The authors wish to apologize for errors in B3glct Tm1Nari allele nomenclature in the above article. To be consistent with MGI (J:286130) nomenclature, this corrigendum has corrected nomenclature for B3glcttm1Nari alleles (MGI:727077, MGI:6277078, and MGI:6277079).
Materials and Methods
Mice and Genotyping
The null allele (B3glcttm1.2Nari (MGI:6277079)) is referred to as B3glct-Δ11–12 (Fig. S2).
Fig. S2.
Targeting strategy for B3glcttm1Nari alleles (A) To generate the B3glcttm1.1Nari (MGI: 6266078) conditional allele (B3glct-floxed11–12), B3glcttm1Nari (MGI: 6277077) chimeras were crossed to ACTB-FLPe mice (B6;SJL-Tg(ACTFLPe)9205Dym/J; Jax Stock No: 03800) expressing flp recombinase to remove the PGK-neo cassette. To generate the null B3glcttm1.2Nari (MGI: 6277079) allele (B3glct-Δ11–12), B3glct-floxed11–12 males were crossed to Ayu1-Cre females (B6;D2-Tg(Ayu1-Cre)8Imeg;
Supplementary Information Text
Supplementary Methods
Generation of B3glct mutations in mice
The B3glcttm1Nari allele (MGI:6277077) targeted exons 11 and 12 containing amino acid residues (DDD) essential for catalytic activity of B3GLCT and was generated in C57BL/6 J embryonic stem (ES) cells (1).
B3glcttm1Nari targeted ES cells (C57BL/6 J ES cells) were injected into ICR blastocysts to generate chimeras.
Refer to Fig. S2 for generation and confirmation of conditional (B3glcttm1.1Nari (B3glct-floxed11–12), MGI: 6277078) and null (B3glcttm1.2Nari (B3glct-Δ11–12), MGI: 6277079) alleles, and Table S2 for genotyping protocols.
Table S2.
Genotyping primers and conditions for B3glctTm1Nari alleles
Primer names are followed by a letter in parenthesis that corresponds to positions of primers indicated in Fig. S2. All PCR reactions were carried out using 0.033 U/μL Denville Scientific’s Choice Taq DNA Polymerase in a final concentration of 1X PCR Buffer (1.5 mM MgCl2), and 0.2 mM dNTPs.
| B3glct Allele | Primer Name [Concentration] | Primer Sequence 5′ ➔ 3′ | Product size | PCR Conditions |
|---|---|---|---|---|
| Wild-type and -floxed11–12 (tm1.1Nari) MGI: 6277078 | MK 14–36 (c) [0.2 μM] | AATGATCAGAGGGAATGACAGT | 109 bp | 95°C—2 min |
| MK 14–41 (d) [0.2 μM] | CAATTCCGGACAATGTCACTCGC | 181 bp | 95°C—30 s | |
| Wild-type and -floxed11–12 (tm1.1Nari) | MK 14–28 (a) [0.2 μM] | CAGTGTCCTTGATCACTGATCCA | 286 bp | 64°C—30 s |
| MK 14–29 (b) [0.4 μM] | GCCGCAAGCCTCCGTGCTTGCA | 354 bp | 72°C—30 s (x30 cycles) | |
| -Δ11–12 (tm1.2Nari) MGI: 6277079 | MK 14–28 (a) [0.2 μM] | CAGTGTCCTTGATCACTGATCCA | 252 bp | 72°C—10 min |
| MK 14–41 (d) [0.1 μM] | CAATTCCGGACAATGTCACTCGC | 15°C—hold |