS toxin are color coded to match the tertiary structure (refer Fig 2D). B) Schematic representation of the reduction of disulfide bonds by DTT and alkylation of free cysteine thiol groups with 4-acetamido-4′-maleimidylstilbene-2, 2′-disulfonic acid (AMS). C) Examination of disulfide bond formation in CARDS toxin by AMS modification. Panel 1. Purified recombinant CARDS toxin (rCARDS; lane 1; 68 kDa) or rCARDS collected after AMS treatment under non-reducing (lane 2; 70 kDa) or reducing (lane 3; 71 kDa) conditions were separated without boiling by 4–12% Nu-PAGE in the absence of any reducing agent and transferred to nitrocellulose membranes. The membranes were immunoblotted with anti-CARDS toxin antibodies. Panel 2. TCA precipitated M. pneumoniae (Mp) cells were analyzed as in panel 1 for native CARDS toxin disulfide bond formation. Panel 3. TCA precipitated rCARDS expressing E. coli (Ec) cells were examined for disulfide bond formation as in panel 1.

For in vivo analysis of the presence of disulfide bonds in native CARDS toxin, mid-log phase M. pneumoniae cells were treated with 5% trichloroacetic acid (TCA) to denature cellular proteins and maintain CARDS toxin sulfhydryl groups in their oxidized or reduced states (Fig 1C, second panel). Similarly, mid-log phase aerobic cultures of Escherichia coli-expressing recombinant CARDS toxin were treated with TCA. Precipitated denatured proteins were then exposed to AMS and analyzed by immunoblot for CARDS toxin gel migration as indicated in Experimental Procedures. Indeed, the migration patterns of CARDS toxin in AMS-treated M. pneumoniae (Fig 1C, second panel) or E. coli (Fig 1C, third panel) cells after lysis showed electrophoretic patterns identical to those observed with purified preparations of AMS-treated, non-reduced and reduced CARDS toxin. These thiol trapping experiments clearly demonstrate that CARDS toxin forms an intramolecular disulfide bond and that the disulfide bond is present in M. pneumoniae-associated native CARDS toxin and in E. coli-expressed and -purified recombinant CARDS toxins.

2.2. Disulfide Bond Formation Occurs between Residues C230 and C247

To identify the cysteine residues involved in disulfide bond formation as well as to address the functional importance of the disulfide bond in CARDS toxin activity, we generated all six cysteine to serine (C→S) mutant constructs and expressed these proteins in E. coli. As seen by immunoblot, the AMS-treated ‘reduced’ cell extracts of E. coli expressing C230S and C247S CARDS toxin proteins showed electrophoretic patterns identical to the AMS-treated ‘non-reduced’ cell extracts (Fig 2A). In contrast, the AMS-treated cell extracts of the remaining four C→S mutants (C324S, C406S, C425S and C548S) exhibited slower migration patterns of CARDS toxin in the reduced state, like wild-type (WT) CARDS toxin (Fig 2A). The identical migration patterns of reduced and non-reduced C230S and C247S mutant toxins upon AMS treatment indicate disulfide bond formation between C230 and C247.

Figure 2. Determining redox states of CARDS toxin.

Figure 2.

Open in a new tab

A) Examination of disulfide bond formation in WT and C→S mutant CARDS toxins. E. coli strains expressing WT and C→S mutant CARDS toxins were grown and induced with 1mM IPTG. TCA precipitated bacterial cultures were analyzed for the redox states of CARDS toxin upon AMS modification as indicated in Experimental Procedures. B) Determining free cysteines of CARDS toxin. E. coli strains expressing wild-type (WT) or C→S mutant CARDS toxins were treated directly with TCA (5%) and protein precipitates were treated with 4mM mal-PEG, separated by 4–12% Nu-PAGE without any reducing agent and transferred on to nitrocellulose membrane and probed with anti-rabbit full length CARDS toxin antibody. The increase in size in C230S and C247S indicates the disruption of a disulfide bond in the absence of one another. The available free Cys reacts with mal-PEG (5 kDa) as indicated in the schematic diagram depicted below. C) Analysis of disulfide bond formation in WT and C230S CARDS toxins. Redox states of WT and C230S CARDS toxins were analyzed upon mal-PEG modification as indicated in Experimental Procedures. D) Cysteine residues highlighted in the CARDS toxin tertiary structure. CARDS toxin folds into three domains arranged in the shape of an isosceles triangle (PDB ID codes 4TLV and 4TLW). The N-terminal ADPRT domain (domain 1 - green) associates with tandem C-terminal β-trefoil subdomains (D2 – blue and D3 - magenta). Within domain 1, the disulfide bond formed between Cys residues 230 and 247 (shown as bonded yellow spheres) stabilizes an α-helix (orange) formed by residues 225–230 that occupies the predicted NAD+-binding site. The four additional Cys residues in the CARDS structure are shown as single yellow spheres.

To further confirm the specificity of disulfide bond formation between C230 and C247, E. coli cell extracts expressing WT and C→S mutants were treated with maleimide polyethylene glycol (mal-PEG; 5 kDa) and analyzed as indicated in Experimental Procedures. After the disturbance of disulfide bonds in both C230S and C247S, the mal-PEG reacted with all five cysteine residues (93 kDa). Note that in WT extracts, mal-PEG reacted only with the freely available four cysteine residues (88 kDa). All the carboxy C→S mutants showed similar faster migration patterns upon mal-PEG binding due to the availability of only three free cysteine residues (83 kDa; Fig 2B).In addition, the mal-PEG-treated ‘reduced’ cell extracts of E. coli expressing WT CARDS toxin protein exhibited slower migration patterns (98 kDa; Fig 2C) than mal-PEG-treated ‘non-reduced’ cell extracts (88 kDa; Figs 2B & C) confirming the presence of a disulfide bond in non-reduced CARDS toxin. In contrast, the mal-PEG-treated ‘reduced or non-reduced’ cell extracts of E. coli expressing C230S CARDS toxin protein showed identical migration pattern upon electrophoresis (Fig 2C; 93 kDa) reinforcing the role of C230 in disulfide bond formation.

Further, analysis of the X-ray crystal structure of CARDS toxin using the Protein Data Bank (PDB ID codes 4TLV and 4TLW) showed an exposed disulfide bond between the two cysteine residues at positions 230 and 247 (Fig 2D). Interestingly, this indicates that within domain-1, the active site R-STS-E signature motif (R10, S49, T50, S51 and E132) responsible for the ADPRT activity (Domenighini et al., 1996) is physically blocked by downstream residues 206–256, comparable to a structurally similar region in pertussis toxin (Stein et al., 1994). An α-helix formed by residues 225–230 occupies the NAD+-binding site and is stabilized in this position by the disulfide bond which tethers its C-terminal C230 (Fig 2D).

2.3. Mutated CARDS Toxins Lacking the Disulfide Bond Inhibit Vacuolating Activity but not ADPRT activity

For functional studies, all expressed C→S mutant toxins were purified and analyzed for their homogeneity (Fig 3A). Like WT-CARDS toxin, purified mutant toxins migrated at the same position on Nu-PAGE gels. However, C247S was partially degraded under the same conditions (Fig 3A). To test whether the disulfide bond is required for toxin activation, intact cells or cell lysates were incubated with various concentrations of WT and mutant toxins and analyzed for vacuolating and ADPRT activities. Like WT, specific C→S mutants (C324S, C406S, C425S and C548S) induced similar vacuole formation within 24h. However, CARDS toxin mutants lacking the disulfide bond (C230S and C247S) did not induce vacuolation even at high concentrations (700 pmol and above) and at longer incubation times (Figs 3B & C). Nevertheless, the mutant toxins ADP ribosylated specific target proteins of sizes 48- to 52-kDa in CHO cells, like WT CARDS toxin; for example, see the autoradiogram for C230S and C425S ADP-ribosylated proteins (Fig 3D). These mammalian cell experiments clearly demonstrated that the absence of the disulfide bond affects the vacuolating activity inside cells but not the ADP-ribosylating activity in total cell lysates.

Figure 3. Effect of mutated CARDS toxin lacking disulfide bond on vacuolating and ADP ribosylating activities.

Figure 3.

Open in a new tab

A) Purification of all six CARDS C→S mutant toxins in recombinant form. Recombinant His-10-tagged proteins were purified using nickel affinity column chromatography as described before (Kannan et al., 2006, Kannan et al., 2014). Proteins were resolved on 4–12% gradient Nu-PAGE gel. B) Effect of CARDS toxin C→S mutation on HeLa cell morphology. Cells were grown to 40–50% monolayer confluence before addition of 700 pmol of wild type (WT) CARDS toxin or C→S mutant toxins (C230S, C247S, C324S, C406S, C425S and C548S) for 24 h. C) Quantification of percentage of HeLa cells with WT or C→S mutant CARDS toxins that induced vacuoles. As indicated in panel B, cells were incubated with CARDS toxin and its derivatives (700 pmol) and the number of vacuolated cells in random fields was calculated as described in Experimental procedures. D) ADP ribosylation of CHO cell-free extracts (CFEs) by WT CARDS toxin and CARDS C→S mutant toxins. CFEs were prepared from confluent CHO cell monolayers and assayed for ADP ribosylation. CFEs were incubated with and without WT CARDS toxin or with the indicated CARDS C→S mutant toxins. Each reaction mixture was precipitated with TCA, proteins were resolved by 4–12% Nu-PAGE, transferred to nitrocellulose membrane, exposed to X-ray films and autoradiographed as shown. The ADP-ribosylated proteins in the range of 48–51 kDa are indicated by arrows.

2.4. Cell Binding and Internalization of CARDS Toxin is not affected by the Disulfide Bond

As C230S and C247S mutant toxins did not induce vacuole formation even after prolonged incubation with mammalian cells (Figs 3B & C), we tested these mutant toxins (C230S and C247S) for their interaction with host cells. As observed in Fig 4A, biotin-labeled C230S binds to and is internalized by HeLa cells as efficiently as WT toxin. Interestingly due to protein degradation, C247S was unable to bind and be internalized. Therefore, purified C247S was no longer used in these studies.

Figure 4. WT and C230S CARDS toxin interaction with HeLa cells.

Figure 4.

Open in a new tab

A) Binding and internalization of biotin-labeled wild type and C230S CARDS toxins. HeLa cells were treated with 140 pmol of biotin-labeled toxins for 1 h at 4°C. After removing unbound toxin by washing, we analyzed binding using horseradish peroxidase-conjugated streptavidin. Cell-bound toxin was measured at 450 nm using ELISA reader as described in Experimental Procedures. To analyze internalization of wild type and C230S CARDS toxin, HeLa cells were treated with 140 pmol of biotin-labeled toxin for 1 h at 4°C, and then incubated at 37°C for 1h after removing unbound toxin by washing. Cells were fixed, and surface-bound biotin was removed with MESNA. Internalized biotin-associated rCARDS toxin was quantified as described in Experimental Procedures. Samples without CARDS toxin served as control. Data are means ± standard deviations of triplicate samples. B) Intracellular transport of CARDS toxin in HeLa cells. HeLa cells were treated with 140 pmol of WT or C230S CARDS toxin for 1 h at 4°C. Then, unbound CARDS toxin was removed by washing, and cells were shifted to 37°C and incubated in fresh medium. At 8h, as indicated in Experimental Procedures, cells were fixed and processed for coimmunofluorescence analysis. ERGIC was labeled using mouse monoclonal anti-ERGIC53 antibody and counterstained by secondary antibody conjugated with AF-488 (green). CARDS toxin was labeled with rabbit anti-CARDS toxin antibody and stained with AF-555 conjugated secondary antibody (red). Nuclei were stained with DAPI (4’,6-diamidino-2-phenylindole; blue). Images were collected sequentially from different channels by immunofluorescence microscopy. The merged images (yellow) showed co-localization of CARDS toxin with ERGIC. C) WT and C230S CARDS toxin reaches ER. C-myc-tagged ER-SNAP-transfected HeLa cells were incubated with Benzylguanine (BG)-labeled WT and C230S CARDS toxin for 16h, lysed and resolved on 4–12% Nu-PAGE. Gels were transferred to nitrocellulose membranes and probed with antibody specific to the c-myc epitope.

2.5. Intracellular Trafficking of CARDS Toxin is not affected by the Disulfide Bond

As there were no significant differences in mammalian cell binding and internalization of WT and C230S toxins, we monitored their intracellular transport to help explain whether the lack of vacuolating activity by C230S was due to dissimilarities in retrograde transport which we recently demonstrated as essential for CARDS toxin-mediated vacuolation (Ramasamy et al., 2018). Co-immunofluorescence analysis (co-IFA) of C230S with ER-Golgi intermediate complex (ERGIC)-53 showed its association with ERGIC (Fig. 4B). Further, the co-localization of all C→S mutants with ERGIC53 indicated that C→S modification did not interfere with retrograde trafficking patterns (Supplementary Fig).

To further explore CARDS toxin trafficking to the ER, we used ER-SNAP-cMyc tag as we recently described (Ramasamy et al., 2018). Incubation of benzylguanine (BG)-coupled WT toxin or C230S with ER-SNAP-cMyc tag-transfected HeLa cells resulted in the formation of complexes between SNAP and WT toxin and SNAP and C230S (c-Myc antibody reactive protein band intensities ≥ 90 kDa; Fig 4C), indicating that C230S transports to ER like WT CARDS toxin. However, when compared to the SNAP-WT-CARDS toxin complexes, the weak intensity of SNAP-C230S complexes and the presence of a ladder of smaller sized c-Myc reactive protein bands (< 90 kDa; Fig 4C; lane 2) in C230S-treated HeLa cells suggested that the disulfide bond plays an essential role in maintaining the stability of CARDS toxin.

2.6. Differential Processing of WT and C230S Toxins

As C230S exhibited substantial differences in vacuole formation (Figs 3B & C) but not in binding, internalization or trafficking properties (Fig 4), we examined whether C230S was stably maintained or processed differently than WT CARDS toxin. Following incubation with HeLa cells, cell-associated WT toxin was cleaved into two fragments within 8h (Fig 5) as detected by immunoblotting. Interestingly, despite the reduced band intensity of full length C230S, there were essentially no detectable processed products, even after 24h (Fig 5) possibly indicating altered sensitivity to host proteases.

Figure 5. Processing of WT and C230S CARDS toxins in HeLa cells.

Figure 5.

Open in a new tab

HeLa cells were treated with 140 pmol of WT and C230S CARDS toxin for 1h, 8h or 24h at 37°C. After the indicated times, cells lysates (5 μg) were separated on 12% SDS-PAGE, transferred to nitrocellulose membrane and probed with anti-rabbit full length CARDS toxin antibody as described in Experimental Procedures. Molecular weight markers are indicated on the left.

2.7. Disulfide Bond Protects ADPRT Domain of CARDS Toxin from Proteases

The differences in the degradation of WT and C230S toxins in mammalian cells could be due to their altered sensitivities to proteolytic enzymes. Therefore, we compared the sensitivity of the WT and C230S toxins to different proteases (trypsin, thermolysin and proteinase K). As internal controls, we screened all other C→S mutants for their sensitivity to these proteases. Earlier, we showed that trypsin cleaves CARDS toxin into two fragments of sizes 37 kDa (1–305) and 33 kDa (308–591) (Pakhomova et al., 2010, Kannan et al., 2014). To examine whether all C→S mutant toxins were cleaved by trypsin as efficiently as WT toxin, we compared their cleavage patterns under the same conditions. As shown in Fig 6A, WT toxin and all mutated toxins including C230S were cleaved by trypsin to the same extent, generating two fragments of sizes 33 and 37 kDa. Interestingly, C→S mutants (C324S, C406S, C425S and C548S), which are not involved in disulfide bond formation, exhibited sensitivities to thermolysin and proteinase K like WT (Fig 6A). In contrast, the disulfide bond-lacking C230S toxin was more sensitive to thermolysin and proteinase K, resulting in complete degradation of full length C230S toxin to a single 37 kDa fragment.

Figure 6. Effect of protease treatment on WT CARDS toxin and CARDS C→S mutant toxins.

Figure 6.

Open in a new tab

A) Sensitivity of WT CARDS toxin and CARDS C→S mutant toxins to different proteases. Purified WT and C→S mutant toxins were treated with carrier buffer (panel 1), trypsin (panel 2), thermolysin (panel 3) or proteinase K (panel 4) for 30 min at room temperature as described in Experimental Procedures. Sample buffer with β-mercaptoethanol and 5 mM PMSF was added, and the samples were boiled. Samples were resolved in 4–12% Nu-PAGE gel and Coomassie brilliant blue stained. The samples used in each lane are indicated above the lanes. Molecular weight markers are indicated on the left. B) Effect of protease treatment on degradation of ADPRT domain of WT CARDS toxin and C230S CARDS toxin. i) Purified WT and C230S mutant toxins were treated with trypsin, thermolysin or proteinase K for 0 minutes. ii-iv) Purified WT and C230S mutant toxin were treated with trypsin (panel 1) thermolysin (panel 2) or proteinase K (panel 3) for different time intervals (15, 30 and 120 minutes corresponding to lanes 1–3). The reactions were stopped as indicated above, and the samples were resolved on 4–12% Nu-PAGE gel and Coomassie stained (i & ii), transferred to nitrocellulose membrane and analyzed by immunoblot using anti-CARDS toxin carboxy (iii) or amino terminal (iv) antibodies. Molecular weight markers are indicated on the right.

To further study the kinetics of protease sensitivity and to confirm the specific toxin fragment protected by the disulfide bond, we treated both WT and C230S with different proteases and analyzed the cleaved products in a time-dependent manner by Nu-PAGE and immunoblotting (Fig 6B). With WT toxin, trypsin digestion released 37 kDa and 33 kDa fragments that were stably maintained even after 120 min incubation whereas, with C230S, the trypsin-released 37 kDa fragment was not stably maintained (Fig 6Bii, panel 1). Despite the longer incubation time (120 min), thermolysin and proteinase K digestion yielded only a partial clipping of WT CARDS toxin. However, by 15 min post-incubation, C230S was completely clipped into a single 37 kDa fragment (Fig 6Bii panels 2 and 3). Parallel immunoblots of protease-clipped WT and C230S CARDS toxin with N-CARDS and C-CARDS toxin antibodies revealed the instability of the amino terminal region. These results strongly suggest that the disulfide bond protects the amino terminal ADPRT domain from degradation (Fig 6B).

2.8. Disulfide Bond is Essential for CARDS Toxin to Execute its Cytotoxicity

As the carboxy region of CARDS toxin is essential for vacuolation (20), the absence of vacuole formation in C230S prompted us to analyze the vacuolating activity of protease-digested C230S. Unlike undigested C230S, trypsin-digested C230S induced vacuole formation like WT CARDS toxin. Thermolysin- and proteinase K-treated C230S also exhibited vacuolating activity (Figs 7A & B) suggesting that differential processing of CARDS toxin in the absence of the disulfide bond either blocks proper release of the toxin or disrupts the stability of CARDS toxin within the cells (Figs 3B & C).

Figure 7. Role of disulfide bond in CARDS toxin cytotoxicity.

Figure 7.

Open in a new tab

A) Effect of proteases-released C-CARDS on vacuole formation of WT CARDS toxin and C230S CARDS toxin. WT and C230S mutant toxin were treated with trypsin, thermolysin and proteinase K and then incubated with HeLa cells as indicated in Experimental Procedures. Vacuole formation in HeLa cells at 24 h is shown. B) Quantification of proteases-treated WT or C230S CARDS toxins induced vacuoles. As indicated in panel A, cells were incubated with protease-treated WT or C230S CARDS toxins and the number of vacuolated cells in random fields was calculated as described in Experimental procedures. C) Differentiated human U937 cells were treated with LPS (1 μg/ml) for 4 h and then with carrier solution (CS) or 700 pmol of WT or C230S CARDS toxin for 48 h, and IL-1β levels in medium supernatants were measured by ELISA. Data represent the mean values ± standard deviations from three independent experiments performed in triplicate. ** P ≤ 0.001.

For retrograde trafficking of bacterial ADPRT toxins, disulfide bonds play essential roles in maintaining toxin function, and their reduction is generally followed by cleavage events that release the ADPRT domain from the ER into the cytosol to function as ADPRTs (Tsai et al., 2001, Tsai et al., 2002). In the case of CARDS toxin, it traffics to the ER (Ramasamy et al., 2018) to execute ADP-ribosylation of NLRP3 which leads to the release of IL-1β (Bose et al., 2014). To further investigate the role of disulfide bonds in CARDS toxin-mediated ADPRT activity, we examined the release of IL-1β in human U937 cells using WT and C230S toxins. Interestingly, despite its in vitro ADPRT activity observed in cell lysates (Fig 3D), C230S induced significantly less IL-1β cytokine release from U937 cells compared to WT (Fig 7C). These results clearly indicate that the disulfide bond is essential to properly execute CARDS toxin-mediated ADPRT and vacuolating activities within target cells.

3. DISCUSSION

CARDS toxin is a key virulence determinant of M. pneumoniae that displays both ADPRT and vacuolating activities (Kannan et al., 2014). Intact CARDS toxin exhibits ADPRT activity only in the presence of reducing agents such as DTT, suggesting that disulfide bonds need to be broken in order to expose the active site (Kannan et al., 2006). To address the role of disulfide bonds in structural and functional properties of CARDS toxin, we modified the cysteine residues of CARDS toxin into serine by site-directed mutagenesis and characterized these mutants for altered properties relative to WT toxin. Of the six cysteine residues associated with CARDS toxin, only the most N-terminal residues (C230 and C247) form an intramolecular disulfide bond. The remaining four cysteines exist in thiol form (Fig 2). Disruption of the C230-C247 cystine bond completely inhibited the vacuolating activity of CARDS toxin in mammalian cell (Figs 3B & C). However, C230S exhibited ADPRT activity similar to WT CARDS toxin in total mammalian cell lysates (Fig 3D) which indicates that the amino acid substitution has not affected ADPRT enzymatic activity. While C230S CARDS toxin showed no differences from WT in binding, internalization and retrograde transport properties in mammalian cells, internalized C230S CARDS toxin was not processed in the same manner as WT CARDS toxin (Figs 4 & 5). Further, when compared to WT toxin, C230S was more susceptible to proteases, leading to complete degradation of its ADPRT domain (Fig 6), suggesting that the mutant toxin adopts a dynamic structure in the absence of the disulfide bond that is more susceptible to proteolysis (Fig 6). In addition, the cystine bond was found to be essential for CARDS toxin to release its ADPRT and vacuolating domains and function as an ADPRT and vacuolating toxin; this is indicated by a decrease in the secretion of proinflammatory cytokine IL-1β in C230S-treated macrophages and by the rescue of its vacuolating activity upon protease digestion (Fig 7). Notably, the disulfide bond is also important for CARDS toxin to perform its C-terminus- associated vacuolating activity.

CARDS toxin is synthesized as a single polypeptide chain with two functionally independent moieties: the N-terminal ADPRT domain (D1) and the C-terminal receptor binding and vacuolating domain (D2 + D3). Among the six cysteine residues, only the cysteines located within the ADPRT domain (C230 and C247) form a disulfide bond. Importantly, as observed in the three-dimensional structure, this disulfide bond forms a solvent-exposed flexible loop between C230 and C247 which appears to contain the cleavage site that relieves the auto-inhibitory block of the NAD+-binding site to release the active ADPRT domain. However, as shown by functional studies in other ADP-ribosylating toxins, reduction of the disulfide bond can itself also relieve the steric blocks of the NAD+-binding pocket, leading to ADP-ribosylating activity, while leaving the C-terminus tethered to the ADPRT domain (Sixma et al., 1991, Sixma et al., 1993). Interestingly, in many bacterial toxins, irrespective of their AB or AB5 nature, they all possess disulfide bonds that maintain the function of the toxin. For example, the A subunit (in most cases, the ADPRT domain) contains in its C-terminal end a disulfide bonded proteasesensitive loop, which is easily cleaved to yield the enzymatically active A1 fragment and the small A2 subunit that is associated with the B subunit (Sixma et al., 1991, Sixma et al., 1993). It is possible that a similar disulfide bridge-dependent processing mechanism may exist within CARDS toxin that favors toxin-mediated cytotoxicity. Despite the disturbance of the disulfide bridge, C230S mutant toxin was able to ADP-ribosylate host cell target proteins in total cell lysates indicating that the lack of disulfide bond had no effect on toxin to execute its ADPRT activity in cell extracts. However, when added to intact macrophages, the internalized C230S was unable to ADP-ribosylate NLRP3 and activate the inflammasome to release the proinflammatory cytokine IL-1β. These results clearly indicate that the disulfide bridge is essential for the release of the active ADPRT domain to act on NLRP3 and activate the inflammasome to release IL-1β (Figs 3D & 7C).

Disturbance of neither C230 nor C247 result in intramolecular disulfide bond as evidenced by the interactions of all five thiol groups of these proteins with mal-PEG (i.e., 93 kDa; Fig 2B). Although the disulfide bridge between C230 and C247 is important, C247 seems to be more significant than C230 for the stability of CARDS toxin (Fig 3A). Previous studies have demonstrated that both disulfides and thiol groups have important roles in the stability of proteins (Burova et al., 1998, Tatara et al., 2005). It is possible that irrespective of its role in disulfide bond formation, the thiol form of C247 may also be essential to maintain the stability of the toxin. However, further structural and biophysical studies are warranted to address the roles of C230 and C247 in maintaining the stability of CARDS toxin.

Since the disruption of the disulfide bond does not influence cell-binding and internalizing activities of CARDS toxin and is not directly involved in vacuole formation (Fig. 3), it is possible that the loss of the intra-chain disulfide bond alters the subsequent trafficking of the toxin or proper processing and/or its stability. To induce cytotoxicity in host cells, bacterial toxins use multiple pathways to reach their intracellular targets. For example, diphtheria toxin reaches the cytosol by passing through early and late endosomes and by translocating across the endosomal membrane in a disulfide bond reduction-dependent cleavage event (Falnes et al., 1994). On the other hand, Shiga toxin (ST), Cholera toxin, and Escherichia coli heat-labile enterotoxin (LT) exploit the complex retrograde transport pathway to reach the endoplasmic reticulum (ER) (Pelham et al., 1992, Sandvig et al., 1992, Lencer et al., 1995). We showed that CARDS toxin uses retrograde transport to reach the ER through Golgi complex by utilizing a distinct KELED motif (Ramasamy et al., 2018). Altering the KELED motif interrupted CARDS toxin retrograde trafficking to ER which in turn blocked ADP-ribosylating and vacuolating activities (Ramasamy et al., 2018). As shown by co-IFA analyses, the co-localization of WT and all C→S mutants including C230S with ERGIC53 indicated that C→S modification did not interfere with the retrograde trafficking patterns. Further, the interaction of BG-labelled WT or C230S CARDS toxin with ER- localized SNAP indicate C230S follows a similar trafficking pattern to the ERGIC and ER as WT CARDS toxin (Figs 4 & 5). However, the presence of a ladder of smaller sized c-Myc reactive protein bands in BG-C230S treated ER-SNAP transfected cells indicated that the disulfide bond is essential to maintain the stability of CARDS toxin.As disulfide bonds play an important role in stabilizing proteins, we analyzed the influence of C230 on CARDS toxin vulnerability to protease processing. We observed that C230S mutant was more susceptible to protease treatments when compared to WT (Fig. 6) and the loss of the disulfide bond led to instability of the N-terminal domain upon protease digestion (Fig 6B). Further, in the absence of the disulfide bond, CARDS toxin was unable to efficiently perform its ADPRT activity inside cells. Hence, it appears that the disulfide bond in CARDS toxin is essential for the conformational stability of the toxin and preservation of its functional activities. This result clearly indicates that the disulfide bond not only maintains the toxin in proper form but also keeps the N-terminal region protected.

The formation of disulfide bonds in proteins regulates the folding and stability needed for the activation of their functional roles (Hogg, 2003). For example, in the Shiga toxin A chain, the disulfide bond appears to be important in stabilizing the toxin subunit after protease cleavage in the endosome or trans Golgi network (Garred et al., 1995, Tam et al., 2007). Also, a disulfide linkage-lacking mutant of Shiga toxin was reported to be more susceptible to degradation by pronase and less cytotoxic to cells (Garred et al., 1997). Likewise, in pertussis toxin, reduction of the disulfide bond alters its conformation and is required for the toxin to exhibit NAD glycohydrolase and ADPRT activities (Moss et al., 1983, Burns et al., 1989). In diphtheria toxin, reduction of the disulfide bond results in the release of active fragment from the endosomes into the cytosol (Falnes et al., 1994, Collier, 2001). In cholera toxin, the disulfide bond needs to be cleaved by disulfide isomerase for the release of the active domain from the rest of the molecule (Tsai et al., 2001, Sandvig et al., 2002, Wernick et al., 2010). In spite of the association of vacuolating activity with the C-terminus, the loss of vacuolating activity in both C230S and C247S mutants indicates that the disulfide bond at the N-terminus (domainl) is also important for proper release and/or activation of the C-terminus (domains 2 and 3) to execute the vacuolating activity (Figs. 3 & 7). As disulfide bonds are important for the stability of many toxins, it is possible that the loss of the cystine bond could alter the stability of CARDS toxin. When there is an intact disulfide bond, cell-associated toxin establishes a conformation such that the portion of the toxin molecule against which the protease acts may be unavailable or protected. It is possible that the disulfide bond of CARDS toxin is cleaved in the retrograde pathway and that the ADP-ribosylating as well as the vacuolating fragments dissociate from the toxin-receptor complex at the ER to intoxicate cells efficiently. Taken together, these data establish the critical role of the disulfide bond in the activation of CARDS toxin and subsequent cytopathological events.

4. EXPERIMENTAL PROCEDURES

4.1. Bacterial strains and mammalian cell culture conditions

Escherichia coli TOPlO (Invitrogen) and E. coli BL21 (DE3) (Stratagene) were grown in Luria-Bertani (LB) broth. HeLa cells (CCL-2) and Chinese hamster ovary (CHO; CCL-61) cells were obtained from the American Type Culture Collection (ATCC) and grown in minimal essential medium (MEM) and F12K medium (ATCC) respectively and supplemented with 10% fetal bovine serum (FBS) (Atlas Biologicals). U937 cells were induced to differentiate by exposing them (3 × 105 cells/ml) to 50 nM of phorbol 12-myristate 13-acetate (PMA) (Sigma) for 24 h. After 24 h, PMA-containing medium was replaced with fresh complete RPMI medium, and cells were maintained for 48 h before treatments. All cell cultures were grown under air-5% CO2 at 37°C. ER-SNAP plasmid was the kind gift of Roger Geiger, Institute for Research in Biomedicine, Bellinzona, Switzerland (Geiger etal., 2013).

4.2. Cloning, site-directed mutagenesis, expression, and purification of cysteine-to-serine (C→S) CARDS toxin mutants

As mycoplasmas use both UGA (universal stop codon) and UGG to encode tryptophan, site-directed mutagenesis was used to replace each UGA codon with UGG to express full-length CARDS toxin (Kannan et al., 2006). This TGA-TGG corrected CARDS toxin DNA was used as a template to amplify the gene fragments. Site-directed mutagenesis of all C→S conversions was achieved by overlap extension PCR as described previously (Ho et al., 1989) using the primers indicated in Table 1. Amplified PCR products were cloned into pCR2.1, which were subsequently digested with Ndel and BamHI and ligated into pET19b. Verification of each construct was achieved by complete DNA sequencing of individual plasmids (Department of Microbiology and Immunology Nucleic Acids Core Facility, University of Texas Health Science Center at San Antonio). Plasmid DNA having the confirmed sequence was isolated and transformed into competent E. coli BL21 (DE3), and recombinant colonies were screened for expression of modified CARDS toxin proteins. Induction of recombinant protein synthesis in E. coli was achieved by the addition of 100 μM isopropyl β-D-1-thiogalactopyranoside (IPTG; Sigma-Aldrich) and bacteria were incubated overnight at 25°C under aeration at 210 rpm. Fusion proteins were purified by nickel affinity column chromatography under native conditions (Qiagen). All recombinant proteins were desalted in appropriate buffer using PD-10 columns (GE Amersham), and protein purity was assessed by Nu-PAGE.

Table 1.

Primers used for the generation of C→S mutants

Name a Primer sequence (5’–3’)b Length (nt)
C230S-FP TCGCTATCGTTTGCGTCGCCTGATTGG 27
C230S-RP CCAATCAGGCGACGCAAACGATAGCGA 27
C247S-FP GGTGAAAATCCGCTAGACAAATCGATTGCG 30
C247S-RP CGCAATCGATTTGTCTAGCGGATTTTCACC 30
C324S-FP CAACGAATTAGTCTCAAGGATTTAACTGGTGC 32
C324S-RP GCACCAGTTAAATCCTTGAGACTAATTCGTTG 32
C406S-FP CACGATTTGTATGTAAGTCCTTTGAAAAATCCACC 35
C406S-RP GGTGGATTTTTCAAAGGACTTACATACAAATCGTG 35
C425S-FP ATAATTGTTGATGAATCGACTACCCATGCGCAG 33
C425S-RP CTGCGCATGGGTAGTCGATTCATCAACAATTAT 33
C548S-FP CGCCACATTCGCAGTTACGCTGAC 24
C548S-RP GTCAGCGTAACTGCGAATGTGGCG 24
Open in a new tab
a

FP-Forward primer; RP-reverse primer.

b

In the given primer sequences, the cysteine to serine changed codons are shown in bold.

4.3. Determining redox states of CARDS toxin

Redox states of CARDS toxin were assessed by the free SH groups that were alkylated by 4-acetamido-4’-maleimidylstibene-2’,2’-disulfonic acid (AMS) (Vestweber et al., 1988). For in vitro modification of free thiol groups, freshly purified CARDS toxin was precipitated by the addition of trichloroacetic acid (TCA) to 5% to fix its redox state. All protein precipitates were collected by centrifugation and washed with acetone, and the samples to be reduced were dissolved in freshly prepared solution containing 10 mM Tris-HCl (pH 8.0) with 100 μM DTT for 30 min and TCA precipitated. Both reduced and non-reduced precipitants were then dissolved in 100 mM Tris-HCl (pH 7.4) buffer containing 1% SDS and 15 mM AMS for 30 min (with the exception of the control non-reduced sample which was resuspended in the same buffer without AMS). The protein samples were then resolved without boiling on non-reducing 4–12% Nu-PAGE, and Coomassie blue stained.

The in vivo redox states of CARDS toxin and its derivatives were determined by the same method as followed by Kobayashi et al. (Kobayashi et al., 1997). Briefly, cells of M. pneumoniae S1-clinical isolate grown in SP-4 media to early mid-log phase (36 h) were washed, scraped and resuspended in 1 mL of 100 mM Tris-HCl (pH 7.4) and whole-cell proteins of IPTG (1 mM) induced E. coli cultures were TCA precipitated. Similarly, whole cell proteins were precipitated by direct treatment of the cultures (expressing either WT or C→S mutated CARDS toxin derivatives) with final addition of 5% of TCA to avoid any subsequent reduction of CARDS toxin after cell disruption. All protein precipitates were collected by centrifugation and washed with acetone, and the samples to be reduced were dissolved in freshly prepared solution containing 10 mM Tris-HCl (pH 8.0) with 100 μM DTT for 30 min then TCA precipitated. All precipitants were dissolved in 1% SDS, 100 mM Tris-HCl (pH 7.4), and 15 mM AMS. Proteins were then separated without boiling by 4–12% Nu-PAGE in the absence of any reducing agent and transferred to nitrocellulose membranes. CARDS toxin was visualized by immunoblot analysis.

To determine the in vivo redox state of the WT and C→S mutant proteins, free thiols were alkylated with the high molecular-weight reagent mal-PEG (Maleimide-polyethylene glycol, Mr 5,000; Sigma). Basically, we performed the same alkylation protocol described above by using 0.5 ml culture samples, replacing AMS by mal-PEG at a final concentration of 4 mM, and diluting the sample with SDS sample buffer (1:1) before gel loading.

4.4. Protease digestion of WT CARDS toxin and C→S CARDS toxin mutants

Purified WT CARDS toxin and all C→S mutant CARDS toxins were digested with trypsin, thermolysin and proteinase K (Pakhomova et al., 2010, Kannan et al., 2014). Briefly, purified proteins in storage buffer at 1 mg ml−1 were incubated with trypsin (10 μg), thermolysin (5 μg) or proteinase k (10 μg) for 15 min, 30 min and 120 min at room temperature. Proteolysis was terminated by adding PMSF (100 μM; Fluka) or boiling in SDS-PAGE lysis buffer. Digested proteins were resolved on 4–12% Nu-PAGE gels and either Coomassie stained or transferred to nitrocellulose membrane for immunoblotting. Immunoblotting was performed with primary rabbit polyclonal anti-CARDS-full length (1:5000) or rabbit polyclonal anti-CARDS N-terminal (1–200 aa; 1:1000) or rabbit polyclonal anti-CARDS C-terminal (572–591aa; 1:3000) antibodies with 3% blotto in Tris-buffered saline with 0.1% Tween 20 (TBST) for 1hr at RT. Secondary goat anti-rabbit HRP conjugated antibody was diluted at 1:3000 with 3% blotto in TBST for 1hr at RT.

4.5. Binding and internalization of WT CARDS toxin, C230S and C247S mutants

Binding and internalization of CARDS toxin and its derivatives were analyzed as we reported previously (Krishnan et al., 2013). In brief, HeLa cells (5 × 104 cells per well) were cultured in Eagle’s MEM medium with 10% FBS in 96-well plates overnight at 37°C. Biotin-labeled WT CARDS toxin and C230S and C247S mutant toxins were prepared, using EZ-Link sulpho-N-hydroxylsulphosuccinimide-biotin (sulpho-NHS-SS-biotin) (Pierce USA). For binding studies, monolayers of HeLa cells were treated with biotin-labeled WT CARDS toxin or its derivatives (140 pmol) in HBSS-BSA at 4°C for 60 min, and the bound proteins were analyzed using horseradish peroxidase (HRP)-conjugated streptavidin (Pierce, USA). Color intensity was measured at 450 nm using ELISA reader (MRX Dynatech Lab., USA) as previously described (Krishnan et al., 2013). For internalization studies, biotin-labeled WT CARDS toxin or its C→S derivatives were added to monolayers at 4°C for 1 h. The temperature was shifted to 37°C, and incubation was continued for 60 min. Cells were subjected to 2-mercaptoethanesulphonic acid (0.5 M) to remove cell surface-bound biotin. Then, cells were permeabilized, and internalized biotin-labeled proteins were estimated using HRP-conjugated streptavidin (Krishnan et al., 2013).

4.6. ER-SNAP trap experiments

SNAP experiments were performed as described before (Ramasamy et al., 2018). In brief, HeLa cells were transfected with ER trapped SNAP plasmid (ER-SNAP) or cytosol associated SNAP (C-SNAP) plasmid (5 μg) using Lipofectamine 2000 (Invitrogen). SNAP-tag is an engineered variant of the human repair protein O(6)-alkylguanine-DNA alkyltransferase (hAGT) that covalently reacts with benzylguanine (BG) derivatives (Geiger et al., 2013). After 24 h post-transfection, cells were intoxicated with 140 pmol of freshly prepared BG-WT or BG-C230S CARDS toxin protein. CARDS toxin (WT or C230S) was coupled to the benzyl moiety only through its C-terminus as there are no lysine residues within the ADPRT region of CARDS toxin (until residue 246) for BG labeling (Ramasamy et al., 2018). Transfected cells with carrier buffer served as controls. After 16 h, cells were lysed, separated in 4–12% Nu-PAGE, transferred to nitrocellulose membranes, and probed with anti-c-Myc antibody (clone 9E10; 1:1,000). BG-CARDS toxin (WT or C230S) that covalently bonded with the ER trapped SNAP tag were analyzed by Nu-PAGE gel mobility shift assays. The number of ER-SNAP proteins interacting with CARDS toxin were dependent on the number of CARDS toxin lysine residues that were BG labeled which determines the sizes of the high molecular weight bands on the gel mobility shift assays.

4.7. ADPRT assay

ADPRT activity of CARDS toxin and its derivatives was performed as previously described (Kannan et al., 2006, Kannan et al., 2014). Briefly, CHO cell lysates were incubated with 140 pmol of freshly prepared WT, C230S or C425S CARDS toxin in a 50 μl reaction mixture volume of 10 mM thymidine (Sigma), 10 mM DTT (Sigma), 2.5 mM MgCl2 (Sigma), 50 mM Tris (pH 7.4), and 0.2 μM [32P]NAD (800 Ci mmol-1; Perkin-Elmer). Samples were resolved on 4–12% Nu-PAGE gel, and the proteins were transferred onto 0.2 μm nitrocellulose membranes (Protran BA83; Schleicher & Schuell) and exposed to autoradiographic films (Kodak) for 1 day to 1 week at −80°C and developed.

4.8. IL-1β cytokine assay

CARDS toxin-mediated IL-1β release from macrophages was assayed as described previously (Bose et al., 2014, Ramasamy et al., 2018). In brief, U937 cells differentiated into monocytes were incubated with lipopolysaccharide LPS-EB (LPS from E. coli O111:B4) (1 μg/ml; InvivoGen) for 4 h, and then incubated with carrier solution or 700 pmol of WT or C230S CARDS toxin for 48 h. IL-1β levels were measured using a human-specific enzyme-linked immunosorbent assay (ELISA) kit (eBioscience).

4.9. Vacuolation measurement

HeLa cells were grown in 6-well plates at 50% confluence. Then, WT CARDS toxin, all C→S variants (140, 350 and 700 pmol) and protease-digested WT and mutant CARDS toxin derivatives (700 pmol) were added in MEM medium at 37 °C, and the incubation was continued for 72 h. Vacuolation was analyzed and quantified as described previously (Johnson et al., 2011, Somarajan et al., 2014). In brief, numbers of vacuolated cells per field were recorded at different time points. All experiments were repeated in triplicate, and 5 fields of 20–25 cells per sample were examined to determine the vacuolation patterns.

4.10. Immunofluorescence of WT and C→S mutant toxin to determine co-localization with Golgi and ERGIC

HeLa cells (2 × 104 cells/cover glass) grown for 18 h were treated with 140 pmol of WT CARDS toxin or C→S mutant CARDS toxins in MEM without serum for 1h at 4°C. Unbound CARDS toxin and its mutant derivatives were removed by washing, and the cells were either processed for binding or incubated with pre-warmed MEM medium with serum for 4h and 8h at 37°C for internalization assessment. Cells were washed once with PBS, fixed in 2% paraformaldehyde (methanol free-Thermo Scientific) in PBS for 15 min at RT, washed with PBS and permeabilized in 0.2% Triton-X 100 in PBS for 5 min at RT. Cells were blocked with 1% heat-inactivated normal goat serum (NGS - Gibco) and incubated with primary antibodies diluted at 1:500 (rabbit anti-CARDS-FL) or 1:100 (mouse anti-ERGIC) in PBS with 0.2% NGS for 1h at RT. Cells were washed with PBS containing 0.2% NGS and incubated with secondary antibodies diluted at 1:500 (Alexa Fluor 488 goat anti-mouse, Alexa Fluor 555 goat anti-rabbit) in PBS with 0.2% NGS for 1h at RT. Cells were washed with PBS and mounted on glass slides with Vectashield hard set mounting media (Vector Labs) containing DAPI stain. Slides were visualized with 488, 555 and DAPI filter sets using a Carl-Zeiss Cell Observer Z.1 microscope.

4.11. Processing of CARDS toxin in HeLa cells

HeLa cells were grown in 6-well plates to 50% confluence. Cells were incubated with 280 pmol of WT or C230S CARDS toxin for 1h-24h. At specific time intervals, cells were collected and lysed in NP-40 lysis buffer for 30 min at 4°C, and cell lysates were collected by centrifugation at 13,000 rpm for 10 min. Proteins were quantified by the Bradford method, and protein samples were prepared by boiling in SDS-PAGE sample buffer. Five microgram of each sample was loaded on 12% SDS-PAGE gels, separated by electrophoresis, transferred to nitrocellulose membranes, blocked with 5% blotto in TBST and immunoblotted with primary rabbit polyclonal anti-CARDS-FL antibody (1:5000) with 3% blotto in TBST overnight at 4°C. Secondary goat anti-rabbit HRP conjugated antibody was diluted at 1:3000 with 3% blotto in TBST for 1hr at RT.

4.12. Statistical analyses and reproducibility of experiments

All experiments were performed at least three independent times, and representative figures were shown in the Results section. All data are expressed as the mean ± standard error of the mean of triplicates. A comparison was considered statistically significant if the P value was < 0.05.

Supplementary Material

supplement-1

ACKNOWLEDGEMENTS

This research was supported by National Institutes of Health (NIH) grants AI 141877 (to T.R.K.), U19AI070412 (to J.B.B) Welch Foundation grant AQ-1399 (to P.J.H.). The University of Texas Health Science Center at San Antonio’s X-Ray Crystallography Core Laboratory in the Institutional Research Cores is supported by the Office of the Vice President for Research and by the Mays Cancer Center NIH/NCI grant P30 CA054174.

The contents of this article are solely the responsibility of the authors and do not necessarily represent the official views of the National Institute of Allergy and Infectious Diseases or the National Institutes of Health.

Footnotes

CONFLICT OF INTEREST

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

REFERENCES

  1. Atkinson TP and Waites KB (2014). Mycoplasma pneumoniae Infections in Childhood. The Pediatric infectious disease journal 33, 92–94. [DOI] [PubMed] [Google Scholar]
  2. Baseman JB, Reddy SP and Dallo SF (1996). Interplay between mycoplasma surfaceproteins, airway cells, and the protean manifestations of mycoplasma-mediated human infections. American journal of respiratory and critical care medicine 154, S137–S144. [DOI] [PubMed] [Google Scholar]
  3. Becker A, Kannan TR, Taylor AB, Pakhomova ON, Zhang Y, Somarajan SR, et al. (2015). Structure of CARDS toxin, a unique ADP-ribosylating and vacuolating cytotoxin from Mycoplasma pneumoniae. Proceedings of the National Academy of Sciences of the United States of America 112, 5165–5170. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Biscardi S, Lorrot M, Marc E, Moulin F, Boutonnat-Faucher B, Heilbronner C, et al. (2004). Mycoplasma pneumoniae and asthma in children. Clinical infectious diseases : an official publication of the Infectious Diseases Society of America 38, 1341–1346. [DOI] [PubMed] [Google Scholar]
  5. Bose S, Segovia JA, Somarajan SR, Chang TH, Kannan TR and Baseman JB (2014). ADP-ribosylation of NLRP3 by Mycoplasma pneumoniae CARDS toxin regulates inflammasome activity. mBio 5, e02186. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Burns DL and Manclark CR (1989). Role of cysteine 41 of the A subunit of pertussis toxin. The Journal of biological chemistry 264, 564–568. [PubMed] [Google Scholar]
  7. Burova TV, Choiset Y, Tran V and Haertle T (1998). Role of free Cys121 in stabilization of bovine beta-lactoglobulin B. Protein engineering 11, 1065–1073. [DOI] [PubMed] [Google Scholar]
  8. Collier RJ (2001). Understanding the mode of action of diphtheria toxin: a perspective onprogress during the 20th century. Toxicon : official journal of the International Society on Toxinology 39, 1793–1803. [DOI] [PubMed] [Google Scholar]
  9. Collier RJ and Kandel J (1971). Structure and activity of diphtheria toxin. I. Thiol-dependent dissociation of a fraction of toxin into enzymically active and inactive fragments. The Journal of biological chemistry 246, 1496–1503. [PubMed] [Google Scholar]
  10. de Paiva A, Poulain B, Lawrence GW, Shone CC, Tauc L and Dolly JO (1993). A role for the interchain disulfide or its participating thiols in the internalization of botulinum neurotoxin A revealed by a toxin derivative that binds to ecto-acceptors and inhibits transmitter release intracellularly. The Journal of biological chemistry 268, 20838–20844. [PubMed] [Google Scholar]
  11. Domenighini M and Rappuoli R (1996). Three conserved consensus sequences identify the NAD-binding site of ADP-ribosylating enzymes, expressed by eukaryotes, bacteria and T-even bacteriophages. Molecular microbiology 21, 667–674. [DOI] [PubMed] [Google Scholar]
  12. Falnes PO, Choe S, Madshus IH, Wilson BA and Olsnes S (1994). Inhibition ofmembrane translocation of diphtheria toxin A-fragment by internal disulfide bridges. The Journal of biological chemistry 269, 8402–8407. [PubMed] [Google Scholar]
  13. Garred O, Dubinina E, Polesskaya A, Olsnes S, Kozlov J and Sandvig K (1997). Role of the disulfide bond in Shiga toxin A-chain for toxin entry into cells. The Journal of biological chemistry 272, 11414–11419. [DOI] [PubMed] [Google Scholar]
  14. Garred O, van Deurs B and Sandvig K (1995). Furin-induced cleavage and activation of Shiga toxin. The Journal of biological chemistry 270, 10817–10821. [DOI] [PubMed] [Google Scholar]
  15. Geiger R, Luisoni S, Johnsson K, Greber UF and Helenius A (2013). Investigatingendocytic pathways to the endoplasmic reticulum and to the cytosol using SNAP-trap. Traffic 14, 36–46. [DOI] [PubMed] [Google Scholar]
  16. Hardy RD, Coalson JJ, Peters J, Chaparro A, Techasaensiri C, Cantwell AM, et al. (2009). Analysis of pulmonary inflammation and function in the mouse and baboon after exposure to Mycoplasma pneumoniae CARDS toxin. PloS one 4, e7562. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Ho SN, Hunt HD, Horton RM, Pullen JK and Pease LR (1989). Site-directedmutagenesis by overlap extension using the polymerase chain reaction. Gene 77, 51–59. [DOI] [PubMed] [Google Scholar]
  18. Hogg PJ (2003). Disulfide bonds as switches for protein function. Trends in biochemical sciences 28, 210–214. [DOI] [PubMed] [Google Scholar]
  19. Jain S, Self WH, Wunderink RG, Fakhran S, Balk R, Bramley AM, et al. (2015a). Community-Acquired Pneumonia Requiring Hospitalization among U.S. Adults. The New England journal of medicine 373, 415–427. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Jain S, Williams DJ, Arnold SR, Ampofo K, Bramley AM, Reed C, et al. (2015b).Community-Acquired Pneumonia Requiring Hospitalization among US Children. New Engl J Med 372, 835–845. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Johnson C, Kannan TR and Baseman JB (2011). Cellular vacuoles induced by Mycoplasma pneumoniae CARDS toxin originate from Rab9-associated compartments. PloS one 6, e22877. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Kannan TR and Baseman JB (2006). ADP-ribosylating and vacuolating cytotoxin of Mycoplasma pneumoniae represents unique virulence determinant among bacterial pathogens. Proceedings of the National Academy of Sciences of the United States of America 103, 6724–6729. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Kannan TR, Coalson JJ, Cagle M, Musatovova O, Hardy RD and Baseman JB (2011). Synthesis and distribution of CARDS toxin during Mycoplasma pneumoniae infection in a murine model. The Journal of infectious diseases 204, 1596–1604. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Kannan TR, Hardy RD, Coalson JJ, Cavuoti DC, Siegel JD, Cagle M, et al. (2012). Fatal outcomes in family transmission of Mycoplasma pneumoniae. Clinical infectious diseases : an official publication of the Infectious Diseases Society of America 54, 225–231. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Kannan TR, Krishnan M, Ramasamy K, Becker A, Pakhomova ON, Hart PJ andBaseman JB (2014). Functional mapping of community-acquired respiratory distress syndrome (CARDS) toxin of Mycoplasma pneumoniae defines regions with ADP-ribosyltransferase, vacuolating and receptor-binding activities. Molecular microbiology 93, 568–581. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Kannan TR, Musatovova O, Balasubramanian S, Cagle M, Jordan JL, Krunkosky TM, et al. (2010). Mycoplasma pneumoniae Community Acquired Respiratory Distress Syndrome toxin expression reveals growth phase and infection-dependent regulation. Molecular microbiology 76, 1127–1141. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Kannan TR, Provenzano D, Wright JR and Baseman JB (2005). Identification and characterization of human surfactant protein A binding protein of Mycoplasma pneumoniae. Infection and immunity 73, 2828–2834. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Kobayashi T, Kishigami S, Sone M, Inokuchi H, Mogi T and Ito K (1997). Respiratory chain is required to maintain oxidized states of the DsbA-DsbB disulfide bond formation system in aerobically growing Escherichia coli cells. Proceedings of the National Academy of Sciences of the United States of America 94, 11857–11862. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Krishnan M, Kannan TR and Baseman JB (2013). Mycoplasma pneumoniae CARDS toxin is internalized via clathrin-mediated endocytosis. PloS one 8, e62706. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Lencer WI, Constable C, Moe S, Jobling MG, Webb HM, Ruston S, et al. (1995).Targeting of cholera toxin and Escherichia coli heat labile toxin in polarized epithelia: role of COOH-terminal KDEL. The Journal of cell biology 131, 951–962. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Maselli DJ, Medina JL, Brooks EG, Coalson JJ, Kannan TR, Winter VT, et al. (2018). The Immunopathologic Effects of Mycoplasma pneumoniae and Community- acquired Respiratory Distress Syndrome Toxin. A Primate Model. American journal of respiratory cell and molecular biology 58, 253–260. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Mekalanos JJ, Collier RJ and Romig WR (1979). Enzymic activity of cholera toxin. II. Relationships to proteolytic processing, disulfide bond reduction, and subunit composition. The Journal of biological chemistry 254, 5855–5861. [PubMed] [Google Scholar]
  33. Moss J, Stanley SJ, Burns DL, Hsia JA, Yost DA, Myers GA and Hewlett EL(1983). Activation by thiol of the latent NAD glycohydrolase and ADP-ribosyltransferase activities of Bordetella pertussis toxin (islet-activating protein). The Journal of biological chemistry 258, 11879–11882. [PubMed] [Google Scholar]
  34. Muir MT, Cohn SM, Louden C, Kannan TR and Baseman JB (2011). Novel toxinassays implicate Mycoplasma pneumoniae in prolonged ventilator course and hypoxemia. Chest 139, 305–310. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Narita M (2016). Classification of extrapulmonary manifestations due to Mycoplasmapneumoniae infection on the basis of possible pathogenesis. Frontiers in microbiology 7, 23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Nisar N, Guleria R, Kumar S, Chand Chawla T and Ranjan Biswas N (2007). Mycoplasma pneumoniae and its role in asthma. Postgraduate medical journal 83, 100–104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Ogata M, Chaudhary VK, Pastan I and FitzGerald DJ (1990). Processing of Pseudomonas exotoxin by a cellular protease results in the generation of a 37,000-Da toxin fragment that is translocated to the cytosol. The Journal of biological chemistry 265, 20678–20685. [PubMed] [Google Scholar]
  38. Pakhomova ON, Taylor AB, Becker A, Holloway SP, Kannan TR, Baseman JB and Hart PJ (2010). Crystallization of community-acquired respiratory distress syndrome toxin from Mycoplasma pneumoniae. Acta crystallographica. Section F, Structural biology and crystallization communications 66, 294–296. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Pelham HR, Roberts LM and Lord JM (1992). Toxin entry: how reversible is the secretory pathway? Trends in cell biology 2, 183–185. [DOI] [PubMed] [Google Scholar]
  40. Peters J, Singh H, Brooks EG, Diaz J, Kannan TR, Coalson JJ, et al. (2011). Persistence of community-acquired respiratory distress syndrome toxin-producing Mycoplasma pneumoniae in refractory asthma. Chest 140, 401–407. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Ramasamy K, Balasubramanian S, Manickam K, Pandranki L, Taylor AB, Hart PJ, et al. (2018). Mycoplasma pneumoniae Community-Acquired Respiratory Distress Syndrome Toxin Uses a Novel KELED Sequence for Retrograde Transport and Subsequent Cytotoxicity. mBio 9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Sandvig K, Garred O, Prydz K, Kozlov JV, Hansen SH and van Deurs B (1992).Retrograde transport of endocytosed Shiga toxin to the endoplasmic reticulum. Nature 358, 510–512. [DOI] [PubMed] [Google Scholar]
  43. Sandvig K and van Deurs B (2002). Transport of protein toxins into cells: pathways used by ricin, cholera toxin and Shiga toxin. FEBS letters 529, 49–53. [DOI] [PubMed] [Google Scholar]
  44. Sixma TK, Kalk KH, van Zanten BA, Dauter Z, Kingma J, Witholt B and Hol WG (1993). Refined structure of Escherichia coli heat-labile enterotoxin, a close relative of cholera toxin. Journal of molecular biology 230, 890–918. [DOI] [PubMed] [Google Scholar]
  45. Sixma TK, Pronk SE, Kalk KH, Wartna ES, van Zanten BA, Witholt B and Hol WG (1991). Crystal structure of a cholera toxin-related heat-labile enterotoxin from E. coli. Nature 351, 371–377. [DOI] [PubMed] [Google Scholar]
  46. Somarajan SR, Al-Asadi F, Ramasamy K, Pandranki L, Baseman JB and Kannan TR (2014). Annexin A2 mediates Mycoplasma pneumoniae community-acquired respiratory distress syndrome toxin binding to eukaryotic cells. mBio 5, e01497. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Stein PE, Boodhoo A, Armstrong GD, Cockle SA, Klein MH and Read RJ (1994).The crystal structure of pertussis toxin. Structure 2, 45–57. [DOI] [PubMed] [Google Scholar]
  48. Tam PJ and Lingwood CA (2007). Membrane cytosolic translocation of verotoxin A1 subunit in target cells. Microbiology 153, 2700–2710. [DOI] [PubMed] [Google Scholar]
  49. Tatara Y, Yoshida T and Ichishima E (2005). A single free cysteine residue and disulfide bond contribute to the thermostability of Aspergillus saitoi 1,2-alpha-mannosidase. Bioscience, biotechnology, and biochemistry 69, 2101–2108. [DOI] [PubMed] [Google Scholar]
  50. Techasaensiri C, Tagliabue C, Cagle M, Iranpour P, Katz K, Kannan TR, et al. (2010). Variation in colonization, ADP-ribosylating and vacuolating cytotoxin, and pulmonary disease severity among Mycoplasma pneumoniae strains. American journal of respiratory and critical care medicine 182, 797–804. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Tsai B, Rodighiero C, Lencer WI and Rapoport TA (2001). Protein disulfide isomerase acts as a redox-dependent chaperone to unfold cholera toxin. Cell 104, 937–948. [DOI] [PubMed] [Google Scholar]
  52. Tsai B, Ye Y and Rapoport TA (2002). Retro-translocation of proteins from the endoplasmic reticulum into the cytosol. Nature reviews. Molecular cell biology 3, 246–255. [DOI] [PubMed] [Google Scholar]
  53. Vestweber D and Schatz G (1988). Mitochondria can import artificial precursor proteinscontaining a branched polypeptide chain or a carboxy-terminal stilbene disulfonate. The Journal of cell biology 107, 2045–2049. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Waites KB and Talkington DF (2004). Mycoplasma pneumoniae and its role as a human pathogen. Clinical microbiology reviews 17, 697–728. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Wernick NL, Chinnapen DJ, Cho JA and Lencer WI (2010). Cholera toxin: anintracellular journey into the cytosol by way of the endoplasmic reticulum. Toxins 2, 310–325. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Yeh JJ, Wang YC, Hsu WH and Kao CH (2016). Incident asthma and Mycoplasmapneumoniae: A nationwide cohort study. The Journal of allergy and clinical immunology 137, 1017–1023 e1016. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

supplement-1
NIHMS1526761-supplement-1.pdf (327.1KB, pdf)

RESOURCES