Cannabinoid receptor-mediated modulation of inhibitory inputs to mitral cells in the main olfactory bulb

Abstract

The endocannabinoid (eCB) signaling system has been functionally implicated in many brain regions. Our understanding of the role of cannabinoid receptor type 1 (CB₁) in olfactory processing remains limited. Cannabinoid signaling is involved in regulating glomerular activity in the main olfactory bulb (MOB). However, the cannabinoid-related circuitry of inputs to mitral cells in the MOB has not been fully determined. Using anatomical and functional approaches we have explored this question. CB₁ was present in periglomerular processes of a GAD65-positive subpopulation of interneurons but not in mitral cells. We detected eCBs in the mouse MOB as well as the expression of CB₁ and other genes associated with cannabinoid signaling in the MOB. Patch-clamp electrophysiology demonstrated that CB₁ agonists activated mitral cells and evoked an inward current, while CB₁ antagonists reduced firing and evoked an outward current. CB₁ effects on mitral cells were absent in subglomerular slices in which the olfactory nerve layer and glomerular layer were removed, suggesting the glomerular layer as the site of CB₁ action. We previously observed that GABAergic periglomerular cells show the inverse response pattern to CB₁ activation compared with mitral cells, suggesting that CB₁ indirectly regulates mitral cell activity as a result of cellular activation of glomerular GABAergic processes . This hypothesis was supported by the finding that cannabinoids modulated synaptic transmission to mitral cells. We conclude that CB₁ directly regulates GABAergic processes in the glomerular layer to control GABA release and, in turn, regulates mitral cell activity with potential effects on olfactory threshold and behavior.

NEW & NOTEWORTHY Cannabinoid signaling with cannabinoid receptor type 1 (CB₁) is involved in the regulation of glomerular activity in the main olfactory bulb (MOB). We detected endocannabinoids in the mouse MOB. CB₁ was present in periglomerular processes of a GAD65-positive subpopulation of interneurons. CB₁ agonists activated mitral cells. CB₁ directly regulates GABAergic processes to control GABA release and, in turn, regulates mitral cell activity with potential effects on olfactory threshold and behavior.

INTRODUCTION

The endocannabinoid system has emerged as an important neuromodulatory system (Iannotti et al. 2016), which involves cannabinoid receptors, CB₁ and CB₂, and their endogenous activators, the endocannabinoids (eCBs). Immunohistochemical and autoradiographic studies indicate that CB₁ is present in the main olfactory bulb (MOB) with moderate to intense levels of staining (Herkenham et al. 1991; Moldrich and Wenger 2000; Pettit et al. 1998; Tsou et al. 1998). Moldrich and Wenger (2000) observed a moderate density of CB₁ immunoreactive cell bodies and fibers in several layers of the MOB: glomerular layer, mitral cell layer, internal plexiform layer, and granule cell layer. In the granule cell layer, CB₁ is abundantly expressed on axon terminals of centrifugal cortical glutamatergic neurons that project to inhibitory granule cells (Soria-Gómez et al. 2014).

Many CB₁-expressing neurons in the central nervous system are GABAergic (Tsou et al. 1998). Functionally, eCBs can act on CB₁ at presynaptic terminals to reduce transmitter release, diminishing glutamate (Kreitzer and Regehr 2001a; Lévénés et al. 1998; Takahashi and Linden 2000) and GABA release (Diana et al. 2002; Hoffman and Lupica 2000; Katona et al. 1999; Ohno-Shosaku et al. 2001; Varma et al. 2001; Wilson and Nicoll 2001) in the hippocampus and cerebellum. Two eCBs are strongly implicated in cannabinoid signaling, 2-arachidonoyl glycerol (2-AG; Mechoulam et al. 1995; Sugiura et al. 1995) and arachidonoyl ethanolamine (AEA; anandamide; Devane et al. 1992). These lipid messengers are produced and broken down enzymatically. Intriguingly, cannabinoid signaling in the MOB is implicated in regulating appetite and olfactory threshold through centrifugal fiber input to inhibitory granule cells as a means of cortical feedback to the MOB (Pouille and Schoppa 2018; Soria-Gómez et al. 2014). However, little is known about the relevance of CB₁ for mitral cell activity in MOB glomeruli.

The MOB is the first central relay station for olfactory information conveyed from the nasal epithelium by olfactory receptor neurons. Sensory transmission from olfactory nerve terminals to principal neurons of the MOB, mitral and tufted cells, is regulated by juxtaglomerular cells in glomeruli. Several types of neurons collectively referred to as juxtaglomerular cells send dendrites into the glomerular neuropil (reviewed in Ennis et al. 2007) targeting external tufted cells, “short axon: cells, and periglomerular cells. Cells in the glomerular layer express NAPE-PLD, an enzyme implicated in the synthesis of anandamide (Egertovaá et al. 2008; Okamoto et al. 2007), but the Allen Brain Atlas (Allen Institute for Brain Science 2009) shows little message for the 2-AG-synthesizing enzymes diacylglycerol lipase-α (DAGLα) or -β (DAGLβ). Periglomerular cells are GABAergic interneurons while external tufted cells are glutamatergic (Ribak et al. 1977; Hayar et al. 2004; Kiyokage et al. 2010). Periglomerular cells receive input from the olfactory nerve or dendrodendritic glutamatergic input from external tufted or mitral cells (Ennis et al. 2007; Hayar et al. 2004; Pinching and Powell 1971; Shipley and Ennis 1996) Through GABAergic transmission, periglomerular cells presynaptically inhibit olfactory receptor neurons (Aroniadou-Anderjaska et al. 2000; Murphy et al. 2005) and postsynaptically regulate mitral cell activity (Dong et al. 2007). Short axon cells express both GABA and dopamine and form extensive interglomerular connections (Kiyokage et al. 2010).

To study the function of the eCB system in the MOB, we determined cannabinoid levels and the expression of CB₁ and other genes associated with the cannabinoid signaling system in the MOB. We additionally tested the effects of agonists/antagonists of CB₁ on cellular and network activity of a key neuronal cell type, mitral cells, in a slice preparation of the mouse MOB.

MATERIALS AND METHODS

Animal use.

All procedures used in this study were approved by the Animal Care Committees of Howard University, Indiana University, and National Cheng Kung University and conform to the of the National Institutes of Health Guide for the Care and Use of Laboratory Animals.

Immunohistochemistry.

Adult mice [CD1 strain (4), C57/BL6 strain (4), CB₁ KO on CD1 strain (2), and GAD67 strain on C57/BL6 strain (2) (number of mice for each strain in parentheses); >5 wk, of either sex, from breeding colony] were housed under a 12:12-h day-night cycle. Mice were perfused transcardially under deep isoflurane anesthesia first with 0.9% saline and then with 4% paraformaldehyde dissolved in phosphate buffer at 4°C. After perfusion, the MOB was removed from the skull and further fixed in 4% paraformaldehyde solution for 1 h followed by a 30% sucrose immersion for 24–72 h at 4°C. Tissue was then rapidly frozen in TissueTek OCT (optimum cutting temperature) compound and sectioned (15–20 μm) using a Leica CM1850 cryostat (Leica Biosystems). Tissue sections were mounted onto Superfrost-Plus slides, washed, and treated with Sea Block blocking buffer (Thermo Fisher Scientific) for 30 min and afterwards with primary antibodies prepared in PBS with a detergent (0.3% Triton-X100 or 0.1% or saponin) and incubated overnight at 4°C. Secondary antibodies (Alexa647, Alexa594, or Alexa488; 1:500; Invitrogen) were subsequently applied at room temperature for 1.5 h. Finally, sections were washed three times with 0.1 M PBS, twice with 0.1 M phosphate buffer, and three times with water and air dried. Coverslips were mounted on top of these sections with a drop of Vectashield containing DAPI (Vector Laboratories). Sections were examined with a Leica TCS SP5 confocal microscope. Images were processed by ImageJ (freeware, available at https://imagej.nih.gov/ij/) and/or Photoshop (Adobe Systems). Images were only modified in terms of brightness and/or contrast.

GAD67-GFP mice generated by Dr. Yuchio Yanagawa (Gunma University, Gunma, Japan; Tamamaki et al. 2003) were provided by Dr. Albert Berger (University of Washington, Seattle, WA), with Dr. Yanagawa’s permission.

Antibody characterization.

The specificity of CB₁-L15 has been previously characterized by using knockout mouse models, and the immunostaining for CB₁ was completely absent in the corresponding knockout (Bodor et al. 2005; Bracey et al. 2002; Hájos et al. 2000) in those studies and also in this article(Fig. 1B). The specificity of the GAD65 antibody (mouse monoclonal, 1:600; Developmental Studies Hybridoma Bank) was established by the recognition of a single band of 64 kDa [representing glutamic acid decarboxylase (GAD)] by Western blotting (Chang and Gottlieb 1988; Jevince et al. 2006). The recoverin antibody (rabbit, polyclonal, 1:1,000; cat. no. AB5585; Chemicon) recognized a 25-kDa band on Western blots of mouse retina (Hendrickson et al. 2009).

Fig. 1.

Cannabinoid receptor type 1 (CB₁) receptors are present in a subpopulation of GAD65-positive periglomerular neurons of murine main olfactory bulb. A: micrograph shows GAD67-GFP (green) and CB₁ staining (red, arrows) in the glomerular layer of the main olfactory bulb. CB₁ and GAD67-GFP staining does not overlap. A′: CB₁ staining from A shows that the staining for CB₁ is restricted to a few neuronal processes. EPL, external plexiform layer; glom, glomerulus. B: CB₁ staining in sample wild-type (WT) and CB₁^−/− tissue taken at same setting. C: micrograph shows rare process extending to the external plexiform layer. D: costaining of CB₁ (red, arrows) and recoverin (green) shows that the CB₁ staining is concentrated in periglomerular zone. E: GAD67-GFP and CB₁ staining in mitral layer [mitral cell (m)] shows an absence of prominent staining in and around these neurons. F: projection of a Z series of GAD65 (green) and CB₁ (red) staining shows a long overlapping process (overlap in yellow, arrows). G: higher magnification from F (3 × 230 nm sections flattened, rotated 90° clockwise) shows region of clear overlap for GAD65 (green) and CB₁ (red). G′ and G″: CB₁ and GAD65 staining from G. Scale bars: A: 30 µm; B: 20 µm; C: 35 µm; D: 20 µm; E: 10 µm; F: 10 µm; G: 5 µm.

Quantification of basal levels of 2-AG, AEA, and related acyl amides in murine OB.

Sixteen mice were euthanized by rapid cervical dislocation, and olfactory bulbs were dissected and fresh frozen in liquid nitrogen before lipid extraction to test the basal levels of 2-AG, AEA, and other related acyl amides [e.g., oleoyl ethanolamide (OEA), palmitoyl ethanolamide (PEA), stearoyl ethanolamide (SEA), and docosahexaenoyl ethanolamide (DHEA)]. Each of the analytes was extracted and quantified using methods previously described (Bradshaw et al. 2009; Hu et al. 2008). In brief, 20 vol of ice-cold HPLC-grade methanol and 100 pmol D₈AEA (internal standard) were added to the methanol-tissue sample. The samples were maintained on ice and sonicated for 1 min and centrifuged at 19,000 g at 24°C for 20 min. Supernatants were collected, and HPLC-grade water was added to a final concentration of 25% methanol. Bond-Elut cartridges (100 mg C18) were conditioned with 5 mL methanol and 3 mL water. The extract was then loaded and passed through by gentle, low-pressure aspiration. After being washed with 5 mL water and 2 mL of 40% methanol, the following fractions were collected and analyzed via HPLC/MS/MS: 60, 75, 85, and 100% methanol. Mass spectrometric analysis was performed with an Applied Biosystems/MDS Sciex (Foster City, CA) API3000 triple quadrupole mass spectrometer using electrospray ionization. Eluents were tested for levels of 2-AG, AEA, and related acyl amides as previously described (Leishman et al. 2016a, 2016b).

Examination of the expression of cannabinoid-related genes in murine OB by RT-PCR.

The sequences of primers designed against CB₁ and 11 additional cannabinoid-related mouse genes (CB₂, NAPE-PLD, ABHD4, GDE1, FAAH, NAAA, DGLα, DGLβ, MGL, ABHD6, and ABHD12) are listed on Table 1. GAPDH is a housekeeping gene used as an internal control. Expression of mRNAs was determined by RT-PCR. Total RNA was isolated from OB using Trizol reagent (Life Technologies), and RNeasy Kit (Qiagen, Valencia, CA) strand DNA was made using High Capacity RNA-to-cDNA Kit (Applied Biosystems, Foster City, CA) using 200 ng RNA in a 20-µl reaction. PCR was performed following the AmpliTaq 360 DNA Polymerase Protocol (Applied Biosystems). One microliter respective mouse OB cDNA was added into a 25-µL PCR reaction that was processed through 40-cycle amplification. PCR products were examined on 1% agarose gel stained with ethidium bromide (EtBr).

Table 1.

Primers designed for assorted mouse cannabinoid-related genes

Gene/Primer	NCBI Reference	Sequence (5′–3′)	Position	Size, bp
CB1	NM_007726.3		1631–1993	363
Forward		CTGATCCTGGTGGTGTTGATCATCTG
Reverse		CGTGTCTGTGGACACAGACATGGT
CB2	BC024052.1		821–1167	347
Forward		CCTGGGATAGCTCGGATGCG
Reverse		GTGGTTTTCACATCAGCCTCTGTTTC
NAPE–PLD	NM_178728.5		133–528	396
Forward		GGGTTTCGACTTCTCGCCGAGGG
Reverse		CCAGCCTCTCTCACTCCAGCGT
ABHD4	NM_134076.2		47–391	345
Forward		CCGGCAGGGCTTGTTTACTA
Reverse		GAGCTTCGCCCAAAACCAAG
GDE1	NM_019580.4		922–1262	341
Forward		GGATTTTGTCTCCCCGGACT
Reverse		AAGTGTGGAGCCTTCCTTGG
FAAH	NM_010173.4		1109–1446	338
Forward		TAGCCTGGCATTGTGCATGA
Reverse		AGCAGGGATCCACAAAGTCG
NAAA	NM_025972.4		255–498	244
Forward		TGGCGCAGGTCATTGGCGAC
Reverse		TCCAGGTTCCGGCCGTGGTAA
DGLα	NM_198114.2		2552–2851	300
Forward		GACGAGGGCCACCTGTTTTA
Reverse		CTCGGCGAATTCTAGCACCT
DGLβ	NM_144915.3		1780–2114	335
Forward		TGTTGGTACGGACTGTTCGG
Reverse		ACGTCAGGCATGTGGTCAAT
MGL	NM_001166251.1		102–437	336
Forward		TTTCCTTCCCTAAGCGGTCG
Reverse		CCACAGCCTCGAGTATCAGC
ABHD6	NM_025341.3		242–574	333
Forward		AAGTTCGCTACGCACACCAT
Reverse		AAGCGGCATATACTCCAGCC
ABHD12	NM_024465.3		622–956	335
Forward		TGTCTGGTGGAAGAATGCCC
Reverse		GCCGTACCAGATTTGTTGCC
GAPDH	AK147969.1		736–1039	304
Forward		GGGAAGCTCACTGGCATGGC
Reverse		GGTCCACCACCCTGTTGCT

NCBI, National Center for Biotechnology Information; CB₁ and CB₂, cannabinoid receptor 1 and 2; NAPE-PLD, N-acyl-phosphatidylethanolamine-hydrolyzing phospholipase D; GDE1, glycerophosphodiesterase 1; FAAH: fatty acid amide hydrolase, NAAA, N-acylethanolamine-hydrolyzing acid amidase; DGLα/β, diacylglycerol lipase α/β; MGL, monoacylglycerol lipase; ABHD4/6/12, α/β-hydrolase domain 4/6/12.

Slice preparation.

Wild-type mice of either sex (C57BL/6J; Jackson Laboratory, Bar Harbor, ME) were used. Juvenile (16–25 day old) mice were decapitated, and the MOBs were dissected out and immersed in artificial cerebrospinal fluid (ACSF, see below) at 4°C, as previously described (Heinbockel et al. 2004). Horizontal slices (400 µm thick) were cut parallel to the long axis using a vibratome (Vibratome Series 1000; Ted Pella, Redding, CA). For recording, a brain slice was placed in a recording chamber mounted on a microscope stage and maintained at 30 ± 0.5°C by superfusion with oxygenated ACSF flowing at 2.5–3 ml/min.

Electrophysiology.

Visually guided recordings were obtained from cells in the mitral cell layer with near-infrared differential interference contrast optics and a BX51WI microscope (Olympus Optical, Tokyo, Japan) equipped with a camera (C2400-07; Hamamatsu Photonics). Images were displayed on a Sony Trinitron Color Video monitor (PVM-1353MD; Sony). Recording pipettes (5–8 MΩ were pulled on a Flaming-Brown P-97 puller (Sutter Instruments, Novato, CA) from 1.5-mm outer diameter borosilicate glass with filament. Seal resistance was routinely >1 GΩ, and liquid junction potential was 9–10 mV; reported measurements were not corrected for this potential. Data were obtained using a Multiclamp 700B amplifier (Molecular Devices, Sunnyvale, CA). Signals were low-pass Bessel filtered at 2 kHz and digitized on computer disk (Clampex 10.1; Molecular Devices). Data were also collected through a Digidata 1440A Interface (Molecular Devices) and digitized at 10 kHz. Holding currents were generated under control of the Multiclamp 700B Commander. Membrane resistance was calculated from the amount of steady-state current required to hyperpolarize the cell by 10 mV, typically from −60 to −70 mV. The detection of events [intracellularly recorded spontaneous inhibitory postsynaptic currents (sIPSCs) and spontaneous excitatory postsynaptic currents (sEPSCs)] was performed off-line using Mini Analysis program (Synaptosoft, Decatur, GA).

Membrane potentials (V_m) were calculated from the steady-state membrane potential that occurred after a single action potential. Minimal membrane potential was measured as membrane potential for burst firing (Liu and Shipley 2008). To reduce the variance of spontaneous mitral cell firing rate, mitral cells with firing rates of 2–6 Hz were used for testing cannabinoid actions. Numerical data are expressed as the means ± SE. Tests for statistical significance (P < 0.05) were performed using paired Student's t-test, and nonparametric Wilcoxon signed rank test for paired data of small sample sizes (~5), or one-way ANOVA followed by the Bonferroni test for multiple comparisons.

The ACSF consisted of the following (in mM): 124 NaCl, 3 KCl, 2 CaCl₂, 1.3 MgSO₄, 10 glucose, 4.4 sucrose, 26 NaHCO₃, and 1.25 NaH₂PO₄ (pH 7.4, 300 mosM), saturated with 95 O₂-5% CO₂ (modified from Heyward et al. 2001). For intracellular recording of spiking activity, the pipette-filling solution consisted of the following (in mM): 144 K-gluconate, 2 MgCl₂, 10 HEPES, 2 Mg₂ATP, 0.2 Na₃GTP, 2 NaCl, and 0.2 EGTA. Lucifer yellow (0.02%, Molecular Probes) was added to the intracellular solution in a subset of experiments for in situ and post hoc labeling, respectively. We observed no difference in neuronal properties and behavior when Lucifer Yellow was included in the recording pipette. For intracellular recordings of IPSCs, EPSCs, electrodes were filled with a high-Cl⁻ or low-Cl⁻-based solution depending on the purpose of experiments. High-Cl⁻-based pipette solution contained the following composition (in mM): 110 cesium cloride, 10 tetraethylammonium-Cl, 2 NaCl, 10 phosphocreatine ditris salt, 2 MgATP, 0.3 GTP, 0.5 EGTA, 10 HEPES, and 10 QX-314 [2(triethylamino)-N-(2,6-dimethylphenyl) bromide], pH 7.3 with 1 N CsOH (osmolarity: 290 mosM). Low-Cl⁻-based pipette solution contained the following composition (in mM): 125 cesium methanesulfonate (CsMeSO₃), 1 NaCl, 10 phosphocreatine ditris salt, 2 MgATP, 0.3 GTP, 0.5 EGTA, 10 HEPES, and 10 QX-314 [2(triethylamino)-N-(2,6-dimethylphenyl)bromide], pH 7.3 with 1 N CsOH (osmolarity: 290 mosM).

The following drugs were bath applied: l-2-amino-5-phosphonopentanoic acid (AP5, APV), 6-cyano-7-nitroquinoxaline-2-3-dione (CNQX), (2-(3-carboxypropyl)-3-amino-6-(4 methoxyphenyl)-pyridazinium bromide (gabazine, SR-95531), (R)-(+)-[2,3-dihydro-5-methyl-3-(4-morpholinylmethyl)pyrrolo[1,2,3,-de]-1,4-benzoxazin-6-yl]-1-naphthalenylmethanone mesylate (WIN 55,212-2 mesylate), N-(piperidin-1-yl)-5-(4-iodophenyl)-1-(2,4-dichlorophenyl)-4-methyl-1H-pyrazole-3-carboxamide (AM251), (1R,4aS,10aR)-1,2,3,4,4a,9,10,-octahydro-1–4a-dimethyl-7-(1-methylethyl)-1-phenanthrenemethanamine hydrochloride (leelamine hydrochloride, lylamine hydrocholoride), N-(2-hydroxyethyl)-5Z,8Z,11Z,14Z-eicosatetraenamide (anandamide, AEA), and 5-(4-chlorophenyl)-1-(2,4-dichloro-phenyl)-4-methyl-N-(piperidin-1-yl)-1H-pyrazole-3-carboxamide (SR141716, rimonabant). Chemicals and drugs were supplied by Sigma-Aldrich (St. Louis, MO) and Tocris (Ellisville, MO), except for SR141716, which was supplied by the National Institute of Drug Abuse Drug Inventory Supply and Control System.

RESULTS

CB₁ is present in periglomerular processes of a GAD65-positive subpopulation of interneurons.

To delineate the receptor expression of CB₁, we made use of an antibody against the last 15 residues of the CB₁ receptor. In the glomerular, external plexiform, and mitral cell layer of the MOB, we observed staining tightly restricted to neuron-like processes in the glomerular layer (Fig. 1A). This staining was absent in the same regions of the MOB taken from CB₁^−/− mice (Fig. 1B). Occasional processes were seen to extend into the external plexiform layer, perhaps representing the origin of these processes. The staining was periglomerular in nature as demonstrated by our costaining with recoverin, which outlines glomeruli (Fig. 1D). Apart from rare processes in the external plexiform layer, no pronounced staining was observed in the external plexiform or mitral cell layer (Fig. 1E). To identify the population of neurons that express CB₁, we tested CB₁ staining against markers of interneuron populations using tissue from GAD67-GFP reporter mice (e.g., Fig. 1A) or an antibody against GAD65. Using this approach, we found that CB₁ colocalizes with a small subset of GAD65-positive interneurons (Fig. 1, F and G). We did not observe staining of neuronal somas, perhaps an indication that the CB₁ staining is restricted to neuronal processes.

The endocannabinoid 2-AG and other related lipids are detected in the mouse MOB.

Cannabinoid receptors are lipid receptors, known to be activated by endogenous cannabinoids 2-AG (Stella et al. 1997) and AEA (Devane et al. 1992). These are part of a larger family of lipids that have been hypothesized to play physiological roles in the body (Piomelli 2003). We tested for the presence of 2-AG, AEA, and several other related lipids in the MOB (Fig. 2, A–F). We found that 2-AG levels were the highest among those tested, consistent with its hypothesized role as a CB₁ receptor ligand. At ~2 nmol/g of tissue, 2-AG levels were comparable to if somewhat lower than those seen elsewhere in the brain (Stella et al. 1997). AEA levels were considerably lower (the lowest of the s6 lipids tested), although this is also consistent with findings for other regions of the brain (Cravatt et al. 2001). Interestingly, OEA levels at 100 pmol/g were lower than reported for brain (Oveisi et al. 2004) yet considerably higher than those for PEA. Low levels of stearoyl SEA and DHEA were also detected.

Fig. 2.

Endocannabinoid levels in murine main olfactory bulb. A: bar graph shows 2-arachidonoyl glycerol (2-AG) level measured in murine main olfactory bulb. B: anandamide (AEA) level, oleoyl ethanolamide (OEA) level, palmitoyl ethanolamide (PEA) level, stearoyl ethanolamide (SEA) level, and docosahexaenoyl ethanolamide (DHEA) level.

Expression of cannabinoid-related genes in the mouse main olfactory bulb by RT-PCR.

As a complementary assay, we tested for mRNA expression of a wide range of cannabinoid-related proteins (CB₁, CB₂, NAPE-PLD, ABHD4, GDE1, FAAH, NAAA, DGLα, DGLβ, MGL, ABHD6, and ABHD12) in the mouse MOB. This allowed independent verification of immunohistochemistry results for CB₁ and also allowed us to obtain data regarding the expression of a multiplicity of other genes known or suspected to be associated with the cannabinoid signaling system.

Our results suggest that all of the components of cannabinoid signaling are present in the mouse MOB (Fig. 3). As expected, high levels of CB₁ mRNA were present. However, the level of CB₂ mRNA is very close to our detection limit. Expression patterns of the enzymes involved in AEA and 2-AG biosynthesis (e.g., NAPE-PLD, ABHD4, GDE1 for AEA; DGLα/β for 2-AG) and metabolism (e.g., FAAH and NAAA for AEA; MGL and ABHD6/12 for 2-AG) were almost all present in the mouse MOB, although the expression of MGL mRNA was relatively low compared with ABHD6/12. Taken together with the immunohistochemistry results, these data indicate that the murine MOB is well supplied with known and hypothesized enzymes for the synthesis/metabolism of AEA and 2-AG.

Fig. 3.

RT-PCR measurement of the expression of 12 cannabinoid-related genes in murine main olfactory bulb. GAPDH is a housekeeping gene as an internal control. The PCR products were examined on 1% agarose gel with ethidium bromide. CB₁ and CB₂, cannabinoid receptor 1 and 2; NAPE-PLD, N-acyl-phosphatidylethanolamine-hydrolyzing phospholipase D; GDE1, glycerophosphodiesterase 1; FAAH: fatty acid amide hydrolase, NAAA, N-acylethanolamine-hydrolyzing acid amidase; DGLα/β, diacylglycerol lipase α/β; MGL, monoacylglycerol lipase; ABHD4/6/12, α/β-hydrolase domain 4/6/12.

CB₁ agonists and antagonist modulate mitral cell membrane potential and firing rate.

To determine the functional relevance of CB₁ in MOB neural circuits, we recorded from 203 mitral cells in mouse MOB slices. Mitral cells were identified visually by their soma location and relatively large soma size and by their input resistance (284 ± 16.6 MΩ, n = 69). The membrane potential of mitral cells in this study was −50.5 ± 0.6 mV (n = 69).

We first tested if selective and nonselective agonists of CB₁ regulate the activity of mitral cells in current-clamp recording conditions. Specifically, we tested whether CB₁ agonists can affect the firing rate and membrane potential of mitral cells. Mitral cells exhibited a background action potential firing rate ranging from 1 to 8 Hz (Heinbockel et al. 2004). The selective CB₁ agonist AEA (10 μM) increased their firing rate (control firing rate: 3.48 ± 0.58 Hz vs. in AEA: 4.51 ± 0.74 Hz, n = 10, P < 0.05; Fig. 4A) and depolarized mitral cells (ΔV_m = 2.5 ± 0.5 mV, n = 11, P < 0.001; Fig. 4B).

Fig. 4.

The activity of mitral cells was regulated by cannabinoids. A: original recording illustrates the increased firing rate of a mitral cell in response to bath application of cannabinoid receptor type 1 (CB₁) agonist anandamide (AEA; 10 μM). Time points 1 and 2 in the 1st trace are shown at higher time resolution in the 2nd and 3rd trace, respectively. B: representative mitral cell depolarized by AEA (10 μM). C: original recording from a mitral cell displayed the reduction in firing rate and hyperpolarization following application of CB₁ antagonist AM251. D: representative mitral cell with hyperpolarized membrane potential in response to AM251. E: group data of the effect of CB₁ agonists and antagonist AM251 on spike rate. *P < 0.05, **P < 0.01, ***P < 0.001, significance level.

Similar excitatory effects on mitral cell firing rate were seen in response to bath application of CB₁ agonist WIN 55,212-2 mesylate (WIN; 1 μM; control: 3.71 ± 0.59 Hz vs. in WIN: 5.27 ± 0.71 Hz, n = 10, P < 0.01) and CP 55,940 (control: 3.75 ± 0.76 Hz vs. in CP, 1 μM: 5.28 ± 0.86 Hz, n = 6, P < 0.05).The effects of the two CB₁ agonists on firing rate and membrane potential of mitral cells were not significantly different from each other (P > 0.05 determined by ANOVA and Bonferroni post hoc analysis; firing rate: P = 0.83; V_m: P = 0.28).

To test if the above excitatory effects were mediated by CB₁, we bath applied the selective CB₁ antagonist AM251. AM251 (10 µM) hyperpolarized mitral cells (ΔV_m = −0.9 ± 0.2 mV, n = 19, P < 0.001; Fig. 4D) and markedly reduced their firing rate (Fig. 4, C and E; control: 4.12 ± 0.65 Hz vs. in AM251: 3.06 ± 0.56 Hz, n = 19, P < 0.001). We further tested if the effects of WIN were CB₁ dependent by pretreating cells with the CB₁ antagonist AM251. In the presence of 10 μM AM251, bath application of WIN failed to induce an increase in firing rate (in AM251: 3.13 ± 0.75 Hz vs. in AM251 + WIN: 3.07 ± 0.77 Hz, n = 6, P > 0.05) or change in membrane potential (in AM251 + WIN: ΔV_m = 0.2 ± 0.3 mV, n = 11, P > 0.05). These results indicate that CB₁ was involved in cannabinoid-mediated modulation of mitral cell activity.

CB₁ agonist and antagonist modulate synaptic transmission in mitral cells.

As the next step, we wanted to determine if spontaneous GABAergic inputs from periglomerular cells to mitral cells might be the target of CB₁-mediated modulation. Our electrophysiological and anatomical data are consistent with CB₁-mediated modulation of periglomerular GABAergic interneurons. In this model, changes in mitral cell activity are due to modulation of GABAergic interneuron signaling in the MOB. Excitatory inputs and/or inhibitory synaptic transmission originating from GABAergic interneurons such as periglomerular cells could therefore modulate mitral cell activity. Therefore, we tested the effect of CB₁ agonists and an antagonist on GABAergic sIPSCs.

Using a low-Cl⁻ pipette solution in voltage-clamp mode at a holding potential of 0 mV, we observed sIPSCs in a subset of mitral cells. Figure 5A shows the increase of sIPSCs in response to the CB₁ antagonist AM251 in a representative mitral cell. sIPSCs in mitral cells were outwardly directed in this condition. To examine sIPSCs in mitral cells more easily, a high-Cl⁻-based pipette solution was used to observe changes in sIPSCs (Wang et al. 2012). sIPSCs in mitral cells were directed downward in this condition and could be completely blocked by 10 μM gabazine, indicating that the currents were mediated by GABA_A receptors. Figure 5B shows that the CB₁ antagonist AM251 increased the frequency of sIPSCs in the presence of CNQX plus AP5 in a representative mitral cell. Ionotropic glutamate receptor blockers (CNQX + AP5) reduced the frequency of sIPSCs (data not shown). In mitral cells, bath application of 10 μM AM251 increased the frequency of sIPSCs (in CNQX + AP5: 1.7 ± 0.4 Hz; in CNQX + AP5 + AM251: 2.3 ± 0.4 Hz, n = 7, P < 0.05) and evoked outward currents of 13.3 ± 6.4 pA (n = 7, range 4.5–27 pA), which is consistent with the inhibitory effect of AM251 on mitral cells (Fig. 4, D and F). Figure 5C shows that the CB₁ agonist WIN reduced the sIPSC frequency in a mitral cell in the presence of CNQX AP5. Bath application of WIN (1 µM) decreased the frequency of sIPSCs (in CNQX + AP5: 1.5 ± 0.1 Hz; in CNQX + AP5 WIN: 1.2 ± 0.1 Hz, n = 5, P < 0.01) and evoked inward currents of 21.6 ± 7.3 pA (n = 5). The results suggest that cannabinoids synaptically regulate mitral cell activity by regulating GABA release from interneurons.

Fig. 5.

Effects of cannabinoids on spontaneous inhibitory postsynaptic currents (sIPSCs) in mitral cells. A: original recording from a representative mitral cell shows an increase of sIPSCs in response to AM251 and the development of an outward current. Currents were recorded using a low-Cl⁻ pipette solution mode. Holding potential was 0 mV. sIPSCs were upward. B and C: original recording shows that AM251 increased and WIN 55,212-2 decreased the frequency of sIPSCs in a representative mitral cell in the presence of CNQX plus AP5. Currents were recorded at a holding potential of −60 mV using high-Cl⁻-based (CsCl) pipette solution. sIPSCs were inward (downward) in this recording condition. The trace in C is shown at an extended time scale in traces a and b. The arrows in the top trace indicate the starting point of traces a and b. D: the cumulative data of the effect of AM251 and WIN 55,212-2 on sIPSCs recorded from mitral cells. *P < 0.05, **P < 0.01, significant level.

The modulation of sIPSCs by cannabinoids was also tested in subglomerular slices in which the olfactory nerve layer and glomerular layer were removed (Dong et al. 2007; see also below). In subglomerular slices, WIN did not modulate sIPSC frequency (0.9 ± 0.08 Hz vs. in WIN: 0.9 ± 0.07 Hz, n = 5, P > 0.05) or evoke inward currents in mitral cells (ΔI =3.8 ± 0.3 pA, n = 12, P > 0.05). The failure of WIN to modulate sIPSC frequency and inward currents in mitral cells in subglomerular slices supported the idea that stimulation of periglomerular GABAergic processes modulated mitral cell activity through CB₁ activation.

Cannabinoids failed to modulate mitral cell activity in subglomerular slices.

Several types of GABAergic interneurons in the MOB express CB₁ (Moldrich and Wenger 2000) and, potentially, can be regulated through direct activation of CB₁. Periglomerular cells are likely candidates for direct effects of cannabinoids since CB₁ is robustly expressed in the glomerular layer of the MOB (Fig. 1 and Moldrich and Wenger, 2000). Periglomerular cells form a heterogeneous neuron population with different firing patterns and morphological properties (Kiyokage et al. 2010; Shao et al. 2009). We previously reported that a CB₁ agonist inhibited periglomerular cells whereas a CB₁ antagonist activated them (Wang et al. 2012), i.e., the inverse response pattern to CB₁ activation compared with mitral cells (Fig. 4). These findings suggested that CB₁ indirectly regulated mitral cell activity by modulating inhibitory inputs to mitral cells.

Potentially, another type of GABAergic interneuron was regulated by CB₁, in addition to periglomerular cells, namely granule cells in the granule layer. To determine if one or both GABAergic interneuron types played a role in mitral cell regulation, we used a subglomerular slice preparation in which the olfactory nerve layer and glomerular layer were removed (Dong et al. 2007). Mitral cell properties in subglomerular slices (V_m, input resistance, spike rates) were not significantly different from mitral cells in intact MOB slices (V_m: −49.5 ±1.7 mV; input resistance: 299 ± 42.1 MΩ; spike rates: 1 to 8 Hz; n = 18).

In subglomerular slices, WIN failed to depolarize mitral cells (Fig. 6). Compared with control conditions, in subglomerular slices WIN did not change the frequency of spiking (control: 4.58 ± 0.50 Hz vs. in WIN: 4.47 ± 0.46 Hz, n = 12, P > 0.05) or the membrane potential of mitral cells (ΔV_m =0.1 ± 0.2, n = 12, P > 0.05). Correspondingly, AM251 failed to decrease the frequency of mitral cell spiking in subglomerular slices (control: 4.00 ± 0.61 Hz vs. in AM251: 4.11 ± 0.62 Hz, n = 7, P > 0.05) or change the membrane potential (ΔV_m = 0.3 ± 0.1, n = 7, P > 0.05). These results suggested the involvement of periglomerular cells in CB₁-mediated mitral cell modulation in the glomerular layer and ruled out granule cells as modulators of mitral cell activity through CB₁ activation.

Fig. 6.

Cannabinoid receptor type 1 (CB₁) failed to modulate mitral cell activity in subglomerular slices. A: mitral cell apical dendrite from regular slice stained with Lucifer yellow. B: mitral cell from a subglomerular slice in which the apical tuft of the mitral cell is not present. Bar = 200 um. C and D: original recordings show lack of CB₁ effect on mitral cell activity in subglomerular slices; neither CB₁ antagonist AM251 (C) nor agonist WIN 55,212-2 (D) modulated mitral cell spiking rate. GCL, granule cell layer, MCL, mitral cell layer; EPL, external plexiform layer; GL, glomerular layer; ONL, olfactory nerve layer.

CB₁ effects are eliminated in blockers of fast synaptic transmission.

One potential alternative explanation for the results is that they occur via activation of CB₁ expressed by mitral cells, which would directly affect the output of mitral cells rather than their input. Similar response profiles have been seen with other G protein-coupled receptors expressed on mitral cells, e.g., mGluRs (Heinbockel et al. 2004). Previously, mitral cells were shown to express CB₁ at a low level (Moldrich and Wenger 2000). However, our immunohistochemical data suggest an extramitral site of action. For example, cannabinoids could activate CB₁ expressed by other MOB cell types such that the observed excitatory and inhibitory effects of CB₁ agonists and antagonists on mitral cells were indirect. Therefore, we applied a CB₁ agonist and antagonist in the presence of blockers of GABAergic and ionotropic glutamatergic transmission (fast synaptic blockers) (Fig. 7, A and B).

Fig. 7.

The effect of a cannabinoid receptor type 1 (CB₁) agonist and an antagonist on mitral cells in the presence of fast synaptic blockers. A: original recording shows no effect of CB₁ agonist WIN on firing rate and membrane potential in the presence of blockers of fast synaptic transmission [synaptic blockers: CNQX (10 μM), APV (50 μM), and gabazine (5 μM)]. B: original recording showed that AM251 failed to reduce the mitral cell spike rate in fast synaptic blockers.

Fast synaptic blockers, which included blockers of ionotropic glutamate and GABA_A receptors (CNQXL: 10 μM; AP5: 50 μM; gabazine: 5 μM), did not significantly change the regular firing rate and membrane potential (for the firing rate: 109.1 ± 10.0% of control, n = 20, P > 0.05, paired t-test; for the membrane depolarization: ΔV_m = 0.3 ± 0.1 mV, n = 20, P > 0.05, paired t-test). In the presence of fast synaptic blockers, AM251 (10 μM) failed to significantly decrease the firing rate (in synaptic blockers: 3.66 ± 0.64 Hz vs. in synaptic blockers + AM251: 3.74 ± 0.75 Hz, n = 9, P > 0.05) or change the membrane potential of mitral cells (ΔV_m = 0.2 ± 0.3 mV, n = 9, P > 0.05). Blockade of the AM251-evoked inhibitory effect by fast synaptic blockers indicated that CB₁-mediated regulation of mitral cell activity involved GABAergic and/or glutamatergic synaptic transmission (Fig. 5B). WIN also failed to induce an increase in firing rate (synaptic blockers: 4.01 ± 0.72 Hz vs. plus WIN: 3.95 ±tk;10.88 Hz, n = 7, P > 0.05) or membrane potential in the presence of fast synaptic blockers (ΔV_m = 0.3 ± 0.4 mV, n = 7, P > 0.05; Fig. 7A). These data suggest an indirect effect of CB₁ on mitral cells. The modulation of mitral cell activity could occur not through CB₁ on mitral cells but rather through an indirect effect of cannabinoids, namely on GABAergic processes in the glomerular layer.

DISCUSSION

Our chief finding is that activity of mitral cells, the chief output neurons of the olfactory bulb, is regulated in a CB1-dependent manner by a periglomerular interneuron network, likely based in a small subset of GAD65-positive neurons (Fig. 8). This offers additional evidence that olfactory sensory inputs to the brain are modulated by the cannabinoid signaling system.

Fig. 8.

Diagram of the glomerular network. A: olfactory nerve (ON) afferents enter the main olfactory bulb through the olfactory nerve laver to synapse with periglomerular cells (PG), mitral cells (MC), and tufted cells [of which only external ones (eTCs) are shown] within the glomerular layer. Periglomerular cells inhibit olfactory nerve terminals, external tufted cells, and mitral cells. The processes of short axon (SA) cells, which are GABAergic and dopaminergic, receive excitatory synaptic input and form extensive interconnections between glomeruli. Mitral cell apical dendrites convey sensory information to deeper layers of the main olfactory bulb. Mitral cells and tufted cells form dendrodenritic synapses with glomerular neuronal processes. B: dendrodendritic interactions of mitral cells and periglomerular cells. Cannabinoids are released nonsynaptically by mitral and potentially other cells act on cannabinoid receptors (CB1R) in periglomerular cells to modulate their synaptic release of GABA. Only the apical dendrite of the mitral cell is shown. GABAR, GABA receptors; GluR, ionotropic and metabotropic glutamate receptors. A is modified from Harvey and Heinbockel (2018) with permission of the publisher MDPI.

Using immunohistochemistry, we show that CB₁ is expressed in a GAD65-expressing subpopulation of interneurons. The CB₁ expression extended along the processes of these neurons, with a distribution restricted to the periglomerular region of the glomerular zone. The rare processes extending from the external plexiform layer may be an indication that this is where the soma resides. Knockout controls lend confidence to our immunohistochemistry staining and may account for the differences between our observed staining and that previously reported by Moldrich and Wenger (2000).

Our eCB measurements yielded evidence for the presence of CB₁ agonist 2-AG, consistent with the findings of Soria-G$ó$mez et al. (2014). The levels are at the low end of the spectrum of values reported for brain, but this may be consistent with the highly restricted expression of CB₁. Levels may also vary depending on stimulation or diurnally (Valenti et al. 2004). Other lipids were also detected but on the low side. For instance, AEA levels were detectable but quite low although AEA levels have typically been found to be lower than those for 2-AG; for instance, an early 2-AG study found 2-AG levels to be >170 times higher than AEA in brain (Stella et al. 1997). Much evidence for CB₁ signaling in neurons points toward 2-AG (Tanimura et al. 2010), but recent evidence also points to roles for AEA (e.g., Puente et al. 2011), although it should be noted that AEA has also been found to be a full agonist at TRPV1 (Smart et al. 2000). To avoid that the AEA effect is due to TRPV-1 activation in mitral cells (Fig. 4), the CB1 agonist WIN was used for subsequent experiments.

Using PCR, we found that many of the identified components of cannabinoid signaling are present in the MOB of the mouse. These proteins for these genes are mostly enzymes involved in production or breakdown of cannabinoids or related lipids. The functional roles of some of these enzymes (e.g., ABHD4) have not been clearly delineated. The most surprising result is the low expression of MGL. Genetic deletion of this enzyme has been shown to dramatically increase 2-AG levels in the brain of the mouse (Pan et al. 2011). However, there are other enzymes capable of breaking down 2-AG, such as ABHD6 and ABHD12 (Blankman et al. 2007), and it is possible that different brain regions and circuits express a differential complement of 2-AG hydrolyzing enzymes. In addition, the MGL mRNA expression may not correspond to protein levels.

The question of whether CB₂ is expressed in the brain remains controversial. CB₂ has long been associated with the immune system, but there is now some evidence of CB₂ presence in the central nervous system (reviewed in Atwood and Mackie 2010). The signal for CB₂ is at the limit of detection for our assay and is, as such, ambiguous and may be accounted for by low levels of immune-related cells that have intruded into our sample.

CB₁ effects on mitral cells and GABAergic cells in the glomerular layer.

Cannabinoids have regulatory effects on principal neurons and interneurons in the MOB. This is different from the hippocampal eCB system where bath application of cannabinoid agonist and antagonist does not lead to significant changes of interneuron membrane properties; the difference may be due to potent enzymatic machinery in the hippocampus that eliminates cannabinoids from the extracellular space (Alger 2002). The effects of cannabinoids on interneurons are typically seen as changes in synaptic transmission from interneurons onto principal neurons, e.g., a reduction of GABA release is reflected as a change in postsynaptic responses of principal neurons (Alger 2002). Our data point to a distinct reduction in firing and membrane hyperpolarization in response to CB₁ activation.

Cannabinoids synaptically modulate mitral cell activity.

Our results do not suggest that activation and inhibition of CB₁ expressed by mitral cells mediates the CB₁ effects as has been shown for direct actions of other G protein-coupled receptors on mitral cells, e.g., mGluRs (Heinbockel et al. 2004). Mitral cells have been postulated to express CB₁ (Moldrich and Wenger 2000). However, that study, making use of rat tissue, did not have the advantage of murine knockout controls, and our data presented here do not show CB₁ staining in mitral cells. A more likely explanation of our electrophysiological data is based on cannabinoids that activate CB₁ expressed by other MOB cell types such that the observed excitatory effects of CB₁ agonists on mitral cells are indirect. Changes in mitral cell activity are likely to reflect the direct activation of CB₁ on and inhibition of a subpopulation of GAD65-positive GABAergic interneurons in the MOB to regulate the GABA release and inhibitory input to mitral cells. From our experiments with subglomerular slices we conclude that 1) CB₁-mediated effects are limited to the glomerular layer and, therefore, did not involve granule cells; and 2) eCB-mediated regulation involves apical dendrites of mitral cells (Fig. 8).

Periglomerular cells are multifunctional neurons involved in neuronal circuit dynamics with several partners. Periglomerular cells form synapses onto mitral/tufted cell dendrites (Pinching and Powell 1971). On the one hand, they play a role in regulating glomerular and bulbar output by synaptically interacting with mitral and tufted cells, while at the same time they have been shown to presynaptically inhibit olfactory afferent input to the MOB (Ennis et al. 2007; Shipley and Ennis 1996). Based on our previous and current results, we postulate that periglomerular cells are candidates for direct modulation by cannabinoids, which in turn regulate synaptic input to mitral cells, i.e., sIPSCs, in the periglomerular or, more broadly, GABAergic cell to mitral cell signaling pathway.

Periglomerular cells presynaptically inhibit olfactory receptor neuron terminals in the glomerular layer of the MOB (Aroniadou-Anderjaska et al. 2000; Aungst et al. 2003; Berkowicz and Trombley 2000; Ennis et al. 2001; Hsia et al. 1999; Keller et al. 1998; Murphy et al. 2005; Palouzier-Paulignan et al. 2002; Wachowiak and Cohen 1999). At the same time, olfactory receptor neurons make direct synaptic contact with mitral and tufted cells (Pinching and Powell 1971). Sensory transmission from olfactory nerve terminals to principal neurons of the MOB, mitral and tufted cells, is mediated by glutamate acting at AMPA and NMDA ionotropic glutamate receptors (Aroniadou-Anderjaska et al. 1999; Bardoni et al. 1996; Chen and Shepherd 1997; Ennis et al. 1996, 2001; Keller et al. 1998). Possibly, besides the signaling pathway from periglomerular cells or other GABAergic cells to mitral cells, CB₁ may indirectly regulate glutamate release from olfactory nerve terminals by relieving presynaptic inhibition of glutamate release. CB₁ could regulate mitral cell activity through another signaling pathway, namely from GABAergic glomerular cells to the olfactory nerve terminals to mitral cells. This hypothesis was supported by our observation that the CB₁ antagonist AM251 increased the frequency of sIPSCs in mitral cells. In this view, eCB release in the glomerular layer inhibits GABAergic cells to reduce GABA release, relieves presynaptic inhibition of olfactory nerve afferents, and, subsequently, results in mitral cell excitation. The modulatory effect of the CB₁ agonist and antagonist on synaptic transmission to mitral cells supports the hypothesis that cannabinoid effects in mitral cells result from direct CB₁ effects on GABAergic cell processes.

In summary, we have identified components of a cannabinoid signaling system in the MOB and identified a likely interneuron-based circuit that negatively regulates the activity of the main output neurons: the mitral cells. Activation of CB₁ in this circuit will lift the interneuron-mediated inhibition and may render mitral cells more responsive to odor stimulation and synaptic input.

GRANTS

This work was supported by National of Institute of Drug Abuse Grant SR-141716. This work was also supported by the Whitehall Foundation, Latham Trust Fund, National Science Foundation Grant IOS-1355034, National Institute of General Medical Sciences Grant GM-08016 (to T. Heinbockel), and National Eye Institute Grant EY-24625 (to A. Straiker).

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the authors.

AUTHOR CONTRIBUTIONS

Z.-J.W., A.S., and T.H. conceived and designed research; Z.-J.W., S.S.-J.H., H.B.B., L.S., K.M., A.S., and T.H. performed experiments; Z.-J.W., S.S.-J.H., H.B.B., L.S., K.M., A.S., and T.H. analyzed data; Z.-J.W., S.S.-J.H., H.B.B., K.M., A.S., and T.H. interpreted results of experiments; Z.-J.W., S.S.-J.H., H.B.B., A.S., and T.H. prepared figures; Z.-J.W., A.S., and T.H. drafted manuscript; Z.-J.W., K.M., A.S., and T.H. edited and revised manuscript; Z.-J.W., H.B.B., L.S., K.M., A.S., and T.H. approved final version of manuscript.