Summary
Impaired ribosome function is the underlying etiology in a group of bone marrow failure syndromes called ribosomopathies. However, how ribosomes are regulated remains poorly understood, as are approaches to restore hematopoietic stem cell (HSC) function attributable to defective ribosome biogenesis. Here we reveal a role for the E3 ubiquitin ligase HectD1 in regulating HSC function via ribosome assembly and protein translation. Hectd1-deficient HSCs exhibit a striking defect in transplantation ability and ex vivo maintenance, concomitant with a reduced protein synthesis and growth rate under stress conditions. Mechanistically, HectD1 ubiquitinates and degrades ZNF622, an assembly factor for the ribosomal 60S subunit. HectD1 loss led to an accumulation of ZNF622 and the anti-association factor eIF6 on the 60S, resulting in 60S/40S joining defects. Importantly, Znf622 depletion in Hectd1-deficient HSCs restored ribosomal subunit joining, protein synthesis, and HSC reconstitution capacity. These findings highlight the importance of ubiquitin-coordinated ribosome assembly in HSC regeneration.
Keywords: Hematopoietic stem cells (HSCs), ubiquitin, signaling, ribosome biogenesis, protein synthesis, ribosome assembly
Graphical Abstract

In Brief (blurb)
Tong and colleagues uncover a key role for ubiquitin-dependent regulation of ribosomal assembly and protein synthesis in hematopoietic stem cell regeneration. Depletion of an E3 ligase, Hectd1, impairs ribosomal subunit joining and protein translation efficiency by promoting retention of its substrate ZNF622 in regenerating hematopoietic stem cells during stress.
Introduction
At the steady-state, protein synthesis rate is low in adult hematopoietic stem cells (HSCs) as compared with committed progenitors or differentiated cells (Signer et al., 2014). Tightly-regulated protein synthesis rate is critical for HSC maintenance and function (Signer et al., 2014; Signer et al., 2016). HSC expansion under regenerative or stress conditions demands increased ribosome biogenesis and protein synthesis. Appropriate ribosome biogenesis and assembly ensures the translation efficiency and fidelity of proteins, which are important for normal development as well as prevention of cancer. Mutations in ribosomal proteins and gene products affecting ribosome biogenesis and protein synthesis are associated with human diseases marked by hematopoietic dysfunction (Sulima et al., 2017). However, how ribosome assembly is regulated in HSCs remains poorly understood, as is its contribution to hematopoietic diseases.
The biogenesis of the two ribosomal subunits 40S and 60S occurs largely in the nucleus; upon nuclear export, they separately undergo final stages of maturation in the cytoplasm that are regulated by distinct assembly factors and incorporation of the last few cytoplasmic ribosome proteins (de la Cruz et al., 2015). These assembly factors proofread and protect key functional sites on the ribosome and prevent premature joining of 60S and 40S subunits, to ensure regulated formation of functional 80S monosomes and appropriate translation (Klinge and Woolford, 2019). “Ribosomopathies” are characterized by a group of inherited bone marrow failure (BMF) syndromes with impaired ribosome function. Individuals with “ribosomopathies” are deficient in HSCs or specific lineages of blood formation, and yet are predisposed to elevated leukemia and cancer risks (Ruggero and Shimamura, 2014). One such example is Shwachman-Diamond syndrome (SDS), that is etiologically linked to ribosome dysfunction arising from mutations of ribosome assembly factors (Warren, 2018; Woloszynek et al., 2004). Germline mutations in three different genes (SBDS, DNAJC21, and EFL1) involved in the 60S maturation and assembly all cause SDS (Boocock et al., 2003; Dhanraj et al., 2017; Tan et al., 2019; Tummala et al., 2016; Woloszynek et al., 2004), implying that HSCs are especially sensitive to perturbations in ribosome assembly. These mutations result in ribosomal subunit joining defects and decreased protein synthesis rate (Finch et al., 2011; Menne et al., 2007; Tan et al., 2019; Wong et al., 2011). The question of how ribosomal abnormalities cause marrow failure and cancer predisposition is therefore of fundamental biological and clinical interest. However, how assembly factors themselves are regulated and their impact on hematopoietic regeneration remain poorly understood.
HectD1, a member of HECT domain E3 ligases, plays an indispensable role in early embryogenesis. The HECT domain of HectD1 catalyzes the ubiquitination of its substrates to modulate protein stability, protein-protein interaction, and cellular localization. HectD1 has been reported to regulate various biological processes, including signaling transduction, gene transcription, development, and lipid homeostasis (Aleidi et al., 2018; Li et al., 2015; Sarkar and Zohn, 2012; Sugrue et al., 2019; Tran et al., 2013). Here, we identify HectD1 as a critical determinant of HSC function via its direct ubiquitination of ribosomal assembly factor. This discovery provides an important new facet to our understanding of ubiquitin-coordinated ribosomal assembly in stem cell biology.
Results
Generation of a conditional Hectd1 knockout mice in hematopoietic cells.
Hectd1 germline knockout (KO) leads to mouse embryonic lethality due to defects in neural tube closure and impaired placenta development (D’Alonzo et al., 2019; Sarkar et al., 2014; Zohn et al., 2007). To explore a potential role for HectD1 in hematopoiesis, we studied a conditional Hectd1 knockout (cKO) mouse model (Figure S1A). The floxed alleles of Hectd1 that target exon 3 (Hectd1f/f) were crossed with Vav-cre transgenic mice, in which the Cre recombinase is under the control of the Vav promoter to allow pan-hematopoietic excision of Hectd1 in all hematopoietic cells (Hectd1f/f;Vav). Deletion of exon 3 is predicted to generate an early stop codon in exon 4, thus producing a non-functional 50 amino acid truncated protein. To evaluate deletion efficiency, we plated bone marrow (BM) cells from Hectd1f/f and Hectd1f/f;Vav mice into semisolid methylcellulose culture and confirmed a nearly 100% deletion efficiency by genotyping individual colonies (Figure S1B). Quantitative PCR analysis (qRT-PCR) demonstrated the specific targeting of exon 3 of the Hectd1 gene (Figures S1C and S1D). Moreover, HectD1 protein was undetectable in Hectd1f/f;Vav BM cells (Figure S1E). Together, these data suggest that Hectd1 was efficiently and specifically deleted in all hematopoietic cells in our cKO mouse model.
Hectd1 deficiency impairs HSC repopulation capacity and decreases functional HSC frequency
To elucidate the impact of Hectd1 loss on homeostatic hematopoiesis, we first investigated the hematological parameters in young adult mice. Complete blood count (CBC) analysis and flow cytometry of different lineages of blood cells from Hectd1f/f;Vav mice showed largely normal blood counts compared with their Hectd1f/f littermates (Figures S2A and S2B). Total BM cellularity and spleen weight were also indistinguishable from controls (Figures S2C and S2D). We then characterized the hematopoietic stem and progenitor cells (HSPCs) in the BM and spleen. Hectd1f/f;Vav mice showed comparable HSPC frequencies and numbers to those of Hectd1f/f controls (Figures S2E–S2H), ie, long-term stem cells (LT-HSCs, Lin−Sca1+c-Kit+Flk2CD150+CD48−), short-term stem cells (ST-HSCs, Flk2−CD150−CD48− LSK), various multipotent progenitors (MPPs) (Lv et al., 2017). Furthermore, we observed no difference in the frequency and number of committed progenitor cells in the BM by flow cytometry (Figures S2I and S2J) or functional progenitors by colony-forming-cell (CFC) assay (Figure S2K). Interestingly, the spleen of Hectd1f/f;Vav mice displayed a significant increase in CMP and MEP progenitors (Figures S2L and S2M), and accordingly, more CFU-E and CFU-GM colonies as compared to their Hectd1f/f littermates (Figure S2N). Moreover, the cell cycle status or apoptosis in HSCs and MPPs remained unchanged (Figures S2O–2Q). These observations indicate relatively normal hematopoiesis in young adult Hectd1f/f;Vav mice under homeostatic conditions.
To assess the consequences of Hectd1 loss in HSC function in vivo, we performed competitive BM transplantation (BMT) assay by injecting 1×106 total BM cells from Hectd1f/f or Hectd1f/f;Vav donor mice (CD45.2) with an equal number of BM cells from competitor mice (CD45.1) into lethally irradiated recipients (CD45.1/CD45.2) (Figure 1A). Donor chimerism in the peripheral blood (PB) of the recipients was determined by flow cytometry every 4 weeks post-BMT. Of note, donor-derived cell percentages from Hectd1f/f;Vav mice were considerably decreased compared with control mice as early as 4 weeks, and exhibited a progressive decline over time (Figures 1B and 1C), indicating a defect in LT-repopulating HSCs. Hectd1 loss did not affect lineage distribution in the transplanted recipients (Figures 1D and S3A–S3D). Importantly, the percentages of donor-derived HSPC populations from Hectd1f/f;Vav mice were substantially decreased in comparison to Hectd1f/f controls (Figure 1E), indicating a reduction in HSC reconstitution. To further examine the impact of Hectd1 loss on HSC self-renewal, we performed secondary BMT by injecting 1×106 total BM cells from primary transplanted mice into secondary recipients. Defective reconstitution from Hectd1f/f;Vav mice was further exacerbated in secondary transplantation (Figure 1F). Thus, these data indicate that Hectd1f/f;Vav mice have inferior long-term BM repopulating HSCs with reduced self-renewal.
Figure 1. Hectd1-deficient BMs display a defective reconstituting ability and reduced functional HSC frequency.

(A) Experimental scheme of serial BM transplantation assay.
(B) Representative flow plots of donor/competitor/host chimerism in the peripheral blood (PB) of recipient mice after transplantation.
(C) Donor chimerisms in the PB of recipient mice were measured every 4 weeks and the results are graphed. Hectd1f/f (n=11) and Hectd1f/f;Vav (n=11).
(D) Lineage reconstitutions of donor-derived cells in primary recipients at 16 weeks post-transplantation are shown. Hectd1f/f (n=11) and Hectd1f/f;Vav (n=11).
(E) Percentages of donor-derived HSPC subpopulation in the BM of primary transplanted mice at 16 weeks are shown. Hectd1f/f (n=6) and Hectd1f/f;Vav (n=6).
(F) Donor percentages in the PB of secondary BMT recipients were analyzed every four weeks and the results are graphed. Hectd1f/f (n=10) and Hectd1f/f;Vav (n=11).
(G) Experimental scheme of limiting dilution BMT to assess functional HSC frequency of Hectd1f/f and Hectd1 f/f;Vav BMs. (H) The results are presented as number of positively engrafted mice versus total number of mice analyzed for the indicated doses. Positive engraftment was defined as >1% donor-derived cells in the PB. CRU: competitive repopulating unit. 1SE: one standard deviation.
(I) Donor chimerisms in the PB of recipient mice transplanted with different doses of BM cells at 16 weeks are shown. 100k: Hectd1f/f (n=5) and Hectd1f/f;Vav (n=6); 30k: Hectd1f/f (n=10) and Hectd1f/f;Vav (n=13); 10k: Hectd1f/f (n=9) and Hectd1f/f;Vav (n=7). In all relevant panels, each symbol represents an individual mouse; bars indicate mean frequencies; error bars indicate SE. *: p<0.05; **: p<0.01; ***: p<0.001; ns: not significant, as determined unpaired by two-tailed Student’s t-test.
To functionally quantify HSC frequency, we next employed limiting dilution BMT (Figure 1G). A graded dose of BM cells from Hectd1f/f and Hectd1 f/f;Vav mice mixed with a fixed number of competitor cells were transplanted into lethally irradiated recipient mice. 16 weeks after BMT, mice with donor percentage higher than 1% were defined as “positive reconstitution” (Bersenev et al., 2008). We found that Hectd1f/f;Vav mice harbored a 4-fold reduction in functional HSC frequencies in the BM by ELDA analysis (extreme limiting dilution analysis) (Figure 1H) (Hu and Smyth, 2009). Hectd1f/f;Vav BM cells exhibited consistently reduced donor chimerisms in the recipients transplanted at all doses of donor cells (Figures 1I and S3E–S3G). Since HectD1 was reported to be involved in protein secretion and cell migration (Duhamel et al., 2018), we asked if Hectd1 loss could affect BM niche or in a cell extrinsic manner. Therefore, we performed reciprocal BMT by injecting BM cells from wildtype mice (CD45.1) into Hectd1f/f or Hectd1f/f;Vav mice as recipients (CD45.2) (Figure S3H). Donor chimerism as well as lineage distribution in the PB and HSPCs in the BM were comparable among recipients of both genotypes (Figures S3I–S3K). Taken together, our data provide strong evidence that Hectd1 insufficiency reduces frequencies of functional HSCs in the BM.
Hectd1 insufficiency diminishes HSC reconstituting activity in vivo and HSC growth ex vivo
To further address if the decreased repopulation observed in total BM transplantation is due to intrinsic HSC properties, we purified LT-HSCs (LSK CD150+CD48−) from Hectd1f/f and Hectd1 f/f;Vav mice by flow cytometric sorting and transplanted 100 HSCs into each lethally-irradiated recipient along with Sca1-depleted BM competitors (Figure 2A) (Balcerek et al., 2018). Our results demonstrated that Hectd1-deficient HSCs exhibited inferior reconstitution ability to that of control HSCs in vivo (Figure 2B). Importantly, donor-derived HSPCs in the BM of recipient mice transplanted with Hectd1-deficient HSCs were significantly reduced when compared with those from control HSCs (Figure 2C), indicating Hectd1 insufficiency decreases intrinsic HSC activity.
Figure 2. HectD1 is required for HSC self-renewal in vivo and maintenance ex vivo.

(A) Experimental scheme of HSC transplantation assay. LT-HSCs (LSK CD150+CD48−) from Hectd1f/f and Hectd1 f/f;Vav mice were purified by flow cytometric sorting and 100 HSCs were either injected with 500K Sca1-depleted competitor BMs into lethally irradiated recipient mice (Day0-BMT) or the resultant culture after 12 days was injected with 300K BMs into recipient mice (Day12-BMT).
(B) Donor chimerisms in the PB of recipient mice transplanted with fresh HSCs (day0-BMT) were measured every 4 weeks and the results are shown in the graph. Hectd1f/f (n=8) and Hectd1f/f;Vav (n=8).
(C) Percentages of donor-derived HSPC subpopulations in the BM of day0-BMT recipient mice 16 weeks post-transplant are shown. Hectd1f/f (n=6) and Hectd1f/f;Vav (n=5).
(D) Donor chimerisms of day12 cultured HSC transplants (Day12-BMT) in the PB of recipient mice were measured every 4 weeks and the results are shown in the graph. Hectd1f/f (n=7) and Hectd1f/f;Vav (n=5).
(E) Percentages of donor-derived HSPC subpopulations in the BM of day12-BMT recipient mice 16 weeks post-transplant are shown. Hectd1f/f (n=6) and Hectd1f/f;Vav (n=4).
(F) Representative images of ex vivo cultured HSCs at day 8.
(G-I) Cell numbers of ex vivo cultured HSCs at different time points in different combinations of cytokines are shown. n=3 in each group.
(J) Experimental scheme of HSC versus MPP/HPC transplantation assay. HSCs (LSK CD150+CD48−) or MPP/HPCs (LSK CD150−CD48+) were sorted from Hectd1f/f and Hectd1 f/f;Vav mice. 500 HSCs or 5000 MPP/HPCs were transplanted into each sub-lethally irradiated recipient mice.
(K-L) Donor chimerisms in the PB of recipient mice were measured by flow cytometry every week post-BMT. Donor chimerisms of HSC (K) and MPP/HPC (L) transplants are shown. Hectd1f/f (n=7–9) and Hectd1f/f;Vav (n=6–7).
Data in (G-I) are represented by mean± SD. In all relevant panels, each symbol represents an individual mouse; bars indicate mean frequencies; error bars indicate SE. *: p<0.05; **: p<0.01; ***: p<0.001, as determined by unpaired two-tailed Student’s t-test.
See also Figure S3L–S3M.
We next analyzed the influence of HectD1 on the maintenance of HSC function upon ex vivo culture. Purified HSCs were cultured in media containing a combination of cytokines SCF, TPO, FLT3L and IL6 for 12 days. The resultant cultured cells from 100 HSCs were transplanted (Figure 2A). Our data revealed that Hectd1 insufficiency failed to maintain HSCs ex vivo, which was accompanied by a marked reduction in reconstituting capacity (9.0% cultured HSCs vs 57.8% fresh HSCs reconstitution at 16 weeks), while control HSCs showed comparable reconstitution after culture (92.0% cultured HSCs vs 82.0% fresh HSCs) (Figure 2D). Moreover, examination of donor-derived HSPCs in the BM of recipient mice revealed that Hectd1-deficient HSCs completely lost their stem cell identity in culture (Figure 2E). Importantly, we found that Hectd1-deficient HSCs had a visibly slower growth rate than control HSCs ex vivo as determined by enumeration of cell numbers, and this phenotype persisted irrespective of cytokines used in culture (Figures 2F–2I). Taken together, our data suggest that HectD1 is critical for HSC function in vivo and HSC growth ex vivo.
Since HectD1 is widely expressed in a range of hematopoietic cells, we asked if HectD1 is preferentially required for HSC function. To test this, we injected 500 purified HSCs (LSK CD150+CD48−) or 5000 MPPs/ hematopoietic progenitors (HPCs) (LSK CD150−CD48+) (Oguro et al., 2013; Pietras et al., 2015; Wilson et al., 2008) from Hectd1f/f and Hectd1 f/f;Vav mice into each sub-lethally irradiated recipient and analyzed donor chimerism every week post-BMT (Figure 2J). Of note, our results showed that Hectd1 deficiency markedly decreased HSC reconstitution ability, but not that of MPP/HPCs (Figures 2K, 2L and S3L, S3M), indicating that HectD1 plays a critical role in regulating HSC function.
HectD1 interacts with, ubiquitinates and regulates the stability of ZNF622
To study the mechanisms underlying the reduced growth of Hectd1-deficient HSPCs, we first evaluated known signaling pathways important for HSC function, ie, JAK-STAT, PI3K-AKT, MAPK-ERK, mTOR, GSK3 and β-catenin pathways (Figure S4A). However, none of these signaling molecules were altered, except for a significant reduction of phospho-RPS6 (pRPS6) in both freshly isolated and cultured Hectd1-deficient LSK cells (Figures 3A and S4B).
Figure 3. HectD1 interacts with, ubiquitinates, and degrades ZNF622.

(A) Freshly purified LSKs from Hectd1f/f and Hectd1 f/f;Vav mice were used to examine various signaling molecules by WB using the indicated antibodies.
(B) TF-1/hMPL cells stably depleted of HECTD1 using two different shRNAs were generated along with shRNA to Luciferase (Luc). Cell lysates were subjected to WB analysis using indicated antibodies.
(C, D) TF-1/hMPL shLuc or shHECTD1 cells were cultured in triplicates in different concentrations of GM-CSF (D) or TPO (D). Cell growth after 3 days’ culture were determined by MTT absorbance.
(E) Silver staining gel image of a representative large-scale protein purification result to evaluate the efficiency and specificity of affinity purification of HA-HectD1 interacting proteins. * indicates the HA-HectD1 bait. IgG-H: indicates the Immunoglobin heavy chain.
(F) CRAPome analysis of Hectd1-intearacting proteins from three independent IP-MS results revealed the SAINT probability over fold changes. ZNF622 was identified as an Hectd1 interactor and highlighted in red.
(G) co-IP/WB analysis confirmed the interaction between Flag-ZNF622 and endogenous HectD1 in Flag-ZNF622 reconstituted TF-1 cells.
(H) ZNF622 protein levels were increased in Hectd1 f/f;Vav LSKs compared to that of Hectd1f/f LSKs.
(I) Quantification of ZNF622 protein levels from three independent experiments as in (H) is plotted.
(J) ZNF622 mRNA levels were not affected in Hectd1-deficient LSKs as shown by qRT-PCR analysis. n=3 in each group.
(K) TF-1 cells stably depleted of HECTD1 using two different shRNAs were treated with cycloheximide (CHX) for indicated times. ZNF622 half-lives were determined by WB. Representative blots of 3 independent experiments are shown. S.E., short exposure; L.E., long exposure.
(L) Relative ZNF622 levels normalized to Luc time 0 (left panel) and that normalized to respective time 0 (right panel) as shown in (J).
(M) 293T cells were transfected with HA-HectD1 or E3-dead mutant HectD1, along with Flag-ZNF622 and His-Ub or Ub mutant constructs as indicated. Cells were subjected to lysis in denatured condition followed by Ni2+ beads-pulldown. Ubiquitinated proteins were detected by WB using indicated antibodies.
In all relevant panels, data are represented by mean± SD. p-values are determined by unpaired two-tailed Students’ t-test. *: p<0.05; **: p<0.01; ***: p<0.001
See also Figure S4.
To facilitate downstream biochemical studies, we resorted to cytokine-dependent human progenitor cell line, TF-1 cells. Using two different shRNAs to stably deplete HECTD1 in human TF-1 cells, in comparison to Luciferase (Luc) control (Figure 3B), we observed a significant growth retardation in the presence of TPO or GM-CSF upon HECTD1 knockdown (Figures 3C and 3D), consistent with findings from HSPCs (Figures 2F–2I). TF-1 cells also recapitulated the signaling defects observed in primary LSK cells, which is a reduction in RPS6 phosphorylation but not any other pathways we examined (Figures S4C–S4E). Thus, TF-1 cells appear to be a reliable and robust cell system for us to further dissect HectD1 functions.
Intriguingly, the reduction of pRPS6 seemed to be independent of mTOR pathway since p-mTOR, p4E-BP1, pS6K1 and a S6K1 substrate pZRF (Barilari et al., 2017) were not changed (Figures 3A and S4B). This led us to hypothesize that HectD1 might directly ubiquitinate RPS6 or regulate S6K1-RPS6 interaction as K63-ubiquitination is known to affect protein complex formation (Shembade and Harhaj, 2015). However, neither RPS6 ubiquitination nor the S6K1-RPS6 interaction was impacted by HectD1 E3 dead mutant C2579G (Mut) (Sarkar and Zohn, 2012) or HECTD1 knockdown (Figures S4F–S4H), implying that HectD1 indirectly affects RPS6 phosphorylation. The phospho-RPS6 has been shown to control the RiBi-(ribosome biogenesis) gene transcriptional program (Chauvin et al., 2014). We found that Hectd1-deficient HSCs did not exhibit changes in either total RNA level that is predominantly rRNAs or the mRNA level of the RiBi genes relatively to that of control cells (Figures S4I and S4J).
In an attempt to explore the molecular mechanism underlying the important role for Hectd1 in HSCs in a comprehensive and unbiased manner, we set out to identify HectD1 substrates by affinity purification of HectD1 interacting protein complex using mass spectrometry (MS). We transfected HA-tagged HectD1 or vector alone into HEK293T cells. HectdD1-interacting proteins were immunoprecipitated (IP) using anti-HA agarose beads, followed by HA peptide affinity elution. Glycine elution after HA elution detected very few bound proteins, and the non-specific proteins remained associated with the agarose beads upon boiling in SDS loading buffer, indicating the specificity and robustness of HA-affinity purification (Figure 3E). We thus subjected the HA eluates to MS analysis along with vector control. Triplicates of IP-MS were performed and results were evaluated using the CRAPome (Contaminant Repository for Affinity Purification) analysis (Mellacheruvu et al., 2013). We ranked and selected the potential interacting proteins with the cutoff of SAINT (Significance Analysis of INTeractome) score ≥0.5 and fold change (FC) ≥3 (Figure 3F). Gene ontology (GO) analysis revealed a high enrichment of ribosome/translation-related proteins and proteasome proteins (Figure S5A and Supplementary Table S1), which is in agreement with the role of HectD1 as an E3 ubiquitin ligase and regulator of cell growth. Additionally, it suggested a potential role for HectD1 in ribosomes and protein synthesis.
Among the top hits, we focused on ZNF622 protein, given the critical role of its yeast homolog Rei1 in ribosome biogenesis (Greber et al., 2016; Meyer et al., 2010). The interaction between HectD1 and ZNF622 was first confirmed in Flag-ZNF622 reconstituted TF-1 cells by co-IP (Figure 3G). Next, we generated a series of deletion mutants of HectD1 and ZNF622, and transfected them into 293T cells, followed by IP/WB analysis to map the responsible domain(s) for their interaction. Our data showed that Hectd1 interacted with ZNF622 regardless of its E3 activity as both HA-Hectd1 WT, and E3 dead mutant C2579G (Mut), but not vector control could pull down endogenous ZNF622. We also found that the Sad1/UNC domain of HectD1 is responsible for its interaction with ZNF622 (Figures S5B and S5C). Furthermore, deletion of either ZnF2 domain or the first linker region (LR1) located in the N-terminus of ZNF622 completely abolished its interaction with HectD1 (Figures S5D and S5E). Interestingly, cryo-EM analysis has revealed that that these two regions of Rei1 are located outside of the polypeptide tunnel (Greber et al., 2016; Kargas et al., 2019), rendering it accessible to HectD1 interaction.
Next, we asked if HectD1 regulates ZNF622 ubiquitination and protein stability. We found that Hectd1 deficiency increased ZNF622 protein, but not mRNA levels in LSK cells (Figures 3H–3J). Consistently, ZNF622 protein but not mRNA level was increased in HECTD1-depleted TF-1 cells (Figures 3K, 3L and S5F). Importantly, the half-life of ZNF622 proteins was significantly prolonged in HECTD1-depleted TF-1 cells in the presence of cycloheximide (CHX) that blocks nascent protein synthesis (Figures 3K and 3L). Next, we analyzed ZNF622 ubiquitination status impacted by HectD1 using Nickel-beads (Ni-NTA) pulldown of His-tagged Ub under denatured conditions to capture direct Ub-conjugation in ZNF622 proteins while reducing the detection of its associated proteins. Our data demonstrated that ZNF622 was robustly ubiquitinated by WT HectD1, but not the C2579G mutant. Moreover, consistent with the notion of HectD1 being an E3 ligase for lysine63-polyubiquitination (K63-Ub) (Sarkar and Zohn, 2012), K63R, but not K48R Ub mutant, abolished ZNF622 ubiquitination (Figure 3M), further demonstrating that ZNF622 is a direct substrate of HectD1. Taken together, our data suggest that HectD1 interacts with, ubiquitinates and regulates the stability of ZNF622.
Hectd1 insufficiency decreases HSPC proliferation and global translation rates upon stress
The HectD1 IP-MS data and the interaction between HectD1-ZNF622 promoted us to investigate a potential role for HectD1 in protein synthesis and ribosome biology. To test this, we performed in vivo OP-puro (O-propargyl Puromycin) assay in primary adult Hectd1f/f and Hectd1 f/f;Vav mice to evaluate protein synthesis rate (Liu et al., 2012). We found that HSCs exhibited a lower protein synthesis rate than restricted progenitors and mature hematopoietic cells (Figures S5G and S5H), consistent with the previous report (Signer et al., 2014). However, Hectd1 insufficiency did not affect protein synthesis rates in any of the hematopoietic cell subsets at the steady state (Figure S5H).
Our data showed that Hectd1 deficiency does not affect phenotypic HSC number in the steady state (Figure S2G), but dramatically decreases functional HSCs in the transplantation assay or ex vivo culture, both of which conditions force HSCs to proliferate (Figures 1 and 2). Thus, we investigated if HectD1 is critical for HSC proliferation in vivo under stress conditions. We subjected the mice to two different types of stress. We first challenged Hectd1f/f and Hectd1f/f;Vav mice with cytoablative drug 5-fluorouracil (5-FU), which depletes cycling hematopoietic cells and drives primitive HSCs to regenerate. At day 10 after 5-FU administration, Hectd1 f/f;Vav mice exhibited a pronounced reduction in BM HSC and MPP numbers in comparison to the control mice (Figure 4A). Notably, both Hectd1 deficient HSCs and MPPs showed reduced protein synthesis rate using the OP-Puro assay (Figures 4B and 4C), which correlated with their slower cycling status than the controls as determined by BrdU incorporation (Figure 4D). We did not observe elevated cell death under 5-FU stress (Figure S5I). To consolidate the conclusion of HectD1 function under stress conditions, we subjected mice to cyclophosphamide treatment followed by two daily doses of GCSF to induce HSPC proliferation (Morrison et al., 1997). In agreement, our data revealed lower HSC and MPP numbers (Figure 4E), slower cell cycle kinetics, as well as decreased protein synthesis rate in Hectd1 f/f;Vav mice in comparison to the controls (Figures 4F–4H).
Figure 4. Hectd1 deficiency reduces HSC frequency and protein translational rate upon proliferative stress.

(A-D) Hectd1 f/f and Hectd1 f/f;Vav mice were injected with 150mg/kg 5-FU, and euthanized at 10 days later for subsequent analysis.
(A) HSC and MPP numbers in the BM of 5-FU challenged Hectd1 f/f (n=8) and Hectd1 f/f;Vav (n=8) mice are shown.
(B) Representative histogram plot of protein synthesis rate in BM HSCs of 5-FU challenged mice as determined by in vivo OP-Puro assay.
(C) Quantification of protein synthesis rate in HSCs and MPPs of 5-FU challenged Hectd1 f/f (n=6) and Hectd1 f/f;Vav (n=5) mice as shown in (B).
(D) Percentages of BM HSCs and MPPs in the S phase of the cell cycle as determined by in vivo BrdU assay. Hectd1f/f (n=3) and Hectd1 f/f;Vav (n=3).
(E-H) Hectd1 f/f and Hectd1 f/f;Vav mice were injected with cyclophosphamide (Cy) followed by two consecutive daily injections of G-CSF. Mice were euthanized one day after the last injection for subsequent analysis.
(E) HSC and MPP numbers in the BM of Cy+2GCSF challenged Hectd1 f/f (n=7) and Hectd1 f/f;Vav (n=7)mice. Data are pooled from 4 independent experiments and unique symbols indicate mice from different experiments.
(F) Representative histogram plot of protein synthesis rate in BM HSCs of Hectd1 f/f and Hectd1 f/f;Vav mice as determined by in vivo OP-Puro assay.
(G) Quantification of protein synthesis rate in HSCs and MPPs of Hectd1f/f (n=4) and Hectd1 f/f;Vav (n=4) mice as shown in (F).
(H) Percentages of BM HSCs and MPPs in the S phase of the cell cycle as determined by in vivo BrdU assay. Hectd1f/f (n=3) and Hectd1 f/f;Vav (n=4).
(I) Protein synthesis rates of 2-day cultured LSKs from Hectd1f/f and Hectd1 f/f;Vav mice were determined by OP-puro incorporation of newly synthesized protein after 1hr labelling. Representative histogram plot is shown.
(J) Quantification of relative protein synthesis rates of 2-day cultured LSKs from three independent experiments using OP-Puro assays as shown in (I).
(K) Relative CFU-GM progenitors from Hectd1f/f (n=3) and Hectd1 f/f;Vav (n=3) BMs in the presence of various concentrations of the translation elongation inhibitor puromycin is shown.
Data in (A, C, D, E, G and H) are represented by mean± SE. Data in (J, and K) are represented by mean± SD. p-value in (E) is determined by paired two-tailed Students’ t-test; p-values in other panels are determined by unpaired two-tailed Students’ t-test. *: p<0.05; **: p<0.01; ***: p<0.001; ns, not significant.
See also Figure S5.
Next, we examined OP-Puro incorporation in ex vivo cultured LSK cells, which were also undergoing proliferative stress. Hectd1-deficient cells displayed a decrease in global translation rate by >20% when compared to control LSKs (Figures 4I and 4J). Consistently, Hectd1-deficient BM progenitors were hypersensitive to puromycin, an inhibitor of translation elongation (Figure 4K). Of note, this observed translation defect in both primary LSK cells and TF-1 cells was independent of eIF2α or 4E-BP1 phosphorylation, two key regulators of translation initiation (Figures S4B–S4E) (Holcik and Sonenberg, 2005). Taken together, we demonstrate that HectD1 plays a critical role in HSPC proliferation and protein synthesis under hematopoietic stress.
Hectd1 deficiency disrupts ZNF622-mediated 60S ribosome maturation and 60S/40S subunit joining
To dissect molecular mechanisms by which HectD1 regulates ribosome assembly and protein translation, we examined whether HectD1 affects ribosome composition by polysome profiling assay. Cell lysates of equal RNA content were fractionated in a sucrose gradient, followed by recording of the ultraviolet (UV) absorbance of each fraction. Hectd1-null LSK cells displayed an increased 60S content but decreased 80S monosome and polysome, while 40S remained unchanged (Figure 5A). This phenotype was also observed in HECTD1-depleted TF-1 cells (Figure 5B). These data indicated a previously-unrecognized role for HectD1 in regulating ribosome assembly and proper global translation.
Figure 5. Hectd1 deficiency results in an accumulation of ZNF622 and eIF6 in the 60S and a reduction in ribosomal subunit joining, which is restored by ZNF622 depletion.

(A) Polysome profiling analysis of 2 day-cultured LSKs from Hectd1f/f and Hectd1 f/f;Vav mice.
(B) Quantifications of 60S:40S ratio (left panel) and 60S:80S ratio (right panel) from polysome profiling assay of TF-1 cells expressing shLuc or shHECTD1. Three independent experiments were performed.
(C) Fractions from sucrose gradients (7%−45%) of TF-1 cell lysates stably expressing shLuc or shHECTD1 were collected and subjected to WB analysis. Representative result of three independent experiments is shown. Fractions 1–3 are cytoplasmic soluble proteins. 40S, 60S, 80S monosome and polysome fractions are indicated by colored lines, arrows, and fonts. Whole cell lysate (WCL). AF: assembly factor; RPL: ribosome protein large unit; RPS: ribosome protein small unit. WCL and sucrose fractions (shLuc and shHECTD1) were resolved in three SDS-PAGE gels in parallel. Sucrose fraction immunoblots were processed and developed in parallel, and images presented side-by-side.
(D) Quantification of relative protein distribution in different polysome fractions as shown in (C). Relative protein levels in each fraction was normalized to the peak fraction of the indicated protein from the shLuc cells and plotted. n=3–4.
(E-J) Knockdown of ZNF622 in HECTD1-deficient cells rescues ribosome composition, eIF6 release, as well as 60S/40S joining.
(E) WB examination of knockdown efficiency in shLuc, HECTD1 single and HECTD1;ZNF622 double knockdown (DKD) cells.
(F) Representative polysome profiles of TF-1 shLuc, HECTD1 and DKD cells.
(G) Quantifications of 60S:40S ratio (left panel) and 60S:80S ratio (right panel) of polysome profiles as shown in (F). n=3.
(H) Representative result of WB analysis with protein fractions from sucrose gradients (7%−45%) of TF-1 shLuc, HECTD1 and DKD cells (top panel). Quantification of eIF6 distribution in polysome fractions (bottom panel). N=3.
(I) Ribosome dissociation/reassociation assay. Indicated TF-1 cell lines were lysed in 0.25mM low Mg2+ buffer to dissociate ribosomal subunits (Top graph). MgCl2 was subsequently added to a final concentration of 10mM for ribosomal subunit reassociation (Bottom graph). Resultant cell lysates were loaded on a 7–45% sucrose gradient profiled. Representative graphs from three independent experiments are shown.
(J) Quantification of 60S:40S ratios in the dissociated profiles (Top panel) and 80S:40S ratios in the reassociated profiles (Bottom panel). N=3. Note that the black line (shLuc) and the blue line (DKD) in (F, H and I) superimpose.
All data are represented by mean± SD. p-values are determined by unpaired two-tailed Students’ t-test. *: p<0.05; **: p<0.01; ***: p<0.001; ns, not significant.
See also Figure S6A–S6F.
During ribosome biogenesis, subunits are exported to the cytoplasm as pre-60S and pre-40S complexes that must undergo final maturation involving sequential addition and release of a series of proteins to form mature 60S and 40S subunits (de la Cruz et al., 2015; Kargas et al., 2019). In yeast, ZNF622 homolog Rei1, stabilizes Arx1 (human PA2G4) association with pre-60S (Greber et al., 2012). Jjj1 (human DNAJC21) is required for the release of Rei1-Arx1 complex and the completion of polypeptide exit tunnel (PET) maturation (Lo et al., 2010; Meyer et al., 2010). Failure of Rei1/Arx1 dissociation from pre-60S particles precludes downstream assembly events, including the anti-association factor eIF6 release from pre-60S, which is a crucial step for 40S joining to form a functional ribosome. Thus, we sought to test if the elevated ZNF622 level in HECTD1-depleted cells would affect 60S maturation. Fractions of shLuc or shHECTD1 TF-1 cells from the sucrose gradient were collected and examined by WB. The results showed that HECTD1 was predominantly located in the cytosol, with a small fraction detected in free ribosome subunits (Figure 5C). Notably, ZNF622 was predominantly associated with the 60S, and HECTD1 depletion resulted in a marked accumulation of ZNF622 in the 60S (Figures 5C and 5D). In contrast, the 40S protein Nob1 remained unchanged. Moreover, the ZNF622 binding partner PA2G4 and downstream eIF6 were markedly increased in the 60S, indicating an abnormal 60S ribosome formation (Figures 5C and 5D). Interestingly, the ribosome biogenesis factor for the maturation of the polypeptidyl transferase center (PTC), NMD3, was unchanged (Figures 5C and S6), indicating that the regulation of PET and PTC may be uncoupled. Besides the association and release of assembly factors, the cytoplasmic maturation of pre-60S subunit involves the concomitant incorporation of cytoplasmic ribosome proteins (de la Cruz et al., 2015; Kargas et al., 2019). Consistent with this notion, we found impaired incorporation of cytoplasmic RPL24 in the polysomes of HECTD1-depleted cells (Figures 5C and 5D), whereas other core RPL proteins that were pre-assembled in the nucleus, such as RPL11 and RPL23A, were unaffected (Figures 5C and S6). Of note, we observed a reduced pRPS6 level but not total RPS6 in HECTD1 deficient cells when compared to the controls (Figures 5C and S6). Together, these data suggest that increased ZNF622 proteins upon HECTD1 loss leads to a defective 60S maturation or activation of a translational quality control pathway arising from a block in the release of PA2G4 and eIF6, reduced joining of 60S and 40S, thereby resulting in reduced 80S and polysomes.
To gain further insight into the role for HectD1 in the regulation of ZNF622 in 60S formation and 60S/40S subunit joining, we assessed if depletion of ZNF622 could rescue the ribosome defects observed upon HECTD1 loss. We compared the polysome profiling and eIF6 retention in the 60S of shLuc control, HECTD1 single and HECTD1; ZNF622 double knockdown (DKD) TF-1 cells (Figure 5E). Our data showed that knockdown of ZNF622 in HECTD1-deficient cells restored ribosome composition as well as eIF6 release to normal levels (Figures 5F–5H). Furthermore, we performed ribosome dissociation/reassociation assay with these cell lines to directly interrogate 60S/40S subunit joining (Burwick et al., 2012). 80S monosomes and polysomes were first dissociated into 40S and 60S subunits under low Mg2+ conditions, and the total amount of 40S and 60S was comparable among these three cell lines (Figures 5I and 5J). We subsequently added back Mg2+ allow 40S and 60S subunits to reassociate. HECTD1 depletion reduced ribosomal reassociation. Importantly, this disruption in ribosomal reassociation was reversed by ZNF622 knockdown (Figures 5I and 5J). Taken together, these results provide direct evidence that HectD1 plays an essential role in controlling 60S/40S subunit joining and translational control by regulating ZNF622.
ZNF622 depletion restores protein translation and HSC transplantation activity induced by Hectd1 loss
We reasoned that if the compromised translation rate observed in Hectd1-deficient cells was owing to the elevated ZNF622 level and ZNF622-mediated ribosome defects, attenuation of ZNF622 expression would be able to rescue this phenotype. To test this hypothesis, we knocked down ZNF622 with shRNA in Luc- or HECTD1-depleted TF-1 cells (Figure 6A). Strikingly, ZNF622-depletion fully restored protein synthesis rate to normal levels in HECTD1-depleted cells, while it did not significantly affect the translation rate in control cells as examined by the OP-Puro assay (Figure 6B). Of note, ZNF622 downregulation restored pRPS6 level in HECTD1-depleted cells that was independent of mTOR (Figures 6A and S6G).
Figure 6. Knockdown of Znf622 in Hectd1-deficient cells restores protein synthesis rate and HSC reconstitution ability.

(A) TF-1 cells stably expressing control shLuc, single or double knockdown of HECTD1 and ZNF622 were generated by lentiviral infection and sorting. WB analysis with indicated antibodies is shown.
(B) Global protein synthesis rates of various TF-1 cells as in (A) were measured using OP-Puro assay.
(C) Knockdown efficiency of 3 different shRNAs to mouse Znf622 in BaF3 cells is shown. shRNA #1 and #2 are chosen for subsequent BMT.
(D) Schematic illustration of HSC lentiviral transduction/BMT strategy.
(E) mCherry+ donor fractions in the PB were analyzed every 4 weeks post-BMT. Quantifications of mCherry+ % within donor from each group are shown. f/f;Vav+shLuc, n=5; f/f;Vav+shZnf622#1, n=6; f/f;Vav+shZnf622#2, n=5.
(F) Quantifications of mCherry+ donor% in the HSC and MPP fractions 16-weeks post BMT are shown. f/f;Vav+shLuc, n=5; f/f;Vav+shZnf622#1, n=3; f/f;Vav+shZnf622#2, n=4.
(G) In a separate experiment, LSK cells were purified from Hectd1f/f and Hectd1 f/f;Vav mice, infected with lentivirus expressing shLuc or shZnf622#1, and subsequently transplanted. Quantifications of mCherry+ donor% in the PB from each group are shown. f/f +shLuc, n=8; f/f+shZnf622#1, n=8; f/f;Vav+shLuc, n=7; f/f;Vav+shZnf622#1, n=7.
(H) Quantifications of mCherry+ donor percentages in the HSC and MPP fractions at the end of primary BMT are shown. f/f +shLuc, n=8; f/f+shZnf622#1, n=8; f/f;Vav+shLuc, n=7; f/f;Vav+shZnf622#1, n=7.
(I) Two million BM cells from primary transplanted mice were harvested and transplanted into each secondary recipient. Quantifications of mCherry+ % within donor from each group in the secondary transplants are shown. f/f +shLuc, n=16; f/f+shZnf622#1, n=13; f/f;Vav+shLuc, n=14; f/f;Vav+shZnf622#1, n=9.
In all relevant experiments, each symbol represents an individual mouse; horizontal lines indicate mean frequencies; error bars indicate SE. *: p<0.05; **: p<0.01; ***: p<0.001; ns, not significant, as determined by unpaired two-tailed Student’s t-test.
See also Figure S6G.
We next asked if the aberrant accumulation of ZNF622 accounts for the perturbed HSC activity owing to Hectd1 deficiency. To functionally test this, we depleted Znf622 in Hectd1-null HSCs and examined their reconstitution ability. We first generated two efficient shRNAs against mouse Znf622 (shZnf622#1 and #2) with #1 shRNA being the most robust (Figure 6C). Subsequently, LSK cells were purified from Hectd1f/f;Vav mice and infected with lentivirus expressing shLuc or two shRNAs to Znf622 with mCherry as a fluorescent marker. We injected 250k lentivirally-infected LSKs into each recipient with 500k Sca1-depleted competitor BM cells to ensure high donor reconstitution and recipient survival (Figure 6D) (Jiang et al., 2012). Both Znf622 shRNAs increased the reconstitution of Hectd1-deficient HSCs in the peripheral blood (PB) of the recipient mice (Figure 6E). Importantly, mice transplanted with LSKs depleted of Znf622 had a significantly higher proportion of mCherry+ cells in the BM HSCs and MPPs than those with shLuc (Figure 6F). Therefore, the restored donor chimerism observed in the PB was resulted from HSC restoration.
We next examined if the rescue effect of Znf622 downregulation was specific to Hectd1-null background. LSKs from both Hectd1f/f and Hectd1f/f;Vav mice were sorted and infected with lentivirus expressing shLuc or shZnf622#1 followed by BMT. While control HSC reconstitution in the PB was not significantly affected by Znf622 knockdown, Hectd1-deficient HSC reconstitution ability was significantly rescued (Figure 6G), and importantly, that was attributed to restored HSPC populations (Figure 6H). Strikingly, mCherry+ donor chimerism in the PB of secondary recipients further validated the HSC promoting effect of Znf622 knockdown as the reconstitution ability of Znf622-depleted Hectd1-null cells was significantly elevated in comparison to control cells (Figure 6I). To summarize, these data support a working model that ZNF622 is an important functional mediator of HectD1 function in regulating ribosome assembly and protein translation efficiency, as well as HSC regeneration.
Discussion
Tightly-regulated protein synthesis rate is critical for HSC maintenance and function, as only a 30% decrease (using Rpl24Bst/+ mice, where ribosome protein Rpl24 is partially depleted) or increase (cKO of Pten or 4E-BP1/2 mice) in protein synthesis is sufficient to impair HSC proliferation and self-renewal (Signer et al., 2014; Signer et al., 2016). Here we identified a critical role for ubiquitin-dependent regulation of ribosome assembly by HectD1 to meet the increased protein demands during HSC regeneration in vivo and ex vivo.
We demonstrate that HectD1 is required for HSC but not progenitor cell expansion in vivo, pointing to that balanced protein synthesis is essential for HSC function. Interestingly, HectD1 is dispensable for HSC development during homeostasis, but is critical for HSC regeneration under proliferative stress. Of note, HectD1 is found indispensable in all hematopoietic stress conditions we tested, such as in vivo transplant settings, ex vivo expansion under cytokines, as well as genotoxic stress 5-FU or cyclophosphamide/GCSF-induced HSPC proliferation. The extraordinary demands for HSPC growth and proliferation in these conditions require increased global protein production, thereby coordinated ribosome production. The data in this report suggest that HectD1 controls ribosome assembly and protein synthesis rate during HSC regeneration by regulating 60S assembly factor ZNF622. Of note, we cannot exclude the possibility that HectD1 also regulates protein synthesis and cell cycle in some, and potentially many, hematopoietic progenitors after injury.
Impaired ribosome function arising from genetic aberrations of RP proteins or assembly factors causes a group of human disorders known as “ribosomopathies”, such as SDS. 90% of SDS patients harbor mutations in the SBDS gene, which functions with the GTPase EFL1 to facilitate the removal of anti-association factor eIF6 from pre-60S ribosomal subunits to allow the assembly of 40S and 60S into functional monosomes (Finch et al., 2011; Menne et al., 2007; Warren, 2018; Weis et al., 2015). In addition, biallelic mutations in DNAJC21, a maturation factor for the PET, cause abnormal accumulation of PA2G4 and eIF6 in pre-60S ribosomal subunits and reduce 60S and 40S joining, eliciting an SDS-like phenotype (Dhanraj et al., 2017; Tummala et al., 2016). It is noteworthy that DNAJC21 assists the release of ZNF622-PA2G4 from pre-60S, allowing for the progression of downstream maturation steps. Thus, our data suggest that Hectd1 deficiency recapitulates both the molecular ribosomal abnormalities and the phenotypic perturbations in HSCs, reminiscent of SDS. We found that depletion of ZNF622 in HECTD1-deficient cells rescues ribosome composition as well as eIF6 release to normal levels, thereby restoring 60S/40S subunit joining and protein translation. Notably, it also supports the idea that ZNF622 influences the affinity of eIF6 for the ribosome, thereby serving as a quality control step to ensure proper ribosome assembly. More importantly, we demonstrate that downregulation of Znf622 rescues HSC reconstitution capacity in Hectd1-null mice, implicating ZNF622 inhibition as a potential therapeutic strategy for the treatment of BMF disease with defective ribosomes.
It is important to point out that structure-function studies of ribosome biogenesis and assembly factors have been most examined in yeast and prokaryotes. Our work provides significant biochemical and functional insight into the critical biogenesis factors of human and mouse ribosomes. Structural analysis of the yeast homolog of ZNF622, Rei1, revealed that the Rei1 C-terminus is deeply inserted into the 60S PET, which is essential for the proofreading of PET maturation and subsequent Arx1 (yeast PA2G4) liberation and eIF6 eviction steps (Greber et al., 2016). Our data in human hematopoietic cells demonstrate that accumulated ZNF622 in pre-60S blocks PA2G4 removal and efficient ribosome maturation, in accordance with the function of Rei1 in Arx1 release in yeast cells (Meyer et al., 2010). An alternative but not mutually-exclusive explanation points to a subunit joining and translation defect rather than a biogenesis defect upon HECTD1 loss, since the amount of total 40S and 60S was unaffected. In the absence of HECTD1, ZNF622 abnormally accumulates in the pre-60S and/or rebinds to mature 60S to block 60S/40S joining via ZNF622-associated eIF6. A role for ZNF622 and eIF6 in ribosomal stress and translational quality control has been suggested in a whole-genome CRISPRi screen in human chronic myeloid leukemia (CML) cell line. This study revealed that depletion of ZNF622 or eIF6 restores cell fitness and cell growth in the presence of PF8503, a translational inhibitor that binds to the PET and inhibits the translation of selective proteins and suppresses cell proliferation (Liaud et al., 2019). Hence, our work may uncover a ribosome quality control pathway that is critical for HSPCs during regenerative or proliferative stress. Under this circumstance, high demand for protein synthesis increases the need for ribosome quality control, where HECTD1 activity controls ZNF622 and eIF6-mediated ribosome assembly and protein translation efficiency.
In yeast, Rei1-Arx1 departure from 60S coincides with the exchange for the Rei1 family member Reh1 in the PET that persists in the later stages of cytoplasmic maturation process (Kargas et al., 2019; Ma et al., 2017). This finding is in striking contrast to those reported in yeast, in which dual knockout of Rei1 and Reh1 severely constrains yeast cell growth (Greber et al., 2016). Therefore, it is possible that ZNF622 exerts a distinct function from its yeast homologs. The N-terminus of Rei1 contacts RPL24 on the surface of the 60S ribosome (Greber et al., 2016) and directly interacts with eIF6 (Kargas et al., 2019). ZNF622 may regulate eIF6 release through its direct interaction with eIF6, or indirectly through RPL24. In agreement, we demonstrate that increased ZNF622 protein level coincides with an accumulation of eIF6 in the 60S subunit of HECTD1-depleted cells and depletion of ZNF622 reduces eIF6 association in the 60S. Of note, RPL24 is essential for the formation of 60S-40S inter-subunit bridges, one of which depends on the direct interaction between RPL24 and RPS6 (Kisly et al., 2019). Our data raise the possibility that RPS6 phosphorylation serves as a feedback regulation in the 40S subunit when the 60S large subunit encounters stress, as we observed a correlation between pRPS6 and 60S maturation and protein synthesis in this context. Nonetheless, the intricate regulation between different ribosome subunits and monosomes/polysomes mandates future investigations.
Taken together, we reveal a ubiquitin-dependent control of ribosome assembly and protein synthesis that is essential to HSC activity and regeneration, highlighting the importance of ribosome assembly factors in HSC function. Importantly, we demonstrate that Znf622 depletion restores 60S ribosome maturation, ribosome assembly, protein synthesis and HSC activity in the context of Hectd1 deficiency. This finding establishes an in vivo example of genetic suppression of HSC defects associated with dysfunctional ribosomes. Hence, it will likely enhance our understanding of the pathogenesis and therapeutic strategies for ribosomopathies.
Limitations of the Study
Our work demonstrates that the E3 ubiquitin ligase HectD1 plays an important role in HSC regeneration by ubiquitin-dependent regulation of ribosome assembly via ZNF622. While our study provides strong evidence for HectD1/ZNF622-mediated protein translation in HSPCs under stress conditions, it is unclear if they play a role in 60S ribosome biogenesis or quality control of stressed ribosomes. We also found that the level of phospho-RPS6 was dramatically decreased in Hectd1-deficient cells and this correlates with reduced protein synthesis rate and HSPC function. However, we do not understand the underlying mechanism or its relevance to ZNF622. Another limitation is that we immunoblotted and quantified the distribution of ribosomal proteins and association factors in ribosomal fractions of a hematopoietic cell line TF-1 cells, but not in HSPCs due to their scarcity.
STAR★METHODS
RESOURCE AVAILABILITY
Lead Contact
Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Wei Tong (tongw@chop.edu).
Materials Availability
This study did not generate new unique reagents.
Data and Code Availability
This study did not generate new datasets.
EXPERIMENTAL MODEL AND SUBJECT DETAILS
Mouse models
Hectd1 “knockout-first, conditional-ready” mouse line (C57B6/NGpt-Hectd1tm1a/Gpt, #T000502) was obtained from EuComm (the ES lines were generated by European Consortium) and Model Animal Resource Information Platform of Nanjing University, China. FLP1 recombinase transgenic mice (B6;SJL-Tg(ACTFLPe)9205Dym/J, #003800) and SJL (CD45.1) recipient mice were purchased from the Jackson Laboratory (Rodriguez et al., 2000). Vav1-Cre mice were originally generated by Dr. Thomas Graf (Stadtfeld and Graf, 2005) and generously provided by Dr. Nancy Speck (Chen et al., 2009). Hectd1 transgenic mice were first crossed with Rosa-Flippase mice to eliminate FRT-flanked LacZ and Neo mini-gene, and then with wild type mice to get rid of the Rosa-Flippase gene to minimize the possible effects of these elements in hematopoiesis. The resultant mice with loxP-flanked Hectd1 alleles (Hectd1f/f) targeting exon 3 were crossed with Vav-cre transgenic mice to obtain the control Hectd1f/f and Hectd1f/f;Vav conditional knockout mice (cKO). All mice were bred and grown in house in pathogen-free animal facilities. Both male and female mice (8~12 weeks old) were used and randomly assigned for all experiments. All the animal studies were performed under an approved protocol by the Institutional Animal Care and Use committee of the Children’s Hospital of Philadelphia.
For 5-FU challenge, sex and age-matched (8~12 weeks old) adult Hectd1f/f and Hectd1f/f;Vav mice were injected intraperitoneally with 5-Fluorouracil (5-FU, Cat#F6627, Sigma, 150mg/kg body weight, pH8.5 in PBS) (Rozenova et al., 2015). Total BM cell count, HSC frequency, cell cycle and apoptosis assay were determined after 10 days of 5-FU administration. For Cy/GCSF induced stress, we intraperitoneally injected mice with 1 dose of cyclophosphamide (4mg/mouse, Baxer) followed by two daily subcutaneous injections of 5ug GCSF (Neupogen, Amgen). 1 day after the last GCSF injection, mice were euthanized for subsequent analysis (Morrison et al., 1997; Signer et al., 2014).
Cell lines
TF-1 cell lines were purchased from American Type Culture Collection (ATCC) and grown in RPMI-1640 media supplemented with 10% bovine calf serum (Cat# SH30072.03, HyClone), 2mM L-glutamine (Cat# 25030–081, Gibco) and penicillin/Streptomycin (Gibco) and 2ng/mL GM-CSF (PeproTech) at 37°C and 95% humidity in an atmosphere of 5% CO2. 293T cells were from ATCC and grown in DMEM media supplemented with 10% bovine calf serum, 2mM L-glutamine and penicillin/Streptomycin at 37°C and 95% humidity in an atmosphere of 5% CO2. BaF3 cells were maintained in RPMI-1640 media supplemented with 10% bovine calf serum and 10% WEHI supernatant at 37°C and 95% humidity in an atmosphere of 5% CO2.
METHOD DETAILS
Genotyping and qPCR
Mouse tail genomic DNAs were isolated with the standard proteinase K lysis protocol. Genotyping was performed by PCR. To evaluated Vav-cre excision efficiency in hematopoietic stem and progenitor cells, we plated total BM cells into M3434 methylcellulose semisolid media (StemCell Technologies Inc) for colony formation. Single colonies were picked, resuspended in 90uL buffer (50mM NaOH, 0.2mM EDTA), and boiled for 20min, followed by mixing with 10uL 1M Tris, pH8.0 for neutralization. The lysates were subsequently used for genotyping. Sequences of genotyping primers are listed in Table S2.
For quantitative real time PCR assay, total RNA was extracted using RNeasy Mini Kit (Qiagen). Reverse-transcription reaction was performed with random primers using qScript cDNA Supermix (Quanta Biosciences), and quantitative PCR was done with SYBR Green Master Mix (Applied Biosystems). Sequences of qPCR primers are listed in Table S2.
Constructs and virus packaging
pCMV-HA-HectD1 WT or C2579G mutant constructs were kindly gifted by Dr. Irene E. Zohn (Children’s Research Institute, United States, Washington, DC, United States) (Sarkar and Zohn, 2012). The truncation mutants were amplified by PCR and subcloned into pCMV-HA vector. Human ZNF622 cDNA was amplified by PCR from a homemade cDNA library from TF-1 cells and constructed into a retroviral pOZ-FH vector that contains a Flag and a HA tag. All the deletion or truncation mutants were subcloned into the pOZ-FH vector. HectD1 or ZNF622 miR30-based shRNA constructs were subcloned into Lentiviral vector (pCL20.MSCV.mir30.PGK.mCherry) generously provided by Dr. Shannon McKinney-Freeman
Complete blood count (CBC), flow cytometry of HSPCs and lineage cells
Peripheral blood was collected from 8~12 week-old Hectd1f/f and Hectd1f/f;Vav mice into EDTA-coated tubes. CBC analysis was performed with a Hemavet 950 (Drew Scientific, Inc). For lineage staining, cells from peripheral blood were lysed with RBC lysis buffer (0.8% NH4Cl, 10uM EDTA, pH 7.4~7.6) for 10min at 4°C to remove red blood cells, followed by staining with different fluorochrome-conjugated anti-Gr-1 (RB6–8C5) (granulocytes), -Mac1 (M1/70) (macrophages), -B220 (RA3–6B2) (mature B cells), -CD4 (GK1.5) and -CD8 (53–6.7) (T cells) antibodies, for 30min at 4°C. After washing with flow buffer (PBS containing 0.5% BSA), cells were suspended in flow buffer containing 1ug/mL propidium iodide (PI) or 2.5ug/mL DAPI for flow cytometry analysis.
HSPCs staining was conducted as described previously (Lv et al., 2017). Cells from BM (2 femurs+2 tibias+2 hips for one mouse) or spleen were harvested in PBS containing 0.5% BSA, and quickly lysed with RBC lysis buffer for 1min at 4°C. Cells were then stained with biotin-conjugated anti-Gr-1 (RB6–8C5), -Mac1 (M1/70), -B220 (RA3–6B2), -CD19 (eBio1D3), -Ter119 (TER-119), -CD5 (53–7.3), -CD4 (GK1.5), -CD8 (53–6.7), in combination with APC-Cy7-c-Kit (2B8), PerCP-Cy5.5-Sca1 (E13–161.7 or D7), FITC-CD48 (HM48–1), PE-Cy7CD150 (TC15–12F12.2), APC-CD34 (RAM34), and PE–Flk2 (A2F10.1) antibodies for 30min on ice, followed by secondary staining with streptavidin-PE-TexasRed (Invitrogen SA1017, 1:50) for 30min on ice. Different HSPC subpopulations were defined as long-term stem cells (LT-HSCs, Lin−Sca1+c-Kit+Flk2−CD150+CD48−), short-term stem cells (ST-HSCs, Flk2−CD150CD48− LSK), multiple potent progenitors (megakaryocyte/erythroid-biased MPP2, Flk2CD150+CD48+ LSK; myeloid-biased MPP3, Flk2−CD150− CD48+ LSK; lymphoid-biased MPP4, Flk2+CD150−LSK) (Pietras et al., 2015).
For committed progenitor cell staining, namely granulocyte-monocyte progenitor (GMP, CD34+CD16/32+ Lin−c-Kit+Sca1−) cells, common myeloid progenitor (CMP, CD34+CD16/32− LKS−) cells and megakaryocyte-erythrocyte progenitor (MEP, CD34+CD16/32− LKS−), cells from the BM or spleen were stained with PE-FrRIII/II (CD16/CD32) for 30min on ice after a quick RBC lysis, followed by blocking with rat serum, then stained with biotin-conjugated lineage panel as described above, along with APC-Cy7-c-Kit (2B8), PerCP-cy5.5-Sca1 (E13–161.7 or D7), APC-CD34 for 1h on ice.
Lineage cell FACS samples were analyzed on a BD FACS Canto flow cytometer, while HSPC and progenitor samples were analyzed on a BD FACS Fortessa flow cytometer. Data were analyzed on FlowJo (FlowJo, LLC).
Competitive BMT and limiting dilution BMT
For competitive BMT, 1 million total BM cells from 8~12-week-old Hectd1f/f or Hectd1f/f;Vav (CD45.2) mice were mixed with the same number of competitor total BM cells (CD45.1), and transplanted into lethally irradiated (a split dose of 10Gy) recipient mice (CD45.1/2) by retro-orbital injection. Every four weeks after BMT, donor cell reconstitution in periphery blood (PB) was evaluated by flow cytometry. 16 weeks after BMT, reconstituted donor stem and progenitor cells (HSPCs) from BM or spleen were analyzed by flow cytometry.
For limiting dilution BMT, an increasing number (10k, 30k, 100k) of total BM cells from Hectd1f/f or Hectd1f/f;Vav (CD45.2) mice were mixed with a fixed number (300k) of competitor BM cells and transplanted into lethally irradiated recipient mice (Bersenev et al., 2008). 16 weeks after BMT, donor cell percentage in the PB was evaluated by flow cytometry. Mice with more than 1% of donor-derived cells were defined as “positive”. Data were analyzed by ELDA (Hu and Smyth, 2009).
HSC sorting and transplantation
HSC purification and BMT were performed as described previously (Balcerek et al., 2018). Lineage positive cells were first depleted using a lineage cell depletion kit (Cat# 130–090-858, Miltenyi Biotec). Lineage negative (Lin-) cells were then stained with APC-Cy7-c-Kit (2B8), PerCP-Cy5.5-Sca1 (E13–161.7 or D7), FITC-CD48 (HM48–1), PE-Cy7-CD150 (TC15–12F12.2). LT-HSCs were purified with MoFlo Astrios Sorter and 100 LT-HSCs were seeded in a round-bottom 96-well plate. These LT-HSCs were either transplanted on the day (D0 BMT) or cultured in SFEM media supplemented with 100 ng/mL SCF and 20 ng/mL TPO for 12 days, and all the resultant cells were then transplanted (Day12 BMT). Specifically, 100 LT-HSCs (D0 BMT) or 100 LT-HSCs-derived cells (CD45.2) at day12 (D12 BMT) were mixed with 500k Sca1-depleted competitor BM cells (CD45.1 or CD45.1/2) and injected retro-orbically into lethally irradiated (10Gy) recipient mice (CD45.1/2 or CD45.1). Every four weeks after BMT, donor cell reconstitution in the PB was evaluated by flow cytometry. 16 weeks after BMT, reconstituted donor stem and progenitor cells (HSPCs) from BM or spleen were analyzed by flow cytometry.
OP-Puro (O-propargyl-puromycin) Click-iT protein synthesis assay
To detect protein synthesis rate in vivo, primary or stressed mice were injected intraperitoneally with OP-Puro (Cat# HY-15680, MCE; 50mg/kg body weight, pH6.4–6.6 in PBS) for 1 hour before euthanasia (Signer et al., 2014). Total BM cells were harvested and live stained with cell surface markers for HSCs/MPPs after a quick RBC lysis. Cells were then fixed with BD Cytofix solution for 20min on ice. After washing with BD Perm/Wash buffer, cells were permeabilized with BD Cytoperm Plus solution for 10min on ice, followed by refixing in Cytofix solution for 5min. The azide-alkyne reaction was performed using Click-iT plus OPP Alexa Fluor 647 or 488 kit (Cat# C10458, Invitrogen) for 30min at room temperature. Cells were then washed and resuspended in flow buffer, and analyzed by on a BD FACS Fortessa flow cytometer.
For ex vivo analysis, OP-Puro was added to cell culture at the final concentration of 20uM for 1 hour at a 37°C incubator. The azide-alkyne reaction was performed as described above.
Cell cycle and cell apoptosis assay
For BrdU cell cycle analysis, mice were injected with 200uL BrdU (10mg/mL, Cat# 550891, BD Pharmingen) for 2 hours. Total BM cells were stained with cell surface markers for HSCs/MPPs, and then fixed and permeabilized with BD Cytofix/Cytoperm kit, followed by treatment with 300ug/mL DNaseI for 1 hours at a 37°C water bath. After washing with BD Perm/Wash buffer, cells were stained with FITC-anti-BrdU (Cat# 5133284, BD Pharmingen) for 20min at room temperature. After washing, cells were resuspended in flow buffer with DAPI (5ug/mL), and analyzed by flow cytometry.
For apoptosis assay, total BM cells were stained with cell surface markers for HSCs/MPPs. After washing with flow buffer, cells were resuspended in 200uL Annexin V binding buffer. 10uL FITC-Annexin V (Cat# 55647, BD Pharmingen) and DAPI were added for 15min at room temperature in the dark, followed by adding 800uL binding buffer. Samples were analyzed on a BD Fortessa cytometer within 1 hour.
Viral transduction of LSK cells and transplantation
For LSK lentiviral infection and rescue BMT, sorted LSK cells from either Hectd1f/f or Hectd1f/f;Vav (CD45.2) mice were cultured in SFEM media (StemCell Technologies Inc) supplemented with 10% FBS (SAFC Biosciences) and cytokines (100 ng/mL mSCF, 20 ng/mL mTpo, 20 ng/mL FLT3L, 20 ng/mL IL6) for 2 days. Lentivirus carrying mCherry/shLuc or mCherry/shmZNF622 were preloaded twice into a RetroNectin (T100B, Takara)-coated 12-well plate (Modlich et al., 2009). Cultured LSKs were transferred to the lentivirus-preload plates and incubated for one more day. At day3, 250k cultured LSKs were mixed with 500k Sca1-depleted competitor BM cells and injected into lethally-irradiated recipient mice. A small fraction of infected cells was spared for flow cytometry to evaluate the viral infection efficiency (Jiang et al., 2012).
Immunoprecipitation (IP)
For each anti-HA immunoprecipitation, ten ~80% confluent 10cm dishes of 293T cells were transiently transfected with pCMV-HA empty vector (control) or pCMV-HA-HectD1. 48 hours after transfection, cells were lysed with IP buffer (10mM Tris, pH7.4, 150mM NaCl, 0.5% NP-40, 1mM NaF, 1mM Na3VO4, PMSF, protease inhibitor cocktail, 10 µM PR-619 (LifeSensors), 4mM 1,10-phenanthroline (o-PA; Mallinckrodt Chemicals), 4mM N ethylmaleimide (NEM; Sigma-Aldrich)) for 30 min at 4°C. Cell lysates were clarified by centrifugation at 13, 000 rpm for 10 min at 4°C, and then pre-cleared with protein A/G beads for 30 min.
HA-EZ Agarose beads (E6779, Sigma) were prepared by being sequentially washed with 0.1M pH2.5 Glycine, twice in 1M pH8.0 Tris buffer, and twice in IP buffer. Precleared supernatants were incubated with 100uL washed HA-EZ Agarose beads for 4 hrs with gentle agitation. We transferred the IPs to BioRad Micro Bio-Spin Chromatography Columns (Cat# 732–6204), and washed columns with 1mL IP buffer for four times, followed by a quick spin down to drain the leftover IP buffer. We then seal the bottom of the columns with parafilm, and added 50uL 1mg/mL HA peptides (#26184, Thermo Fisher Scientific) for 15 min at 30°C with occasional mixing, and collected the elute as “HA elute1”. This step was repeated to get another 50uL HA peptide eluate as “HA elute2”. Then the beads were incubated with 50uL of 0.1M pH2.5 Glycine for 5 min at room temperature twice to get “Glycine elute 1 and 2”, which was neutralized with 5uL pH8.0 Tris. Lastly, the beads were boiled in 75uL 1*LDS loading buffer. All elutes from above were added with 25uL 3* LDS loading buffer and boiled for 5min. A small aliquot of eluted samples was resolved with SDS-PAGE, and evaluated by silver staining. Once determined the purification was successful, we loaded majority of the first HA eluates on an SDS-PAGE, stained with colloidal blue. Gel slices were excised and subsequently subjected to mass spectrometry analysis at the Harvard Taplin Mass Spectrometry facility.
Mass spectrometry and Significance analysis of INTeractome (SAINT)
Excised gel bands were cut into approximately 1 mm3 pieces. Gel pieces were then subjected to a modified in-gel trypsin digestion procedure (Shevchenko et al., 1996). Gel pieces were washed and dehydrated with acetonitrile for 10 min, followed by removal of acetonitrile. Pieces were then completely dried in a speed-vac. Rehydration of the gel pieces was with 50 mM ammonium bicarbonate solution containing 12.5 ng/µl modified sequencing-grade trypsin (Promega, Madison, WI) at 4°C. After 45 min, the excess trypsin solution was removed and replaced with 50 mM ammonium bicarbonate solution to just cover the gel pieces. Samples were then placed in a 37°C room overnight. Peptides were later extracted by removing the ammonium bicarbonate solution, followed by one wash with a solution containing 50% acetonitrile and 1% formic acid. The extracts were then dried in a speed-vac (~1 hr). The samples were then stored at 4°C until analysis.
On the day of analysis, the samples were reconstituted in 5–10 µl of HPLC solvent A (2.5% acetonitrile, 0.1% formic acid). A nano-scale reverse-phase HPLC capillary column was created by packing 2.6 µm C18 spherical silica beads into a fused silica capillary (100 µm inner diameter x ~30 cm length) with a flame-drawn tip (Peng and Gygi, 2001). After equilibrating the column each sample was loaded via a Famos auto sampler (LC Packings, San Francisco CA) onto the column. A gradient was formed and peptides were eluted with increasing concentrations of solvent B (97.5% acetonitrile, 0.1% formic acid).
Eluted peptides were subjected to electrospray ionization and then entered into an LTQ Orbitrap Velos Pro ion-trap mass spectrometer (Thermo Fisher Scientific, Waltham, MA). Peptides were detected, isolated, and fragmented to produce a tandem mass spectrum of specific fragment ions for each peptide. Peptide sequences (and hence protein identity) were determined by matching protein databases with the acquired fragmentation pattern by the software program, Sequest (Thermo Fisher Scientific, Waltham, MA) (Eng et al., 1994). All databases include a reversed version of all the sequences and the data was filtered to between a one and two percent peptide false discovery rate.
We performed 3 biological replicates of IP-MS. Three replicates were evaluated by CRAPome (v1.1) (Contaminant Repository for Affinity Purification) analysis (http://www.crapome.org/) (Mellacheruvu et al., 2013). We used five HA controls with four (CC51, CC52, CC53, CC54) from CRAPome repository and one from our own HA control. To calculate SAINT scores (Choi et al., 2012), spectral counts were analyzed using SAINT parameters “Lowmode = 0, MinFold = 0, Normalize=1”. The presented SAINT score was the average probability of SAINT results from all three biological replicates. Fold change (FC) is the ratio of the normalized spectral counts of a potential HectD1-interactor to the average of three highest normalized spectral counts of that protein across the negative controls. We chose the cutoff of SAINT score ≥0.5 and fold change (FC) ≥3 based on the established HectD1-interactors (RIOK2, (Varjosalo et al., 2013); ZRANB1, (Tran et al., 2013); SMC2, (Li et al., 2015)). ZNF622 was among the top hits of all 3 replicates (Supplemental Excel). Gene Ontology (GO) analysis of HectD1-interacting proteins was performed using PANTHER Classification System (http://pantherdb.org) (Mi et al., 2019).
Polysome profiling
20~30 million TF-1 cells with shLuc or shHECTD1 were pre-treated with 100 ug/mL cycloheximide (CHX) for 5min and washed with ice-cold CHX-containing PBS. After centrifugation, cell pellets were lysed in polysome lysis buffer (20mM Tris, pH7.5, 1.5mM MgCl2, 140mM KCl, 1% Triton X-100, 100ug/mL CHX, 0.5mM DTT, protease inhibitor cocktail) for 10min in ice with gentle rocking. The cell lysate was clarified by centrifugation at 17,000g for 10min at 4°C. OD260 value was measured in Nanodrop. Linear sucrose gradient (7%−45%) was generated using a Gradient Maker (BioComp Instruments, Canada). 15–20 OD260 of total cell extract was loaded on the sucrose gradient, followed by ultracentrifugation at 35,000rpm for 3hrs 20min at 4°C in SW40 rotor. Polysome profiling was analyzed with a BioComp fractionator.
For detection of protein distribution, a total of 13 fractions (830uL/fraction) from polysome profiling were collected by a fraction collector (Cat# 4422151, FC-203B, Gilson). To extract proteins for Western Blot (WB) analysis, 150uL of each fraction was pelleted by methanolcholoform-H2O precipitation with sequential addition of 600uL ice-cold methanol, 225uL chloroform and 450uL H2O. The reaction was thoroughly mixed by inversion and centrifuged at 20,000g for 4min at 4°C. After carefully removing the aqueous layer, 1mL prechilled methanol was added and mixed by inversion, followed by centrifugation at 20,000g for 4min at 4°C. The supernatant was then decanted, and the protein pellet was dried at room temperature. 50uL 1*LDS loading solution was directly added to dissolve protein pellets by frequent pipetting up and down. Due to the extra abundance of proteins in cytoplasmic fractions 1–3, 2uL of fractions 1–3 along with 20uL of fractions 4–13 (different ribosomal fractions) were loaded onto an SD-SPAGE for WB analysis.
Ribosomal subunit dissociation and re-association assay
This assay was adapted from a previously published work (Burwick et al., 2012). For ribosomal subunit dissociation, 20~30 TF-1 cells were harvested without cycloheximide treatment and lysed with low Mg2+ buffer (20mM Tris, pH7.4, 140mM KCl, 0.25mM MgCl2, 0.5mM DTT, 1% Triton X-100, EDTA-free protease inhibitor cocktail (Roche)) for 10min on ice. After clarification by centrifugation at 17,000g for 5min at 4°C, the cell lysate was divided into two aliquots. One aliquot was loaded on a 7–45% low Mg2+ sucrose gradient (20mM Tris, pH7.4, 140mM KCl, 0.25mM MgCl2, 0.5mM DTT, EDTA-free protease inhibitor cocktail (Roche)) and analyzed with a BioComp fractionator to detect total 40S and 60S.
For ribosomal subunit re-association, 2.5M MgCl2 was added to the other aliquot for a final concentration of 10mM Mg2+ and incubated for 5min at 37°C. The resultant cell lysate was loaded on a 7–45% high Mg2+ sucrose gradient (20mM Tris, pH7.4, 140mM KCl, 10mM MgCl2, 0.5mM DTT, EDTA-free protease inhibitor cocktail (Roche)) and analyzed with a BioComp fractionator.
Denatured His-ubiquitination assay
293T cells were transfected with indicated HectD1 and ZNF622 constructs, as well as His-tagged Ub WT, K48R or K63R mutants. 2 days later, cells were harvested and washed with cold PBS twice, and then lysed with denatured Urea Lysis buffer (100mM Na2HPO4, 100mM NaH2PO4, 10mM Tris, pH8.0, 0.2% Triton X-100, 5mM β-Mercaptoethanol, 10mM Imidazole, 8M urea), followed by immediate vortex and rocking at RT for 20min. After centrifuging for 10min at 15,000g, supernatant was obtained and incubated with HisPur Ni-NTA resin (88221 Thermo Scientific) for 2 hrs at RT. Resin was then washed 3 times with wash buffer (100mM Na2HPO4, 100mM NaH2PO4, 10mM Tris, pH6.3, 0.2% Triton X-100, 5mM β-Mercaptoethanol, 20mM Imidazole, 8M urea). Bound ubiquitinated proteins were eluted with SDS elution buffer (200mM Imidazole, 5% SDS, 150mM Tris, pH6.8, 30% glycerol, 720mM β-Mercaptoethanol) and subjected to western blot analysis.
Cytokine signaling, protein half-life assay and Western blot (WB)
For cytokine signaling, TF-1/MPL cells were stared in RPMI-1640 media plus 0.5% BSA for 24hrs, and then stimulated with TPO for indicated time points and snap-frozen in dry ice. For mTOR signaling, we also stimulated starved cells with a graded concentration of calf serum. Cell pellets were lysed in LDS loading buffer and sonicated for homogenization. For measuring protein half-life, cycloheximide (CHX) was employed to block de novo protein synthesis for different time points prior to cell harvest.
Protein lysates were subjected to standard WB protocols. Briefly, samples were resolved by SDS-PAGE, and transferred to NC membrane. For all primary phosphor-antibody blots, membranes were blocked with 5% BSA (BP1600–100, Fisher Bioreagents) in TBS-T, while other primary antibody blots were blocked with 5% non-fat milk (sc2325, Santa Cruz). Membranes were incubated with primary antibodies for 2hrs at room temperature or overnight in cold room. Following primary antibody blots, membranes were washed with TBS-T extensively, and then incubated with HRP-conjugated secondary antibody for 1hr at room temperature. After extensive washing, membranes were developed with ECL (#34095, Thermo Scientific). To compare immunoblots with a large number of samples that require multiple gels, samples were resolved in SDS-PAGE gels in parallel. Immunoblots were processed and developed side by side, then images were placed side-by-side for presentation.
HSC cell growth and MTT proliferation assay
100 LT-HSCs from Hectd1f/f or Hectd1f/f;Vav mice were sorted into round-bottom 96-well plate and cultured in SFEM (StemCell Technologies Inc.) supplemented with 10% FBS and various combinations or concentrations of cytokines as indicated in the main text. At different days, cell numbers were enumerated in the presence of trypan blue using a hemacytometer slide.
TF-1/MPL cells with shLuc or shHECTD1 were cultured in an increasing dose of GM-CSF or TPO in a 96-well plate (10k cells/100uL per well) for 3 days. 3-(4,5-dimethylthiazole-2-yl)-2,5-diphenyl tetrazolium bromide (MTT; M6494, Invitrogen) was added to media at a final concentration of 0.5 mg/mL for 3–4 hrs at 37°C. Stopping buffer (15% SDS, 2.5% Acetic acid, 50% dimethylformamide) was then added to terminate the reaction. The absorbance was read by a spectrophotometer at 570 nm.
QUANTIFICATION AND STATISTICAL ANALYSIS
Statistics for MTT, HSC cell growth and CFC assays were performed using unpaired two-tailed Student’s t test and error bars indicate mean± SD. Signal intensities of Western blot bands were quantified by Fiji software. Statistics was analyzed using unpaired two-tailed Student’s t test. All the relevant quantifications performed in primary mice or transplanted mice were analyzed by GraphPad Prism and error bars indicate mean± SEM. Paired t test was used for pairwise comparison of HSC/MPP numbers in Cyclophosphamide+2GCSF challenged mice. Details of “n” values describing the number of experiment repeats or mice are shown in the figure legends. Statistics significance was determined by Student’s t test. ns, not significant; *: p<0.05; **: p<0.01; ***: p<0.001.
Supplementary Material
Table S1. Fold enrichment changes and SAINT score for HectD1 interacting proteins by IP/MS. Related to Figure 3.
Table S2. Genotyping and qPCR primers used. Related to STAR Methods.
KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Rabbit polyclonal anti-HectD1 | Bethyl lab | Cat# A302–908A, RRID:AB_10664800 |
| Rabbit polyclonal anti-ZNF622 | Bethyl lab | Cat# A304–075A, RRID:AB_2621324 |
| Rabbit polyclonal anti-NOB1 | Bethyl lab | Cat# A304–680A, RRID:AB_2620875 |
| Rabbit polyclonal anti-RPS3 | Bethyllab | Cat# A303–840A, RRID:AB_2620191 |
| Rabbit polyclonal anti-RPL23A | Proteintech | Cat# 16386–1-AP, RRID:AB_2269755 |
| Rabbit polyclonal anti-RPL24 | Proteintech | Cat# 17082–1-AP, RRID:AB_2181728 |
| Rabbit polyclonal anti-eIF6 | Proteintech | Cat# 10291–1-AP, RRID:AB_2096515 |
| Rabbit polyclonal anti-NMD3 | Proteintech | Cat# 16060–1-AP, RRID:AB_2282830 |
| Rabbit polyclonal anti-DNAJC21 | Proteintech | Cat# 23411–1-AP, RRID:AB_2879274 |
| Mouse monoclonal anti-PA2G4 | Proteintech | Cat# 66055–1-Ig, RRID:AB_11042597 |
| Rabbit polyclonal anti-RPL11 | Abcam | Cat# ab79352, RRID:AB_2042832 |
| Rabbit monoclonal anti-RPL11 | Abcam | Cat# ab32157, RRID:AB_732117 |
| Mouse monoclonal anti- GSK3α/β | Millipore | Cat# 368662–200UG, RRID:AB_2043310 |
| Mouse monoclonal anti-HSP90 | StressMarq | Cat# SMC-107, RRID:AB_854214 |
| Mouse monoclonal anti-β-Catenin | BD Biosciences | Cat# 610153, RRID:AB_397554 |
| Goat monoclonal anti-Actin | Santa Cruz | Cat# sc-1616, RRID:AB_630836 |
| Rabbit polyclonal anti-STAT5 | Santa Cruz | Cat# sc-835, RRID:AB_632446 |
| Rabbit monoclonal anti-pY1007/1008-JAK2 | Cell Signaling | Cat# 3776, RRID:AB_2617123 |
| Rabbit monoclonal anti-JAK2 | Cell Signaling | Cat# 3230, RRID:AB_2128522 |
| Rabbit polyclonal pY694-STAT5 | Cell Signaling | Cat# 9351, RRID:AB_2315225 |
| Rabbit polyclonal anti-pS473-AKT | Cell Signaling | Cat# 9271, RRID:AB_32982 |
| Rabbit polyclonal anti-AKT | Cell Signaling | Cat# 9272, RRID:AB_329827 |
| Mouse monoclonal anti-pT202/204-ERK1/2 | Cell Signaling | Cat# 9106, RRID:AB_331768 |
| Rabbit polyclonal anti-ERK1/2 | Cell Signaling | Cat# 9102, RRID:AB_330744 |
| Rabbit monoclonal anti-pS2448-mTOR | Cell Signaling | Cat# 5536, RRID:AB_10691552 |
| Mouse monoclonal anti-mTOR | Cell Signaling | Cat# 4517, RRID:AB_1904056 |
| Mouse monoclonal pT389-S6K1 | Cell Signaling | Cat# 9206, RRID:AB_2285392 |
| Rabbit polyclonal anti-S6K1 | Cell Signaling | Cat# 9202, RRID:AB_331676 |
| Rabbit monoclonal anti-pS235/236-RPS6 | Cell Signaling | Cat# 4858, RRID:AB_916156 |
| Rabbit polyclonal anti-pS240/244-RPS6 | Cell Signaling | Cat# 2215, RRID:AB_331682 |
| Rabbit monoclonal anti-RPS6 | Cell Signaling | Cat# 2217, RRID:AB_331355 |
| Rabbit monoclonal anti-pT37/46–4E-BP1 | Cell Signaling | Cat# 2855, RRID:AB_560835 |
| Rabbit monoclonal anti-4E-BP1 | Cell Signaling | Cat# 9644, RRID:AB_2097841 |
| Rabbit polyclonal anti-pS21/9-GSK3α/β | Cell Signaling | Cat# 9331, RRID:AB_329830 |
| Rabbit polyclonal anti-eIF2α | Cell Signaling | Cat# 9722, RRID:AB_2230924 |
| Rabbit monoclonal anti-β-Tubulin | Cell Signaling | Cat# 2128, RRID:AB_823664 |
| Mouse monoclonal anti-GAPDH | Cell Signaling | Cat# 97166, RRID:AB_2756824 |
| Rabbit monoclonal anti-HA | Cell Signaling | Cat# 3724, RRID:AB_1549585 |
| Mouse monoclonal anti-FLAG M2-HRP | Sigma-Aldrich | Cat# A8592, RRID:AB_439702 |
| Digital anti-mouse HRP | Kindle Biosciences | Cat# R1005, RRID:AB_2800463 |
| Digital anti-Rabbit HRP | Kindle Biosciences | Cat# R1006, RRID:AB_2800464 |
| CD45.1-FITC | BD Biosciences | Cat# 553775, RRID:AB_395043 |
| CD45.1-PE-Cy7 | Thermo Fisher | Cat# 25–0453-82, RRID:AB_469629 |
| CD45.1-eF450 | Thermo Fisher | Cat# 48–0453-82, RRID:AB_1272189 |
| CD45.2-APC-Cy7 | Thermo Fisher | Cat# 47–0454-82, RRID:AB_1272175 |
| CD45.2-Buv395 | BD Biosciences | Cat# 564616, RRID:AB_2738867 |
| Gr1-PE | Thermo Fisher | Cat# 12–5931-83, RRID:AB_466046 |
| Mac1-APC | Thermo Fisher | Cat# 17–0112-83, RRID:AB_469344 |
| B220-PE | BD Biosciences | Cat# 553090, RRID:AB_394620 |
| B220-APC | Thermo Fisher | Cat# 17–0452-83, RRID:AB_469396 |
| CD4-PE | BD Biosciences | Cat# 553049, RRID:AB_394585 |
| CD8a-PE | BioLegend | Cat# 100707, RRID:AB_312746 |
| CD3e-FITC | Thermo Fisher | Cat# 11–0031-82, RRID:AB_464882 |
| CD3e-PE | Thermo Fisher | Cat# 12–0031-85, RRID:AB_465498 |
| Ter119-biotin labeled | Thermo Fisher | Cat# 13–5921-85, RRID:AB_466798 |
| Gr1-biotin labeled | Thermo Fisher | Cat# 13–5931-86, RRID:AB_466802 |
| Mac1-biotin labeled | Thermo Fisher | 13–0112-86, RRID:AB_466361 |
| B220-biotin labeled | Thermo Fisher | Cat# 13–0452-86, RRID:AB_466451 |
| CD19-biotin labeled | Thermo Fisher | Cat# 13–0193-86, RRID:AB_657655 |
| CD4-biotin labeled | Thermo Fisher | Cat# 13–0041-86, RRID:AB_466327 |
| CD5-biotin labeled | Thermo Fisher | Cat# 13–0051-85, RRID:AB_466340 |
| CD8a-biotin labeled | Thermo Fisher | Cat# 13–0081-86, RRID:AB_466348 |
| Streptavidin-PE-TexasRed | Thermo Fisher | Cat# SA1017, RRID:N/A |
| Streptavidin-APC-Cy7 | Thermo Fisher | Cat# 47–4317-82, RRID:AB_10366688 |
| c-Kit-PE | BD Biosciences | Cat# 553355, RRID:AB_394806 |
| c-Kit-APC | Thermo Fisher | Cat# 17–1171-83, RRID:AB_469431 |
| c-Kit-APC-Cy7 | Thermo Fisher | Cat# 47–1171-82, RRID:AB_1272177 |
| ScaI-PE | BD Biosciences | Cat# 553336, RRID:AB_394792 |
| ScaI-PerCp-Cy5.5 | Thermo Fisher | Cat# 45–5981-82, RRID:AB_914372 |
| CD150-PE-Cy7 | BioLegend | Cat# 115914, RRID:AB_439797 |
| CD48-FITC | BioLegend | Cat# 103403, RRID:AB_313018 |
| CD48-APC-Cy7 | BioLegend | Cat# 103432, RRID:AB_2561463 |
| CD48-AF700 | BioLegend | Cat# 103426, RRID:AB_10612755 |
| CD48-APC | Thermo Fisher | Cat# 17–0481-82, RRID:AB_469408 |
| Flk2-PE | BD Biosciences | Cat# 553842, RRID:AB_395079 |
| CD34-APC | Thermo Fisher | Cat# 50–0341-82, RRID:AB_10596826 |
| CD16/32-PE | BD Biosciences | Cat# 553145, RRID:AB_394660 |
| Bacterial and Virus Strains | ||
| pCL20.MSCV.mir30.PGK.mCherry | Holmfeldt et al., 2016 | N/A |
| pCL20.MSCV.mir30.PGK.GFP | This paper (Replace mCherry with GFP) | N/A |
| Chemicals, Peptides, and Recombinant Proteins | ||
| 5-Fluorouracil (5-FU) | Sigma-Aldrich | Cat# F6627 |
| Cyclophosphamide | Baxer | Cat# NDC 10019–955-01 |
| O-Propargyl-Puromycin (OP-Puro) | MedChemExpress | Cat# HY-15680/CS-6850 |
| BrdU | BD Pharmingen | Cat# 5133284 |
| Puromycin dihyrdochloride | Sigma-Aldrich | Cat# P7255 |
| Insulin Solution Human | Sigma-Aldrich | Cat# I9278 |
| 10% BSA in IMDM | StemCell Technologies | Cat# 09300 |
| L-Glutamine | Gibco | Cat# 25030–081 |
| Holo-Transferrin human | Sigma-Aldrich | Cat# T0665 |
| β-Mercaptoethanol | Sigma-Aldrich | Cat# M3148 |
| Propidium iodide (PI) | Sigma-Aldrich | Cat# P4170 |
| DAPI | Sigma-Aldrich | Cat# D9542 |
| 3% Acetic Acid with Methylene Blue | StemCell Technologies | Cat# 07060 |
| Retronectin | Takara | Cat# T100B |
| Cycloheximide | Sigma-Aldrich | Cat# C7698 |
| Imidazole | Acros Organics | Cat# 288–32-4 |
| N-Ethylmaleimide (NEM) | Sigma-Aldrich | Cat# E1271 |
| PR619 | LifeSensors | Cat# SI9619 |
| 1,10-phenanthroline | Mallinckrodt Chemicals | Cat# 2631–55 |
| Sodium Fluoride | Sigma-Aldrich | Cat# S7920 |
| Sodium orthovanadate | Sigma-Aldrich | Cat# 450243 |
| PMSF | Sigma-Aldrich | Cat# P7626 |
| Protease Inhibitor Cocktail Tablets; EDTA-free | Roche | Cat# 11836170001 |
| Protease Inhibitor Cocktail Tablets | Roche | Cat# 11697498001 |
| Bovine Serum Albumin (BSA) | Fisher Bioreagents | Cat# BP1600 |
| Nonfat milk | Santa Cruz | Cat# sc2325 |
| StemSpan SFEM | StemCell Technologies | Cat# 09600 |
| Fetal Bovine Serum | SAFC Biosciences | Cat# 12103C |
| Bovine Calf Serum | HyClone | Cat# SH30072.03 |
| HA peptide | Thermo Fisher | Cat# 26184 |
| Anti-HA Affinity Gel | Sigma-Aldrich | Cat# E6779 |
| Anti-FLAG M2 Affinity Gel | Sigma-Aldrich | Cat# F2426 |
| Protein A Sepharose CL-4B | GE Health | Cat# 17–0780-01 |
| Protein G Sepharose 4 Fast Flow | GE Health | Cat# 17–0618-01 |
| HisPur Ni-NTA Resin | Thermo Fisher | Cat# 88221 |
| Murine SCF | Peprotech | Cat# 250–03 |
| Murine Tpo | Peprotech | Cat# 315–14 |
| Murine IL3 | Peprotech | Cat# 213–13 |
| Murine FLT3L | Peprotech | Cat# 250–31L |
| Murine IL6 | Peprotech | Cat# 216–16 |
| rh EPO | Espogen | Cat# NDC 55513–144-10 |
| rG-CSF (Neupogen) | Amgen | Cat# NDC 55513–209-01 |
| Human GM-CSF | Peprotech | Cat# 300–03 |
| Human TPO | Peprotech | Cat# 300–18 |
| Critical Commercial Assays | ||
| Lineage Cell Depletion Kit mouse | Miltenyi Biotec | Cat# 130–090-858 |
| Anti-Sca-1 Microbead Kit (FITC) | Miltenyi Biotec | Cat# 130–092-529 |
| Click-iT Plus OP-Puro Protein Synthesis Kit | Thermo Fisher | Cat# C10458 |
| FITC Annexin V Apoptosis Detection Kit | BD Pharmingen | Cat# 556547 |
| BrdU Flow Kits | BD Pharmingen | Cat# 557891 |
| BD Cytofix/Cytoperm | BD Biosciences | Cat# 554714 |
| SYBR Green Master Mix | Applied Biosystems | Cat# 43–091-55 |
| RNeasy Plus Mini Kit | QIAGEN | Cat# 74136 |
| qScript cDNA Supermix | Quanta Biosciences | Cat# 98047 |
| Experimental Models: Cell Lines | ||
| TF-1 | ATCC | Cat# CRL-2003, RRID:CVCL_0559 |
| HEK293T | ATCC | Cat# CRL-3216, RRID:CVCL_0063 |
| WEHI-3B | Dr. Harvey Lodish lab | RRID:CVCL_2239 |
| BaF3 | DSMZ | Cat# ACC-300, RRID:CVCL_0161 |
| Experimental Models: Mouse Strains | ||
| C57B6/NGpt-Hectd1tm1b/Gpt | EuComm and MARC, China | Cat# 5757216, RRID:MGI:5757216 |
| FLP B6;SJL-Tg(ACTFLPe)9205Dym/J | Jackson laboratories | Cat# JAX:003800, RRID:IMSR_JAX:003800 |
| Vav-Cre mice | Stadtfeld and Graf, 2005; Chen et al., 2009 | N/A |
| C57BL/6J (CD45.2) | Jackson laboratories | Cat# 000664 |
| SJL (CD45.1) | Jackson laboratories | Cat# 000686 |
| Oligonucleotides | ||
| sh human HECTD1#1: tatgaaacaagattgtagtcaa | This paper | N/A |
| sh human HECTD1#2: taccactggttgttcaactcta | This paper | N/A |
| sh human ZNF622#1: atcggaaagtggagatgatgaa | This paper | N/A |
| sh human ZNF622#2: tggagacgattgggaagatatt | This paper | N/A |
| sh mouse Znf622#1: agagaaagttggtgttggcaaa | This paper | N/A |
| sh mouse Znf622#2: tgtgacagttgctaggaatcaa | This paper | N/A |
| Oligonucleotides for mouse genotyping and real-time qPCR see Table S2 | This paper | N/A |
| Recombinant DNA | ||
| pCMV-HA-HectD1 WT | Sarkar and Zohn, 2012 | N/A |
| pCMV-HA-HectD1 C2579G | Sarkar and Zohn, 2012 | N/A |
| pCMV-HA-HectD1 truncates/deletion mutants | This paper | N/A |
| pOZ-FH-ZNF622 full length | This paper | N/A |
| pOZ-FH-ZNF622 truncates/deletion mutants | This paper | N/A |
| pOZ-Flag-ZNF622 | This paper | N/A |
| Softwares and Algorithms | ||
| Flowjo | https://www.flowjo.com/solutions/flowjo | RRID:SCR_008520 |
| GraphPad Prism | http://www.graphpad.com/ | RRID:SCR_002798 |
| Fiji | http://fiji.sc | RRID:SCR_002285 |
| QuantStudio Real-Time PCR software | Thermo Fisher | https://www.thermofisher.com/us/en/home/lifescience/pcr/real-time-pcr/ |
| SAINT | Choi et al., 2012 | http://saint-apms.sourceforge.net/Main.html |
| ELDA | Hu and Smyth, 2009 | http://bioinf.wehi.edu.au/software/elda/ |
| Sequest | Eng et al., 1994 | http://tools.thermofisher.com/content/sfs/manuals/Man-XCALI-97160-SEQUEST-331-UserManXCALI97160-B-EN.pdf |
Highlights.
Conditional deletion of Hectd1 impairs HSC engraftment and ex vivo growth.
HECTD1 regulates HSPC protein synthesis and proliferation under stress conditions.
HECTD1 controls ribosomal assembly and protein translation via ZNF622.
Znf622 depletion restores protein synthesis and HSC activity in Hectd1-null mice.
Acknowledgements
WT is supported by NIH grants R01DK127738 and R01HL095675, awards from Department of Defense, St. Baldrick’s Foundation, Alex’s Lemonade Research Foundation, and Basser Center for BRCA Research. VRP is supported by an NIH grant R35 GM138035. AJW is supported by a Specialist Programme from Blood Cancer UK (12048, to AJW), the UK Medical Research Council (MR/T012412/1), the Kay Kendall Leukaemia Fund, a Wellcome Trust strategic award to the Cambridge Institute for Medical Research (100140), a core support grant from the Wellcome Trust and MRC to the Wellcome Trust-Medical Research Council Cambridge Stem Cell Institute, the Connor Wright Project, the Cambridge National Institute for Health Research Biomedical Research Centre and the European Cooperation in Science and Technology (COST) Action CA18233 “European Network for Innovative Diagnosis and treatment of Chronic Neutropenias, EuNet INNOCHRON”. YC is supported by the Scientific and Technical Foundation of Shanxi Province (grant no. 2020JM-015). We thank Dr. Irene E. Zohn for kindly providing the HectD1 WT and C2579G constructs. We are grateful to Drs. John Woolford and Sebastian Klinge for valuable advice and helpful discussions of this work.
Footnotes
Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Declaration of interests
The authors declare no competing financial interests.
Inclusion and diversity
We worked to ensure sex balance in the selection of non-human subjects. The author list of this paper includes contributors from the location where the research was conducted who participated in the data collection, design, analysis, and/or interpretation of the work.
REFERENCE
- Aleidi SM, Yang A, Sharpe LJ, Rao G, Cochran BJ, Rye KA, Kockx M, Brown AJ, and Gelissen IC (2018). The E3 ubiquitin ligase, HECTD1, is involved in ABCA1-mediated cholesterol export from macrophages. Biochim Biophys Acta Mol Cell Biol Lipids 1863, 359–368. [DOI] [PubMed] [Google Scholar]
- Balcerek J, Jiang J, Li Y, Jiang Q, Holdreith N, Singh B, Chandra V, Lv K, Ren JG, Rozenova K, et al. (2018). Lnk/Sh2b3 deficiency restores hematopoietic stem cell function and genome integrity in Fancd2 deficient Fanconi anemia. Nat Commun 9, 3915. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Barilari M, Bonfils G, Treins C, Koka V, De Villeneuve D, Fabrega S, and Pende M (2017). ZRF1 is a novel S6 kinase substrate that drives the senescence programme. EMBO J 36, 736–750. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bersenev A, Wu C, Balcerek J, and Tong W (2008). Lnk controls mouse hematopoietic stem cell self-renewal and quiescence through direct interactions with JAK2. J Clin Invest 118, 2832–2844. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Boocock GR, Morrison JA, Popovic M, Richards N, Ellis L, Durie PR, and Rommens JM (2003). Mutations in SBDS are associated with Shwachman-Diamond syndrome. Nat Genet 33, 97–101. [DOI] [PubMed] [Google Scholar]
- Burwick N, Coats SA, Nakamura T, and Shimamura A (2012). Impaired ribosomal subunit association in Shwachman-Diamond syndrome. Blood 120, 5143–5152. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chauvin C, Koka V, Nouschi A, Mieulet V, Hoareau-Aveilla C, Dreazen A, Cagnard N, Carpentier W, Kiss T, Meyuhas O, et al. (2014). Ribosomal protein S6 kinase activity controls the ribosome biogenesis transcriptional program. Oncogene 33, 474–483. [DOI] [PubMed] [Google Scholar]
- Chen MJ, Yokomizo T, Zeigler BM, Dzierzak E, and Speck NA (2009). Runx1 is required for the endothelial to haematopoietic cell transition but not thereafter. Nature 457, 887–891. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Choi H, Liu G, Mellacheruvu D, Tyers M, Gingras AC, and Nesvizhskii AI (2012). Analyzing protein-protein interactions from affinity purification-mass spectrometry data with SAINT. Curr Protoc Bioinformatics Chapter 8, Unit8 15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- D’Alonzo D, Emch FH, Shen X, Bruder E, De Geyter C, and Zhang H (2019). Hectd1 is essential for embryogenesis in mice. Gene Expr Patterns 34, 119064. [DOI] [PubMed] [Google Scholar]
- de la Cruz J, Karbstein K, and Woolford JL Jr. (2015). Functions of ribosomal proteins in assembly of eukaryotic ribosomes in vivo. Annu Rev Biochem 84, 93–129. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dhanraj S, Matveev A, Li H, Lauhasurayotin S, Jardine L, Cada M, Zlateska B, Tailor CS, Zhou J, Mendoza-Londono R, et al. (2017). Biallelic mutations in DNAJC21 cause Shwachman-Diamond syndrome. Blood 129, 1557–1562. [DOI] [PubMed] [Google Scholar]
- Duhamel S, Goyette MA, Thibault MP, Filion D, Gaboury L, and Cote JF (2018). The E3 Ubiquitin Ligase HectD1 Suppresses EMT and Metastasis by Targeting the +TIP ACF7 for Degradation. Cell Rep 22, 1016–1030. [DOI] [PubMed] [Google Scholar]
- Eng JK, McCormack AL, and Yates JR (1994). An approach to correlate tandem mass spectral data of peptides with amino acid sequences in a protein database. J Am Soc Mass Spectrom 5, 976–989. [DOI] [PubMed] [Google Scholar]
- Finch AJ, Hilcenko C, Basse N, Drynan LF, Goyenechea B, Menne TF, Gonzalez Fernandez A, Simpson P, D’Santos CS, Arends MJ, et al. (2011). Uncoupling of GTP hydrolysis from eIF6 release on the ribosome causes Shwachman-Diamond syndrome. Genes Dev 25, 917–929. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Greber BJ, Boehringer D, Montellese C, and Ban N (2012). Cryo-EM structures of Arx1 and maturation factors Rei1 and Jjj1 bound to the 60S ribosomal subunit. Nat Struct Mol Biol 19, 1228–1233. [DOI] [PubMed] [Google Scholar]
- Greber BJ, Gerhardy S, Leitner A, Leibundgut M, Salem M, Boehringer D, Leulliot N, Aebersold R, Panse VG, and Ban N (2016). Insertion of the Biogenesis Factor Rei1 Probes the Ribosomal Tunnel during 60S Maturation. Cell 164, 91–102. [DOI] [PubMed] [Google Scholar]
- Holcik M, and Sonenberg N (2005). Translational control in stress and apoptosis. Nat Rev Mol Cell Biol 6, 318–327. [DOI] [PubMed] [Google Scholar]
- Hu Y, and Smyth GK (2009). ELDA: extreme limiting dilution analysis for comparing depleted and enriched populations in stem cell and other assays. J Immunol Methods 347, 70–78. [DOI] [PubMed] [Google Scholar]
- Jiang J, Balcerek J, Rozenova K, Cheng Y, Bersenev A, Wu C, Song Y, and Tong W (2012). 14–3-3 regulates the LNK/JAK2 pathway in mouse hematopoietic stem and progenitor cells. J Clin Invest 122, 2079–2091. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kargas V, Castro-Hartmann P, Escudero-Urquijo N, Dent K, Hilcenko C, Sailer C, Zisser G, Marques-Carvalho MJ, Pellegrino S, Wawiorka L, et al. (2019). Mechanism of completion of peptidyltransferase centre assembly in eukaryotes. Elife 8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kisly I, Remme J, and Tamm T (2019). Ribosomal protein eL24, involved in two intersubunit bridges, stimulates translation initiation and elongation. Nucleic Acids Res 47, 406–420. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Klinge S, and Woolford JL Jr. (2019). Ribosome assembly coming into focus. Nat Rev Mol Cell Biol 20, 116–131. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li W, Hu Y, Oh S, Ma Q, Merkurjev D, Song X, Zhou X, Liu Z, Tanasa B, He X, et al. (2015). Condensin I and II Complexes License Full Estrogen Receptor alpha-Dependent Enhancer Activation. Mol Cell 59, 188–202. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Liaud N, Horlbeck MA, Gilbert LA, Gjoni K, Weissman JS, and Cate JHD (2019). Cellular response to small molecules that selectively stall protein synthesis by the ribosome. PLoS Genet 15, e1008057. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Liu J, Xu Y, Stoleru D, and Salic A (2012). Imaging protein synthesis in cells and tissues with an alkyne analog of puromycin. Proc Natl Acad Sci U S A 109, 413–418. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lo KY, Li Z, Bussiere C, Bresson S, Marcotte EM, and Johnson AW (2010). Defining the pathway of cytoplasmic maturation of the 60S ribosomal subunit. Mol Cell 39, 196–208. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lv K, Jiang J, Donaghy R, Riling CR, Cheng Y, Chandra V, Rozenova K, An W, Mohapatra BC, Goetz BT, et al. (2017). CBL family E3 ubiquitin ligases control JAK2 ubiquitination and stability in hematopoietic stem cells and myeloid malignancies. Genes Dev 31, 1007–1023. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ma C, Wu S, Li N, Chen Y, Yan K, Li Z, Zheng L, Lei J, Woolford JL Jr., and Gao N (2017). Structural snapshot of cytoplasmic pre-60S ribosomal particles bound by Nmd3, Lsg1, Tif6 and Reh1. Nat Struct Mol Biol 24, 214–220. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mellacheruvu D, Wright Z, Couzens AL, Lambert JP, St-Denis NA, Li T, Miteva YV, Hauri S, Sardiu ME, Low TY, et al. (2013). The CRAPome: a contaminant repository for affinity purification-mass spectrometry data. Nat Methods 10, 730–736. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Menne TF, Goyenechea B, Sanchez-Puig N, Wong CC, Tonkin LM, Ancliff PJ, Brost RL, Costanzo M, Boone C, and Warren AJ (2007). The Shwachman-Bodian-Diamond syndrome protein mediates translational activation of ribosomes in yeast. Nat Genet 39, 486–495. [DOI] [PubMed] [Google Scholar]
- Meyer AE, Hoover LA, and Craig EA (2010). The cytosolic J-protein, Jjj1, and Rei1 function in the removal of the pre-60 S subunit factor Arx1. J Biol Chem 285, 961–968. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mi H, Muruganujan A, Ebert D, Huang X, and Thomas PD (2019). PANTHER version 14: more genomes, a new PANTHER GO-slim and improvements in enrichment analysis tools. Nucleic Acids Res 47, D419–D426. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Modlich U, Schambach A, Li Z, and Schiedlmeier B (2009). Murine hematopoietic stem cell transduction using retroviral vectors. Methods Mol Biol 506, 23–31. [DOI] [PubMed] [Google Scholar]
- Morrison SJ, Wright DE, and Weissman IL (1997). Cyclophosphamide/granulocyte colony-stimulating factor induces hematopoietic stem cells to proliferate prior to mobilization. Proc Natl Acad Sci U S A 94, 1908–1913. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Oguro H, Ding L, and Morrison SJ (2013). SLAM family markers resolve functionally distinct subpopulations of hematopoietic stem cells and multipotent progenitors. Cell Stem Cell 13, 102–116. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Peng J, and Gygi SP (2001). Proteomics: the move to mixtures. J Mass Spectrom 36, 1083–1091. [DOI] [PubMed] [Google Scholar]
- Pietras EM, Reynaud D, Kang YA, Carlin D, Calero-Nieto FJ, Leavitt AD, Stuart JM, Gottgens B, and Passegue E (2015). Functionally Distinct Subsets of Lineage-Biased Multipotent Progenitors Control Blood Production in Normal and Regenerative Conditions. Cell Stem Cell 17, 35–46. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rodriguez CI, Buchholz F, Galloway J, Sequerra R, Kasper J, Ayala R, Stewart AF, and Dymecki SM (2000). High-efficiency deleter mice show that FLPe is an alternative to CreloxP. Nat Genet 25, 139–140. [DOI] [PubMed] [Google Scholar]
- Rozenova K, Jiang J, Donaghy R, Aressy B, Greenberg RA, and Tong W (2015). MERIT40 deficiency expands hematopoietic stem cell pools by regulating thrombopoietin receptor signaling. Blood 125, 1730–1738. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ruggero D, and Shimamura A (2014). Marrow failure: a window into ribosome biology. Blood 124, 2784–2792. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sarkar AA, Nuwayhid SJ, Maynard T, Ghandchi F, Hill JT, Lamantia AS, and Zohn IE (2014). Hectd1 is required for development of the junctional zone of the placenta. Dev Biol 392, 368–380. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sarkar AA, and Zohn IE (2012). Hectd1 regulates intracellular localization and secretion of Hsp90 to control cellular behavior of the cranial mesenchyme. J Cell Biol 196, 789–800. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Shembade N, and Harhaj EW (2015). Elucidating dynamic protein-protein interactions and ubiquitination in NF-kappaB signaling pathways. Methods Mol Biol 1280, 283–295. [DOI] [PubMed] [Google Scholar]
- Shevchenko A, Wilm M, Vorm O, and Mann M (1996). Mass spectrometric sequencing of proteins silver-stained polyacrylamide gels. Anal Chem 68, 850–858. [DOI] [PubMed] [Google Scholar]
- Signer RA, Magee JA, Salic A, and Morrison SJ (2014). Haematopoietic stem cells require a highly regulated protein synthesis rate. Nature 509, 49–54. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Signer RA, Qi L, Zhao Z, Thompson D, Sigova AA, Fan ZP, DeMartino GN, Young RA, Sonenberg N, and Morrison SJ (2016). The rate of protein synthesis in hematopoietic stem cells is limited partly by 4E-BPs. Genes Dev 30, 1698–1703. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Stadtfeld M, and Graf T (2005). Assessing the role of hematopoietic plasticity for endothelial and hepatocyte development by non-invasive lineage tracing. Development 132, 203–213. [DOI] [PubMed] [Google Scholar]
- Sugrue KF, Sarkar AA, Leatherbury L, and Zohn IE (2019). The ubiquitin ligase HECTD1 promotes retinoic acid signaling required for development of the aortic arch. Dis Model Mech 12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sulima SO, Hofman IJF, De Keersmaecker K, and Dinman JD (2017). How Ribosomes Translate Cancer. Cancer Discov 7, 1069–1087. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tan S, Kermasson L, Hoslin A, Jaako P, Faille A, Acevedo-Arozena A, Lengline E, Ranta D, Poiree M, Fenneteau O, et al. (2019). EFL1 mutations impair eIF6 release to cause Shwachman-Diamond syndrome. Blood 134, 277–290. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tran H, Bustos D, Yeh R, Rubinfeld B, Lam C, Shriver S, Zilberleyb I, Lee MW, Phu L, Sarkar AA, et al. (2013). HectD1 E3 ligase modifies adenomatous polyposis coli (APC) with polyubiquitin to promote the APC-axin interaction. J Biol Chem 288, 3753–3767. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tummala H, Walne AJ, Williams M, Bockett N, Collopy L, Cardoso S, Ellison A, Wynn R, Leblanc T, Fitzgibbon J, et al. (2016). DNAJC21 Mutations Link a Cancer-Prone Bone Marrow Failure Syndrome to Corruption in 60S Ribosome Subunit Maturation. Am J Hum Genet 99, 115–124. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Warren AJ (2018). Molecular basis of the human ribosomopathy Shwachman-Diamond syndrome. Advances in biological regulation 67, 109–127. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Weis F, Giudice E, Churcher M, Jin L, Hilcenko C, Wong CC, Traynor D, Kay RR, and Warren AJ (2015). Mechanism of eIF6 release from the nascent 60S ribosomal subunit. Nat Struct Mol Biol 22, 914–919. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wilson A, Laurenti E, Oser G, van der Wath RC, Blanco-Bose W, Jaworski M, Offner S, Dunant CF, Eshkind L, Bockamp E, et al. (2008). Hematopoietic stem cells reversibly switch from dormancy to self-renewal during homeostasis and repair. Cell 135, 1118–1129. [DOI] [PubMed] [Google Scholar]
- Woloszynek JR, Rothbaum RJ, Rawls AS, Minx PJ, Wilson RK, Mason PJ, Bessler M, and Link DC (2004). Mutations of the SBDS gene are present in most patients with Shwachman-Diamond syndrome. Blood 104, 3588–3590. [DOI] [PubMed] [Google Scholar]
- Wong CC, Traynor D, Basse N, Kay RR, and Warren AJ (2011). Defective ribosome assembly in Shwachman-Diamond syndrome. Blood 118, 4305–4312. [DOI] [PubMed] [Google Scholar]
- Zohn IE, Anderson KV, and Niswander L (2007). The Hectd1 ubiquitin ligase is required for development of the head mesenchyme and neural tube closure. Dev Biol 306, 208–221. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Table S1. Fold enrichment changes and SAINT score for HectD1 interacting proteins by IP/MS. Related to Figure 3.
Table S2. Genotyping and qPCR primers used. Related to STAR Methods.
Data Availability Statement
This study did not generate new datasets.
