Arbuscular mycorrhizal symbiosis regulates the physiological responses, ion distribution and relevant gene expression to trigger salt stress tolerance in pistachio

Abstract

Mycorrhizal symbiosis is generally considered effective in ameliorating plant tolerance to abiotic stress by altering gene expression, and evaluation of genes involved in ion homeostasis and nutrient uptake. This study aimed to use arbuscular mycorrhizal fungus (AMF) to alleviate salinity stress and analyse relevant gene expression in pistachio plants under No/NaCl stress in greenhouse conditions. Arbuscular mycorrhizal symbiosis was used to study the physiological responses, ion distribution and relevant gene expression in pistachio plants under salinity stress. After four months of symbiosis, mycorrhizal root colonization showed a significant reduction in all tested parameters under salt stress treatment compared to non-saline treatment. Salinity affected the morphological traits, and decreased the nutrient content including N, P, Mg and Fe as well as K/Na and Ca/Na ratios, relative water content (RWC), membrane stability index (MSI), and increased the concentration of K, Ca and Na nutrient, glycine betaine, ROS and MDA. Inoculation of seedlings with AMF mitigated the negative effects of salinity on plant growth as indicated by increasing the root colonization, morphological traits, glycine betaine, RWC and MSI. Specifically, under salinity stress, shoot and root dry weight, P and Fe nutrient content, K/Na and Ca/Na ratio of AMF plants were increased by 53.2, 48.6, 71.6, 60.2, 87.5, and 80.1% respectively, in contrast to those of the NMF plants. The contents of Na, O^2•− and MDA in AMF plants were significantly decreased by 66.8, 36.8, and 23.1%, respectively at 250 mM NaCl. Moreover, salinity markedly increased SOS1, CCX2 and SKOR genes expression and the inoculation with AMF modulated these genes expression; however, NRT2.4, PHO1 and PIP2.4 gene expressions were increased by salinity and AMF. It could be concluded that inoculation of AMF with Rhizophagus irregularis conferred a larger endurance towards soil salinity in pistachio plants and stimulate the nutrient uptake and ionic homeostasis maintenance, superior RWC and osmoprotection, toxic ion partitioning, maintaining membrane integrity and the ion-relevant genes expression.

Introduction

Plants usually encounter a variety of environmental stresses resulting in considerable undesirable variations in growth and metabolism, which ultimately affect the plant yield (Hashem et al. 2018). Worldwide, soil salinity is the most crucial environmental problem. About 1000 million hectares of the semiarid and arid region worldwide is affected by soil salinity which accounts about 7% of the land on earth (Dagar and Minhas, 2016; Evelin et al. 2009). Sodium chloride (NaCl) is the most soluble and abundant constituent, causing salt stress by negatively affecting all physiological processes in the plants. Excess ions, mainly Na⁺ and Cl⁻, leads to osmotic stress and ionic toxicity; consequently, inhibiting the growth and development of plant by disrupting numerous physiological processes (Liu et al. 2016; Shamshiri and Fattahi 2016), such as the water uptake, metabolic processes, nutrient composition, osmotic adjustment and hydraulic conductivity (Huang et al. 2010; Hashem et al. 2016).

These injurious osmotic effects and ionic toxicity leads to the generation of the toxic reactive oxygen species (ROS) including singlet oxygen (¹O₂), superoxide anion (O₂^-), hydroxyl radical (OH¯) and hydrogen peroxide (H₂O₂), (Abd-Allah et al. 2015). Excess ROS induces oxidative stress which damages lipids, proteins and nucleic acids, disrupts membrane integrity, changing the selective permeability of cell membrane and eventually causing membrane leakage through lipid peroxidation (Huang et al. 2010). Therefore, to overcome the harmful impacts on growth and development, plants react to salinity stress through morphological, physiological and metabolic modifications in all plant organs that permit the plant to avoid the stress or to increase its tolerance (Ruiz-Lozano et al. 2012). The up-regulation of the antioxidant enzymes and molecules for detoxification of ROS, the regulation of genes responsible for the transport and the compartmentation of nutrients (Tavanti et al. 2021), synthesis and accumulation of the compatible osmolytes to maintain the turgor, regulation and improved water uptake and its efficient use, and the efficient compartmentalization of toxic ions into the vacuoles are involved in the ionic and water/osmotic homeostasis to help plants to avert stress induced damage (Munns and Tester 2008; Hashem et al. 2016).

To avoid damages caused by salinity, plants develop several mechanisms that are responsible for ionic and water/osmotic homeostasis via regulation of the genes responsible for nutrient transport and compartmentation, the solutes accumulation, and aquaporins expression. It was reported that salt overly sensitive 1 gene (SOS1) has a major role in keeping up the homeostasis of ions by managing Na⁺ and K⁺ transport in both tonoplast and plasma membrane (Yin et al. 2020)). However, the SKOR channel is engaged with K⁺ discharge into xylem (Long-Tang et al. 2018). Cation/Ca²⁺ exchangers are a basic segment of Ca²⁺ signaling pathways and capacity to move cytosolic Ca²⁺ ions across the membranes against the electrochemical gradient using the declining gradients of different cation species like Na⁺, K⁺ or H⁺ (Li et al. 2016). Additionally, Ca²⁺ spiking happen during initial periods of the colonization of root by AM organisms (Gutjahr and Parniske 2013). Plasma-membrane intrinsic proteins (PIPs); which belong to the subfamily of plant aquaporins, were shown to be primary channels mediating water uptake in the plant cells and PIP2.4 transport water and able to mediate water loss from plant cells under salt stress (Vajpai et al. 2018). Moreover, the upregulation of aquaporin genes is one of the mechanisms through which the mycorrhizal symbiosis enhance the regulation of water status in plants (Evelin et al. 2019). On the other hand, NRT2.4 gene is one of the seven NRT2 (nitrate transporters 2) family genes and is a double liking transporter that adds to both low-and high-affinity nitrate uptake by the roots (Wang et al. 2012). Furthermore, PHO1 gene is a Pi exporter act as a mediating efflux of Pi outside the cells, the transfer of Pi from the roots to the shoots and may have role in the salt stress response (Wang et al, 2019).

A direct helpful impact of Arbuscular Mycorrhizal Fungus (AMF) on the growth and development of plant under the salinity stress have been recommended in pistachio (Soleymanian et al. 2017), safflower (Abbaspour 2010), soybean (Hashem et al. 2019), cucumber (Hashem et al. 2018), watermelon (Ye et al. 2019), sweet sorghum (Wang et al. 2019), and tomato (Ebrahim and Saleem 2017). Pistachio ranks the fifth among global nut production, and is undergoing a surge worldwide. Although native to Mediterranean basin, it is currently cultivated in five continents. The main producers are the United States and Iran, with over 70% of total production (Faostat 2013). Despite the fact that pistachio is arranged as a salt-tolerant glycophyte variety, its yield is seriously diminished under high salinity and other abiotic stress (Hajiboland et al. 2014). As of late, soil salinization, high temperature, and decrease of soil water stockpiling have become a danger to a dominant part of pistachio territories in Iran, which has negative monetary, ecological and social effects (Aliakbarkhani et al. 2015).

Previous studies reported that inoculation of three pistachio rootstocks resulted in colonization percentages ranging from 39 to 80% (Ferguson et al., 1997) and various mycorrhizal fungi significantly enhance the growth and nutrient uptake of pistachio plant (Fattahi et al. 2021). The mycorrhizal inoculation of pistachio plants grown under different water regimes increased plant drought tolerance by means of drought avoidance and drought tolerance mechanisms (Bagheri et al. 2011; Abbaspour et al. 2012). Additionally, mycorrhizal symbiosis improved the plant growth and to raise pistachio tolerance against cadmium stress (Rohani et al. 2019). Mycorrhizal, mainly Glomus versiforme, exhibited greater efficiency in alleviating salt stress of pistachio plants as suggested by Abbaspour et al. (2016); however, the degree of salt tolerance in different varieties is not precisely known. Therefore, the aims of the current study were to evaluate the effect of AM, Rhizophagus irregularis, on pistachio plants grown under No/NaCl stress condition, to investigate whether AM inoculation alleviated salinity through variations in physiological and biochemical attributes and a number of genes related to nutrient uptake and salt stress (SOS1, CCX2, SKOR, NRT2.4, PIP2.4 and PHO1).

Material and methods

Experimental design

The study was conducted in a completely randomized design with two mycorrhizal inoculations (+AMF) and non-inoculated (-AMF) treatments. Four replicates of each treatment were performed for an aggregate of 16 pots with the goal that half of them were cultivated under 0 mM NaCl while the other half was exposed to 250 mM NaCl stressed. The places of the pots were changed each week.

Arbuscular mycorrhizal inoculum

The AMF species used in the study was Rhizophagus irregularis Becker and Gerdemann (Gec). Pure starter cultures of the AMF species Rhizophagus irregularis (previously known as Glomus intraradices) were obtained from the International Culture Collection of Arbuscular and Vesicular Arbuscular mycorrhizal fungi (INVAM). R. irregularis was multiplied in pot cultures with sterilized fine sand as a substrate. Maize (Zea mays L.) was used as a host and was cultured in a greenhouse under natural conditions of temperature, light and humidity for 3 months. Maize plants were harvested just prior to inoculation by excising and discarding shoots. The mycorrhizal fungal inocula used in the current study comprised of soil containing spores (the spore density was 10-12/g dry soil) hyphae, and infected root fragments of Maize (Zea mays L.) plants with an infection level about 60-70 % were isolated previously (Abbaspour et al. 2010, 2012).

Plant growth with salt and AMF treatments

A greenhouse experiment was conducted during 2017 at the Islamic Azad University, Damghan, Iran. Greenhouse conditions were as per the following: temperature system of 32/19°C (day/night), with normal relative humidity of 51% and 13/11 h light/dark period at greatest photosynthetic photon flux density of 921 µ mol m⁻²/s⁻¹. Seeds of Pistacia vera L. cv. Ohadi, were surface sterilized with 20% solution of sodium hypochlorite in distilled water and afterward incubated at 30°C on a sterile moist cloth for 10 days. Seedlings were planted in plastic pots (30 cm × 20 cm) containing substrate (silty clay soil mixed with sand 1:5, V/V) (6 seedlings/pot) at a profundity of around 3 cm. The number of seedlings per pot was decreased to three uniform seedlings when the development time frame was finished around 3 weeks of planting. The characteristics of the soil after mixing with sand were: pH 6.9, EC 1.6 ds/m, 5.6% silt, 15.1% clay, 79.3% sand, 1.3% organic matter, 10.9 mg/kg P, 143 mg/kg K and 34 mg/kg N. To stimulate mycorrhiza formation, P was not added to soil. Thirteen days old pistachio seedlings were inoculated with 100 g inoculum for mycorrhizal treatment or 100 g sterilized inoculum as the non-mycorrhizal treatment. Irrigation of all pots was done for 3 months utilizing Damghan typical urban water (with a salinity of 0.6 dS/m) at field capacity to permit sufficient growth of plant and symbiotic establishment. Two concentrations of saline solution (0 and 250 mmol/L NaCl) were added to the soil substrate by adding a predetermined amount of NaCl from a 1 mol/L stock saline solution based on the amount of substrate in the pots. The concentration of NaCl in the soil was adjusted gradually to avoid the osmotic shock. Plants were irrigated with NaCl solution (100 ml/pot) for 1 week and a total volume 400 ml of saline solution was added to each pot in the experiment. Plants were kept up under these conditions for one month and were watered with tap water until harvest.

Determination of AM colonization and growth parameters

The plants were harvested after they had been grown under salt stress conditions for 30 days. Growth parameters, i.e plant height and stem diameter (for the first internode) were measured using a ruler (0.01 cm exactness) and a computerized caliper (0.01 mm precision), respectively. Leaf area was resolved to utilize an AM-200 leaf area meter. Subsequent to tallying the number of branches and leaves, shoot and root were separated and their dry weights were recorded after over-drying at 70 ^OC for 72 h. Mycorrhizal colonization in roots of pistachio was determined as described by Phillips and Hayman (1970), and percentage colonization was calculated according to Giovanetti and Mosse (1980). The percentage of AM colonization in pistachio roots was estimated utilizing the gridline intersection method (Biermann and Linderman, 1981) as recently portrayed (Abbaspour 2010, 2016; Abbaspour et al. 2012).

Estimation of mineral nutrient concentrations

Shoot dried samples were acid digested, Na⁺, K⁺, Mg²⁺ and Ca²⁺ were determined according to Wolf (1982) utilizing a flamephotometer. Phosphorus and nitrogen content were determined in dried shoot colorimetrically (Lueck and Boltz 1958). Other mineral nutrients (Zn, Cu, Fe, and Ca) were determined by the addition of 1M hydrochloric acid to the processed dried shoot powder. The elements concentrations were analyzed by atomic absorption spectrophotometer.

Determination of oxidative stress markers and osmoregulatory compounds

ROS such as hydrogen peroxide (H₂O₂) and superoxide anion (O2^•−) were measured as described by Zhao et al. (2016). Plant leaf (0.3 g) was homogenized with 3 ml of 50 mM phosphate buffer (pH 7.8) and centrifuged (12000 × g for 20 min at 4 °C). Hydroxylamine hydrochloride (1 ml) was mixed with 1 ml of the supernatant and the mixture was incubated at 25 °C for 20 min. After the incubation, the absorption was monitored at 530 nm and O2^•− was determined by a standard curve based on sodium nitrite.

H₂O₂ content was determined by the method described by Gururani et al. (2016). Fresh leaves samples (0.5 g) were homogenized with 5 ml 0.1% (w/v) TCA in an ice water bath. The homogenate was centrifuged for 15 min at 12,000 x g. 0.5 ml potassium phosphate buffer (100 mM, pH 7.0) and 1 ml of 1 M KI were added to 0.5 ml of the supernatant. The absorbance was recorded at 390 nm and H₂O₂ concentration was determined depending on a standard curve. The quantitative estimation of malondialdehyde (MDA) was carried out according to Huang et al. (2015). Glycine betaine as the osmoregulatory compound in pistachio leaves was determined according to Soleymanian et al. (2017).

Determination of RWC and MSI

The method described by Zhang et al. (2013) was utilized for the determination of relative water content (RWC). Briefly, fresh leaves (plates of 1 cm breadth) were collected from the completely extended leaves using a leaf punch. Fresh weight (FW) was estimated following harvest; the samples were submerged in deionized water for 5 h at 4 °C in the dark and turgid weight (TW) was estimated. Leaf samples were dried in an oven at 70 °C for 24 h, and the dry weight (DW) was recorded. Leaf RWC was determined as follows:

$$RWC=\left[\left(FW-DW\right)/\left(TW-DW\right)\right]\times 100.$$

Samples of green fully extended leaves (around 400 mg) were from each pot to determine membrane stability index (MSI). The leaf material was separated in two arrangements of 200 mg each. The first set was heated at 40°C for 30 min in a water bath (10 cm³); at that point the electrical conductivity (C1) was estimated. The subsequent set was bubbled at 100°C for 10 min (in 10 cm³ of water) before estimating the electrical conductivity (C2). MSI was determined according to Sairam et al. (1997) as follows:

$$MSI=\left[1-\left(C1/C2\right)\right]\times 100$$

RNA extraction and gene expression analysis

RNA was extracted utilizing the Easy BLUE absolute RNA extraction kit (iNtRON). RNA concentration was estimated using the Nanodrop and the quality was analyzed utilizing electrophoresis. DNase treatment and cDNA synthesis was done using Power cDNA Synthesis Kit (iNtRON) instruction. For each sample, 2 µg of RNA was reverse transcribed into cDNA with reverse transcription reaction mixture of Power cDNA Synthesis Kit (iNtRON). Real Time PCR was performed with Power SYBR Green PCR Master Mix (ABI). Amplifications were performed using 25 ng cDNA in a 20 μL final volume with an Applied Biosystems step-one Plus (ABI) with standard conditions: 5 min at 95 °C, 40 cycles of 15 s at 95 °C, and 60 s at 60 °C. For each target gene, PCR primers were designed based on P. vera sequences deposited in NCBI (https://www.ncbi.nlm.nih.gov/genbank/; Table 1). All PCR reactions were carried out in triplicates. The actin gene of pistachio was utilized as an endogenous reference gene. The qPCR results were examined utilizing the 2-ΔΔCT method (Livak and Schmittgen 2001).

Table 1.

Primer sequences used for qRT-PCR analysis

Primer name	sequences (5'-3')	GenBank accession number	Tm (°C)	PCR product length (bp)
F-SOS1	CGACGATATCCCCAGGGCTT	XM_031407501.1	60	97
R-SOS1	GTTGGCGCTCTTGACAGACG
F-NRT2.4	CTCCCACCTCCTCTCTTGCC	XM_031403821.1	60	98
R- NRT2.4	GGCCGGTTCTCTTCCTGTGA
F-PIP2.4	TGCTGATGATCGATGCCCGT	XM_031397857.1	60	96
R-PIP2.4	GAACTTGGGTTTGGTCGGCG
F-PHO1	ACCGAGCCAAGTTGATGCCA	XM_031411831.1	60	95
R-PHO1	AGCGTGTGGGGCGATAGAAA
F-SKOR	ATGGGCACTCTACTCGTCCT	XM_031403972.1	60	95
R-SKOR	ACTGCCCAGCAATGTCCAAA
F-CCX2	TGAAAGCCTATCGAGGCTGC	XM_031411763.1	60	86
R-CCX2	AAACATCAGGGGCGCCATTA
F-EF1α	TCAGGTGCCAAGGTCACCAA	XM_031400539.1	60	71
R-EF1α	GCCTAGCTACGGTAGACCTCC

Statistical Analysis

Data were subjected to analyses of variance (ANOVA) using the statistical software package SPSS 22.0. The data were assessed for normality and variance homogeneity prior to ANOVA. The data presented in the tables and figures are expressed as mean values based on four replicates ± standard error (S.E.) per treatment. Tukey’s test was utilized to compare the differences between individual means. The significance probability levels of the results were given at p< 0.02 level.

Results

After 120 days under mycorrhizal colonization, characteristic physiological and morphological structures of AMF were noticed in pistachio roots inoculated with Rhizophagus irregularis. The salt toxicity symptoms, for example, chlorosis and withering, were outwardly observable under salt treatment and injury indications were more serious in non-mycorrhizal plants than mycorrhizal plants. The AM colonization rates for different treatments of pistachio seedlings are presented in Table (2). No AMF colonization was observed in the roots of the non-inoculated plants. AMF root colonization happened following the inoculation with AMF, and mycorrhizal colonization level was significantly diminished by the salt stress (Table 2).

Table 2.

Growth parameters of mycorrhizal (+ AMF) and non-mycorrhizal (−AMF) pistachio seedling grown under salt stressed and no-stressed conditions

NaCl level (mM)	Mycorrhizal treatment	AM colonization (%)	Plant height (cm)	Shoot dry weight (g)	Root dry weight (g)	Stem diameter (mm)	Leaf area (mm2)
0	+ AMF	58.4 ± 3.1a	32.8 ± 1.2a	2.03 ± 0.09a	0.68 ± 0.03a	4.49 ± 0.4a	967 ± 45a
	−AMF	0.0	29.2 ± 1.8b	1.64 ± 0.05b	0.49 ± 0.04b	4.26 ± 0.1a	820 ± 68b
250	+ AMF	41.2 ± 3.8b	23.9 ± 2.7c	1.21 ± 0.07c	0.52 ± 0.03b	3.93 ± 0.09b	695 ± 73c
	−AMF	0.0	17.2 ± 1.6d	0.79 ± 0.02d	0.35 ± 0.05c	3.71 ± 0.3b	514 ± 94d

Within each column, mean superscript with different letter are significantly different (p < 0.02, Tukey’s test)

AMF symbiosis positively influenced the growth and development of the plant under normal and saline conditions. Growth parameters, including plant height, the dry weight of shoot and root, stem diameter and leaf area were higher in mycorrhizal than in non-mycorrhizal plants under saline and non-saline conditions, in spite of the fact that the differences for stem diameter was not significant (Table 2). Salt treatment significantly affected the growth parameters in mycorrhizal and non-mycorrhizal seedlings, yet the AM seedlings grew better than NM seedlings during salt stress and normal conditions (Table 2). During the 250 mM NaCl treatment, plant height, shoot dry weight, root dry weight, stem diameter and leaf area of the mycorrhizal inoculated pistachio plant increased by 38.9, 53.2, 48.6, 5.9 and 35.2 %, respectively, in contrast with those of the non-mycorrhizal pistachio (Table 4). These outcomes indicated that AMF inoculation significantly enhanced the survival of P. vera seedlings in the presence of 250 mM NaCl.

Table 4.

Percent of changes in growth variables and nutrient contents of pistachio shoot due to AMF colonization grown at different salinity levels

NaCl level (mM)	N	P	K	Ca	Mg	Na	Fe	K/Na	Ca/Na	Plant height	Shoot DW	Root DW	Stem diameter	Leaf area
0	6.4	28.2	9.5	6.6	14.4	13.1	15.5	3.6	6.2	12.3	23.8	38.8	5.4	17.9
250	9.1	71.6	11.8	11.2	26.5	-66.8	60.2	87.5	80.1	38.9	53.2	48.6	5.9	35.2

Percent of changes in growth parameters and nutrient contents was calculated using the amounts of NM and AM plants in the following equations

Growth variable (GV) = (GV_AM – GV_NM)/ GV_NM × 100; Nutrient content (NC) = (NC _AM – NC _NM)/ NC _NM × 100

The elemental concentrations and their percentage changes in nutrient contents in pistachio shoot as a function of salinity and mycorrhiza are presented in Tables (3 and 4). The concentration of Na was increased significantly by salinity in both AMF and NMF plants. AMF plants had less Na content than NMF plants at 250 mM salt levels. The contents of Na in AMF plants were significantly reduced by 66.8 % at 250 mM NaCl, albeit no significant difference in Na level was found in the control treatment (Tables 3 and 4). Salt stress treatment resulted in a significant increment in K and Ca content by the shoots of AMF and NMF plants; however, the levels of N, P, Mg, and Fe were diminished. Also, Mg content in AMF and NMF plants and N, P and Fe content in NMF plants were decreased significantly under salt stress (Table 3). During the salt treatment, the N, P, K, Ca, Mg, and Fe levels of AMF plants were increased by 9.1, 71.6, 11.8, 11.2, 26.5, and 60.2%, respectively, in contrast to those of the NMF plants (Table 4). The K/Na and Ca/Na ratios in the shoot were affected significantly by salt treatment. Under control conditions, the K/Na and Ca/Na ratios were not significantly different the AMF and NMF plants. AMF pistachio showed increased K/Na and Ca/Na ratios during salt stress as compared to NMF pistachio (Table 3). During salt treatment, the K/Na and Ca/Na ratio of AMF plants increased by 87.5, and 80.1 %, respectively, contrasted and those of the NMF plants (Table 4).

Table 3.

Shoot content of N, P, K, Ca, Mg, Na, Fe, and K/Na and Ca/Na ratios in + AMF and -AMF pistachio seedlings grown during salt stressed and no-stressed conditions

NaCl level (mM)	Mycorrhizal treatment	N (mg/g DW)	P (mg/g DW)	K (mg/g DW)	Ca (mg/g DW)	Mg (mg/g DW)	Na (mg/g DW)	Fe (µg/g DW)	K/Na	Ca/Na
0	+ AMF	384 ± 11a	23.2 ± 2.1a	920 ± 68bc	790 ± 23b	175 ± 12a	164 ± 13c	3270 ± 245a	5.6 ± 0.3a	4.8 ± 0.3a
	−AMF	361 ± 9b	18.1 ± 1.3b	840 ± 47c	741 ± 25c	153 ± 9b	145 ± 24c	2831 ± 300a	5.8 ± 0.6a	5.1 ± 0.1a
250	+ AMF	373 ± 14ab	21.8 ± 1.8a	1054 ± 56a	904 ± 40a	124 ± 10c	232 ± 18b	2947 ± 285a	4.5 ± 0.3b	3.8 ± 0.7b
	−AMF	342 ± 7c	12.7 ± 1.5c	943 ± 48b	813 ± 33b	98 ± 13d	387 ± 26a	1840 ± 268b	2.4 ± 0.2c	2.1 ± 0.3c

Within each column, means superscripts with the same letter are not differ significantly (p < 0.02, Tukey’s test)

Soil salinization significantly diminished the relative water content (RWC) and the membrane stability index (MSI) values compared to the non-stressed condition in both inoculated and non-inoculated seedlings with AMF (Fig 1A, B). While under control treatment no impact was seen by AMF symbiosis, during NaCl treatment, the MSI and RWC values were significantly higher in inoculated plants contrasted with non- inoculated plants. AMF inoculation significantly alleviated MSI and RWC by 19.3, and 31.1 %, respectively, under salt stress. Thus, mycorrhiza inoculation was favorable in plants by enhancing the RWC and MSI to mitigate the salt stress.

Fig.1.

Effect of mycorrhizal vaccination on MSI (A), RWC (B), O2• − (C), H₂O₂ (D), MDA (E) and glycine betaine substance (F) of pistachio plants in response to salinity stress. Columns with different letters are significantly different at p < 0.02 (Tukey’s test). M and NM represent mycorrhizal and non-mycorrhizal pistachio plants, respectively

The effect of NaCl treatment on oxidative stress markers (lipid peroxidation, hydrogen peroxide and superoxide anion formation) in pistachios (Fig. 1C-E) revealed that salt stress significantly increased H₂O₂ and O^2•− in both AMF and NMF (Fig. 1C, D). However, the level of H₂O₂ and O^2•− were significantly decreased after inoculum with AMF compared with NMF inoculated treatment by 28.3 and 36.8 %, respectively. MDA increased significantly by NaCl treatment compared to the control which showed a significant decrease by 23.1% after AMF treatment (Fig. 1E). Glycine betaine was increased significantly in both mycorrhizal and non-mycorrhizal plants during salt stress (Fig 1F). An enhanced glycine betaine concentration in pistachio during NaCl treatment was demonstrated which indicated that the viable plant stress reaction at the metabolic level. Additionally, glycine betaine was increased by the salt stress both in the NMF and AMF plants. AMF assisted with improving the salt stress impacts in plants by diminishing ROS production and lipid peroxidation and increased glycine betaine concentration in pistachio compared to NaCl-stressed plants.

Ion analyses suggested that AMF influences tissue K⁺, Na⁺, Ca²⁺, P and N. Along these lines, the current study investigated whether membrane transporters involved in shoot ion and elemental deposition were influenced at the transcript level by AMF colonization. In the root tissues of pistachio seedlings, the expression of SOS1 and SKOR was upregulated in both Rhizophagus irregularis inoculated and non-inoculated plants during salinity stress. In any case, expression level of SOS1 and SKOR gene in roots of Rhizophagus irregularis inoculated plants was higher than non- inoculated plants under salinity stress (Fig. 2). The transcription level of CCX2 gene in roots of both inoculated and non-inoculated plants was significantly increased during the salinity treatment compared to the control by 7.2 and 4.2-fold, respectively.

Fig. 2.

Effect of mycorrhizal vaccination on the expression of SOS1, SKOR, CCX2, PIP2.4, PHO1, and NRT2.4 genes in root of pistachio plants in response to salinity stress. Columns with different letters are significantly different at p < 0.02 (Tukey’s test). M and NM represent mycorrhizal and non-mycorrhizal pistachio plants, respectively

Under non-saline conditions, the mRNA level of PIP2.4 in roots of inoculated plants was significantly higher than those of non-inoculated ones. NaCl treatment increased the expression of PIP2.4 gene in the roots of both inoculated and non-inoculated plants (Fig. 2). The expression of nitrate transporter gene (NRT2.4) was emphatically influenced by the salinity level in non-mycorrhizal plants or inoculated plants compared to the control by 2.3 and 6.5-fold, respectively (Fig. 2). In non-saline conditions, the expression of NRT2.4 in inoculated plants was significantly higher than non-inoculated ones. It was noticed similar outcomes for phosphate transporter gene (PHO1) with the goal that the utilization of NaCl improved impressively the expression of the PHO1gene in roots of plants colonized by R. irregularis compared to the control plants.

Discussion

Salt stress is a serious problem for agricultural production as salinity has negative impacts on a large portion of yields. Numerous reports showed that salinity can inhibit the growth of plant through different mechanisms including the damage to enzymes and plasma membranes (Hussain et al. 2021), decrease in plant water accessibility due to the lower soil water potential (Soltabayeva et al. 2021), accumulation of toxic elements (i.e., Na and Cl), obstruction of chlorophyll and protein synthesis, decrease in nutrient uptake, transport as well as partitioning inside the plant (Grattan and Grieve 1998). The negative impact on the root colonization to NaCl treatment may be due to the toxic substances accumulated in the rhizosphere that further limit spore germination and the hyphal development of AMF (Trindade et al. 2006).

In this study, salinity stress significantly decreased growth parameters. Decreased rate of cell division and cell elongation because of stress are the primary factors for diminished growth of plants under stress (Yasseen et al. 1987). Similar outcomes were reported by several investigators (Ashraf and Foolad 2013; Acosta-Motos et al. 2017; Ansari et al. 2019) who suggested that inoculation by AMF diminished the negative impacts of salinity on pistachio growth and development. The advancement of plant growth by AMF has been reported also in different plant species (Gąstoł and Domagała-Świątkiewicz 2015; Hashem et al. 2018; Ye et al. 2019). The growth improvement of plants by mycorrhizal symbiosis is likely attributed to the absorption of more water and the nutrient acquisition by mycorrhizal extra radical hyphae (Hashem et al. 2019; Lenoir et al. 2016).

The current study demonstrated the effect of NaCl on pistachio nutrient content in the shoot. Salt stress increased Na contents, since plants take up more Na when salt concentrations in the soil are high (Evelin et al. 2019). The increase in Na concentration disturbs the nutrient balance, osmotic regulation and causes ion toxicity (Munns and Tester 2008). Also, salinity increases the K and Ca levels that mostly because of the mechanism of abiotic stress resistance of P. vera. In addition, Ca serves as an important cellular messenger for plant growth signaling (Talukdar, 2012; El-Beltagi and Mohamed, 2013), which help in raising the plant adaptation to salinity (Jarstfer et al., 1998). Interestingly, the levels of N, P, Mg, Fe, and K/Na and Ca/Na ratios were decreased by salinity, which may be due to the antagonism between the essential nutrient and toxic ion, and furthermore to make them immobilizing. Salinity conditions meddle with N acquisition by immobilizing it (Hodge and Fitter 2010) and mostly identified with the antagonism of nitrate metabolism from Cl (Ashraf et al. 2018) . Salt-induced interruption of membrane proteins that change plasma membrane integrity additionally affects the uptake of nitrogen (Köhler and Raschke 2000). Salinization renders P unavailable to plants because of its precipitation with different cations such as Ca, Mg, and Zn (Amin et al. 2021), along with these lines making salt-induced P deficiency in plants. Moreover, salinity reduces the solubility and mobility of micronutrients such as Fe (Grattan and Grieve 1998), thus, making a consumption zone around the root which brings about a decline in the take-up of the micronutrients by plants. These outcomes are in partial agreement with the recent reports (Chang et al. 2018; Ebrahim and Saleem 2017; Giri et al. 2003; Ye et al. 2019).

In the present study, colonized pistachio plants had a significant effect on important mineral nutrients than non-mycorrhizal plants under both control and salt stress conditions; however, the impacts were increasingly articulated during salt stress particularly for P and Fe ions. The explanation behind this could be that AM fungi frequently have increased the length as well as modified root architecture by means of the extra radical mycelia that increase mineral nutrient components take-up. Additionally, AM symbiosis interaction can specifically take up nutrients such as essential minerals while avoiding uptake of Na (Hammer et al. 2011). Improved nitrate uptake in AM plants is credited to AMF-mediated maintainance of membrane stability and increased nitrate reductase activity (Talaat and Shawky 2014). The increase N accumulation in shoots of AM plants may be also partially due to the AM symbiosis upregulation of N transport genes e.g NRT2.4. In this concern, Fileccia et al. (2017) reported that the high nitrogen uptake by AM durum Triticum aestivum plants (colonized with a mixture of Rhizophagus irregularis and Funneliformis mosseae) during salt stress is mainly due to the high expression of nitrate genes (NRT2.4, NAR2.2) and the ammonium transporters genes (AMT1.1 and AMT1.2).

The mobility of some elements such as P and Fe in soils is low. The main reasons for the increase in plant P uptake by AMF were suggested as follow; (i) the fungus overgrows the P depletion zone around the root to take up and transfer to the plant, since P presented in the zones of the soil is not accessible to the root and the increased availability of P in the soil due to secretion of acid and alkaline phosphatases by hyphae that liberates P from its bound form; (ii) maintenance of intrinsic phosphate concentration (Pi) by forming polyphosphates inside the hyphae; (iii) ability of AMF to take up P at lower threshold owing to the expression of high affinity phosphate transporter genes; and (iv) sustained movement of P into the roots as AMF capable of accumulating significant amounts of absorbed P than roots (Bolan 1991; Marschner and Dell. 1994; Selvaraj and Chellappan 2006; Abdel-Fattah and Asrar 2012). Higher P concentration in AMF pistachio seedlings reported herein under salt and non-salt condition may be due to the increased expression of phosphate transporter gene (PHO1). Thusly, in AM plants, increased expression of phosphate transporter gene and successful uptake of P help in maintaining cell membrane integrity, reducing ion leakage, removing toxic ions in vacuoles, and specific uptake of ions in this manner improving salt resistance in mycorrhizal plants (Rinaldelli and Mancuso 1996; Evelin et al. 2012).

This study also showed that the concentration of Na was significantly low in AMF than NMF pistachio during salt treatment. As indicated by Pedranzani et al. (2016), AMF excludes Na by separating its take-up during its transfer to the plants or from the soil as a strategy to limit the accumulation of this toxic ion in the photosynthetic tissues (Pedranzani et al. 2016). The inoculation of AMF enhances the stress resistance by the inhibition of sodium uptake and the regulation of ionic balance in the cells during the salinization of soil. Enhanced proficient nutrient acquisition by AMF plants has been accounted for by few specialists (Abbaspour 2016; Chang et al. 2018; Hashem et al. 2018; Wang et al. 2019). Results of this study demonstrated that AMF inoculation significantly advanced K/Na and Ca/Na ratio at NaCl-stress, this provides improved capacity of AMF in improving the uptake of K and Ca under salinity stress conditions. In view of the competition among Na and K for binding sites fundamental for different cellular functions (Evelin et al. 2013), along these lines keeping up a high K/Na ratio is a key component for plants neutralizing Na stress, as K and Na balance bears significance for keeping up membrane potential and the activities of numerous cytosolic enzymes (Arzani and Ashraf 2016). Ca participates in the important processes which protect the structural and the functional integrity of the plant membranes, control the ion transport and selectivity and stabilize cell wall structures (Maathuis and Amtmann 1999). Additionally, higher Ca uptake in mycorrhizal plants may mitigate NaCl-induced ionic imbalances (Evelin et al. 2013).

The current results prompted us to hypothesize that AMF may regulate the genes expression of plant encoding for ion transporters. The overexpression of Na⁺/H⁺ and K⁺/H⁺ antiporters and cation/calcium exchangers improved the salt tolerance in plants (Rodríguez-Rosales et al. 2008). However, the possible regulation of plant genes involved in ion homeostasis by the AMF symbiosis is still unclear. Until now, only Ouziad et al. (2006) have studied the effect of AMF symbiosis on the expression of Na⁺/H⁺ antiporter in tomato under salt stress conditions, and reported that no regulation of these genes by the AM symbiosis. Hence, we examined the expression of the three genes involved with Na⁺, K⁺ and Ca²⁺ transport in order to get some clues on molecular mechanisms involved in the enhanced resilience of the mycorrhizal plants to salinity stress. The SOS signaling pathway has a crucial role in keeping up ion homeostasis by regulating Na⁺ and K⁺ transport at both plasma membrane and the tonoplast. At the root tissues, SOS1 has been demonstrated to be involved in Na⁺ expulsion to the soil solution (Yin et al. 2020). However, the SKOR channel is involved in K⁺ release into the xylem at the root stele and therefore causes accumulation of K in the shoots (Long-Tang et al. 2018). Based on that, we analysed the expression of these pistachio genes in the roots of the different treatments. The most significant differences among treatments were seen at 250 mM NaCl for these two genes, where plants inoculated with R. irregularis showed enhanced relative expression. Conversely, under non-saline conditions, these plants consistently demonstrated decreased expression when compared with non-mycorrhizal plants. These results correlate with the higher K⁺ and lower Na⁺ concentrations found in the shoot tissues of pistachio plants. Moreover, pistachio seedlings colonized by AMF extensively increased the expression of SKOR gene when exposed to 250 mM NaCl. This increased in the expression of SKOR gene may has contributed to K⁺ retention in the plant tissues and accounted for the enhanced K⁺/Na⁺ ratios in AMF plants when contrasted with the non-AMF plants (Long-Tang et al. 2018).

Cation/Ca²⁺ exchangers are vital components of Ca ion signaling pathways and function as transporter for cytosolic Ca²⁺ across the membranes against its electrochemical gradient by using the declining gradients of other cation species such as H⁺, Na⁺, or K⁺ (Li et al. 2016). During salt stress condition, the cytosolic level of Ca²⁺ increased as it is transported from apoplast to intracellular space by plasma membrane Cation/Ca²⁺ exchangers and this transit of Ca²⁺ advance the transduction of stress signals which result in rising the plant adaptation to salinity. Additionally, Ca²⁺ spiking happens during several phases of the colonization of root by AMF organisms (Gutjahr and Parniske 2013). We noticed that the increased expression of CCX2 in pistachio seedlings colonized by AMF markedly compared to non-inoculated plants. This observation correlated with high Ca²⁺ concentration in AMF pistachio plants. This result confirms that keeping up a high K/Na and Ca/Na ratio under saline conditions is alluded to as a salt resistance mechanism and diminished negative impacts of Na on the growth and development of plant.

Salt stress decreased MSI and RWC in pistachio seedling, and these results agree with those reported previously (Munns and Tester 2008; Ansari et al 2019). The high salt level in the rhizosphere additionally imposes the physiological drought in the plants since salt immobilizes water and renders it inaccessible for the plants (Füzy et al. 2008). Salinity disturbs the harmony among transpiration and water take-up by plants and diminishes RWC. During salinity, RWC was altogether alleviated after AMF treatment, on the grounds that AMF plants had a higher height and dry weight of root than NMF. It is well known that the extensive extrametrical mycelium of AMF in the soil absorbs more water and nutrients (Ansari et al. 2019; Evelin et al. 2013; Ye et al. 2019). The better RWC in AMF plants might be elucidated by the AMF regulated aquaporin genes expression present in leaves and roots of salt stressed plants (Kapoor et al. 2019). Right now, R. irregularis inoculation increased the expression of PIP2.4 gene in the roots. Chen et al. (2017) and Aroca et al. (2007) showed an increase in aquaporins expression by useful fungi under salt stress. These authors reported that up regulated expression of aquaporins increases the root hydraulic conductivity and therefore increases the water absorption by the roots, which is reliable with the outcomes acquired from the improvement of the water status by AMF colonization in the current work.

Salinity intervened in hyperosmotic and hyperionic stress incite another secondary stress in plants, oxidative stress, resulted from the production of excess ROS (Gill and Tuteja 2010), hence, ROS content increased with salinity stress. Under salt stress, Na ions, water deficiency and significant level of ROS could diminish MSI (Ashraf and Foolad 2013; Volkov, 2015). It is demonstrated that AMF seedlings had higher MSI than NMF seedlings in view of less absorption of Na ion and high RWC. Increased membrane stability index by AMF pistachio plants has been studied by different specialists (Ansari et al. 2019; Fileccia et al. 2017) and suggested that under salt stress conditions; the AMF plants had a superior growth status than the NMF plants.

The excess ROS production disturbs different cell functions by attacking micro biomolecules such as nucleic acid, protein and membrane lipid. Salinity increases lipid peroxidation leading to higher membrane permeability and loss of ions from the cells (Evelin et al. 2012; Estrada et al. 2013; Pedranzani et al. 2016; Fileccia et al. 2017; Zhang et al. 2018). MDA is the decomposition result of polyunsaturated fatty acids of membranes and is used to evaluate the effect of oxidative stress ( Huang et al. 2015; Cao et al. 2018). So as to refute this effect, plants utilize osmoregulation as a system to endure salt stress (Zou et al. 2013). Osmolytes are small organic solutes, water-soluble, non-toxic at the high concentrations and called compatible solutes (Hajiboland et al. 2014). Right now, the AMF plant diminished MDA level and accumulation of ROS (H₂O₂, O^2•−) as well as increased the glycine betaine concentration during salinity. Glycine betaine (N, N, N-trimethyl glycine betaine) as one of the osmolytes, stabilizes the structure and activity of enzymes and protein complexes and keeps up the integrity of membranes against the harmful impacts of unreasonable salt; moreover, it is associated with ROS extinguishing (Annunziata et al. 2019 ). Increased gathering of glycine betaine in AMF-inoculated plants has been also considered (Soleymanian et al. 2017).

In this study, we applied a combination of physiological and molecular approaches in order to study novel insights into the AMF-mediated responses of pistachio plants under salinity stress. Due to the unavailability of most parts of the pistachio genome sequence, including stress-related responsive genes, the available sequences were examined. Moreover, a clear understanding of the mechanisms involved in AMF pistachio plants in response to salt stress requires more extensive studies.

Conclusion

The results of the present work showed that NaCl addition influenced pistachio plants and initiated severe growth depression, poor nutrition, oxidative and osmotic stresses bringing about the loss of membrane functioning because of lipid peroxidation. Nevertheless, the results of the current study also indicated that the growth, nutrient content and membrane integrity of P. vera seedlings could be increased by inoculation with R. irregularis. Mycorrhizal inoculation significantly improved pistachio by diminishing the negative impacts of salinity stress. Arbuscular mycorrhizal fungi protect the plants against salt stress through increasing host plant nutrition, keeping up higher K/Na and Ca/Na ratios, improving osmotic adjustment by the glycine betaine accumulation, up-regulation of ion and nutrient transporter genes, higher RWC and MSI. The noticeable impact of AMF against salinity was demonstrated to be because of a limitation in Na take-up by roots and to the homeostasis of nutrient take-up. Along these lines, the information from this work proposes that R. irregularis mycorrhizal can be a successful symbiosis to improve pistachio on saline agricultural lands.

Authors' contributions

H. Abbaspour and Fatemeh S. Nematpour conceived the original idea, carried out the experiment, performed the computations and verified the analytical methods. M.A. Abdel-Wahhab edited the manuscript with support from Abbaspour and Pour. All authors discussed the results and contributed to the final manuscript.

Declarations

Conflicts of interest

The authors declare that they have no conflict of interest.