Abstract
The human pathogenic fungus Candida albicans is a frequent cause of mucosal infections. Although the ability to transition from the yeast to the hypha morphology is essential for virulence, hypha formation and host cell invasion per se are not sufficient for the induction of epithelial damage. Rather, the hypha-associated peptide toxin, candidalysin, a product of the Ece1 polyprotein, is the critical damaging factor. While synthetic, exogenously added candidalysin is sufficient to damage epithelial cells, the level of damage does not reach the same level as invading C. albicans hyphae. Therefore, we hypothesized that a combination of fungal attributes is required to deliver candidalysin to the invasion pocket to enable the full damaging potential of C. albicans during infection. Utilizing a panel of C. albicans mutants with known virulence defects, we demonstrate that the full damage potential of C. albicans requires the coordinated delivery of candidalysin to the invasion pocket. This process requires appropriate epithelial adhesion, hyphal extension and invasion, high levels of ECE1 transcription, proper Ece1 processing, and secretion of candidalysin. To confirm candidalysin delivery, we generated camelid VHHs (nanobodies) specific for candidalysin, and demonstrate localization and accumulation of the toxin only in C. albicans-induced invasion pockets. In summary, a defined combination of virulence attributes and cellular processes is critical for delivering candidalysin to the invasion pocket to enable the full damage potential of C. albicans during mucosal infection.
1. Introduction
Candida albicans is a commensal fungus in the majority of the human population, but also frequently causes mucosal infections and, in severe cases, life-threatening systemic infections (Brown et al., 2012). The ability of C. albicans to cause such diseases is mediated by a wide range of virulence attributes. This includes the morphological transition between the yeast and the filamentous form, and the production of the peptide toxin candidalysin (Mayer et al., 2013, Moyes et al., 2016, Wilson et al., 2016).
Although yeast cells are required for dissemination via the bloodstream during systemic infections, the hyphal form is the more invasive morphology (Jacobsen et al., 2012, Kornitzer, 2019). In fact, hypha formation is accompanied by the deployment of several additional virulence attributes, including adhesins, invasins, metal acquisition factors, hydrolytic and detoxifying enzymes and thigmotropism (Wachtler et al., 2011, Mayer et al., 2013, Brunke et al., 2016). Of the multiple genes identified as essential for mediating the full virulence potential of C. albicans, many are required for or associated with filamentation, demonstrating the critical role of hypha formation in C. albicans pathogenesis (Mayer et al., 2013).
During mucosal infection, the yeast-to-hypha transition is initiated by contact to epithelial cells (Phan et al., 2000, Zakikhany et al., 2008, Dalle et al., 2010, Sudbery, 2011, Wachtler et al., 2011). The initial step of filamentation, described as germ tube formation, is associated with increased adhesion to epithelia, mediated by hypha-associated adhesins such as Als3 (Hoyer et al., 1998). Extending hyphae grow along host cell surfaces and change their directional growth by contact sensing, also termed thigmotropism (Gow, 1997, Brand et al., 2007). This feature is required for the invasive properties of hyphae, since mutants lacking proteins associated with thigmotropism, such as Bud2, show reduced invasive growth (Brand et al., 2008). Invasion of epithelial cells occurs via “induced endocytosis” and “active penetration” depending on the epithelial cell type and both routes require hypha formation (Zakikhany et al., 2007, Mayer et al., 2013). Induced endocytosis is a host driven process triggered by hypha-associated invasins, in particular Als3, which acts as both an adhesin and invasin (Phan et al., 2000, Wachtler et al., 2011). Active penetration is a fungal driven process mediated by the physical forces and properties of elongating hyphae (Zakikhany et al., 2007, Dalle et al., 2010). Both induced endocytosis and active penetration cause invagination of epithelial cells and the formation of an “invasion pocket” in which the hypha is tightly surrounded by the host membrane (Zakikhany et al., 2007, Wachtler et al., 2012). Since the majority of proteins secreted by hyphae are transported to the hyphal tip via a complex secretion machinery (the Spitzenkörper) (Weiner et al., 2019), proteins or peptides secreted by hyphae in this scenario are expected to be secreted into the invasion pocket.
Mutants incapable of producing hyphae, such as a mutant lacking two key transcriptional regulators of the yeast-to-hypha transition – Cph1 and Efg1 – have poor adherence kinetics and are non-invasive (Lo et al., 1997, Ramage et al., 2002, Wachtler et al., 2011). Mutants which are unable to extend their growth at the hyphal tip, like a mutant lacking the protein Eed1 (Zakikhany et al., 2007, Martin et al., 2011), are only poorly able to invade host tissues. The eed1ΔΔ mutant produces short hyphae, expresses the full set of hypha-associated genes (HAGs) at early time points, and invades superficially, but then fails to maintain hyphal elongation (Zakikhany et al., 2007, Martin et al., 2011, Polke et al., 2017). Instead, eed1ΔΔ cells switch back to yeast growth and proliferate as yeast cells, a portion of them remaining inside the invaded cell (Zakikhany et al., 2007). Another C. albicans mutant lacking Hgc1, a G1 cyclin-related protein and regulator of morphogenesis, forms very short germ tubes but is unable to maintain filamentation (Zheng et al., 2004). Although hgc1ΔΔ still expresses HAGs (Zheng et al., 2004), it has a reduced potential to invade epithelial cells (Wachtler et al., 2011). A systematic study of 26 C. albicans mutants showed that all mutants with reduced potential to adhere to and/or invade into epithelial cells, including mutants with dysfunctional contact sensing, are also unable to fully induce epithelial damage (Wachtler et al., 2011).
While hypha formation and maintenance are critical for invasion, the key virulence attribute responsible for inducing epithelial damage is candidalysin (Moyes et al., 2016). This peptide toxin, a product of the larger Ece1 (extent of cell elongation, (Birse et al., 1993)) polyprotein, is exclusively secreted by C. albicans hyphae, and is responsible for pore-induced damage of different epithelial cell types, including oral, vaginal, and intestinal cells (Moyes et al., 2016, Richardson et al., 2017, Allert et al., 2018, Richardson et al., 2018). Processing of Ece1 requires the sequential activities of the Golgi-located proteases Kex2 and Kex1 (Moyes et al., 2016, Richardson et al., 2018). C. albicans mutants lacking Ece1 or the candidalysin-coding sequence only, are unable to damage epithelial cells, despite normal hypha formation. Incomplete processing of candidalysin also prevents epithelial damage (Richardson et al., 2018). Importantly, these studies showed that it is candidalysin’s activity that damages host cells rather than C. albicans hypha formation and host cell invasion per se, which finally decoupled epithelial damage from hypha formation (Wilson et al., 2016). However, while synthetic, exogenously added candidalysin is sufficient to lyse epithelial cells (Moyes et al., 2016), the degree of damage does not reach the same level as C. albicans hyphae invading epithelial cells, unless extremely high concentrations of the peptide are applied (Moyes et al., 2016, Allert et al., 2018). Therefore, we hypothesized that a combination of fungal attributes and cellular processes is required for the full damage potential of C. albicans during epithelial infection.
In this study, we utilized a selected panel of C. albicans mutants with known virulence defects to demonstrate that the full damage observed with wild type C. albicans cells requires a defined combination of virulence attributes to deliver candidalysin to the invasion pocket during mucosal infections. This process requires appropriate adhesion, hyphal extension and invasion, high levels of ECE1 transcription, proper Ece1 processing and, finally, secretion of candidalysin. Candidalysin delivery to the invasion pocket was confirmed using camelid VHHs (nanobodies) specific for candidalysin.
2. Results
2.1. Diverse C. albicans mutants show reduced oral epithelial damage
To dissect which virulence attributes of C. albicans are required for full epithelial damage (relative to the wild type infection) in combination with the production of mature candidalysin, we analyzed a panel of mutants with known defects in hypha formation (cph1ΔΔ/efg1ΔΔ; hgc1ΔΔ), hypha extension (eed1ΔΔ), thigmotropism (bud2ΔΔ), adhesion (als3ΔΔ), Ece1 processing (kex2ΔΔ, kex1ΔΔ) and lacking Ece1 (ece1ΔΔ) (Table 1). All mutants grew normally in their yeast morphology and thus have no general growth defect. However, some mutants show multiple other defects, for example the kex2ΔΔ mutant is not only unable to process the Ece1 polypeptide (Richardson et al., 2018) but also multiple other pro-proteins with Lys-Arg processing sites (e.g. secreted aspartic proteases (Newport et al., 1997, Naglik et al., 2003) and is known to have defects in hypha formation (Newport et al., 1997, Newport et al., 2003). Damage caused to TR146 OECs is summarized in Figure 1A. All mutants showed either an intermediate (hgc1ΔΔ, bud2ΔΔ) or a (very) strongly reduced damage potential (cph1ΔΔ/efg1ΔΔ, eed1ΔΔ, als3ΔΔ, kex1ΔΔ, kex2ΔΔ, ece1ΔΔ), indicating that hypha formation and extension, thigmotropism, adhesion, Ece1 production and processing are all critical to enable full epithelial damage by C. albicans.
Table 1.
Strains used in this study.
| Strain name | Internal name | Relevant genotype | Relevant published or expected phenotype | Reference |
|---|---|---|---|---|
| BWP17/CIp30 | M1477 | ura3::λimm434/ura3::λimm434 iro1::λimm434/iro1::λimm434 his1::hisG/his1::hisG arg4::hisG/arg4::hisG RPS1/rps1::(URA3-HIS1-ARG4) | Isogenic wild type. | (Zakikhany et al., 2007) |
| cph1ΔΔ/efg1ΔΔ | M2065 | cph1::hisG/cph1::hisG efg1::hisG/efg1::hisG RPS1/rps1::URA3 | Yeast-locked. No expression of HAGs. | (Wartenberg et al., 2014) |
| hgc1ΔΔ | M1309 | hgc1::HIS1/hgc1::ARG4 RPS1/rps1::URA3 | Forms germ tubes but is unable to properly filament. Still expresses HAGs. | (Zheng et al., 2004) |
| eed1ΔΔ | M1263 | eed1::HIS1/eed1::ARG4 RPS1/rps1::URA3 | Switches back to yeast growth after initial germ tube formation. Starts invasion, but remains trapped, no interepithelial dissemination. | (Zakikhany et al., 2007) |
| bud2ΔΔ | M1412 | bud2::ARG4/URA3-bud2::bud2::HIS1 | Aberrant thigmotropic growth. Reduced invasion. | (Hausauer et al., 2005) |
| als3ΔΔ | M1284 | als3::ARG4/als3::HIS1 ura3::λimm434/ura3::(URA3-IRO1) | Reduced adhesion to ECs. | (Nobile et al., 2006) |
| kex2ΔΔ | M215 | kex2::hisG/kex2::hisG-URA3-hisG | Inability to form hyphae. Inability to process Ece1. | (Newport et al., 1997) |
| kex1ΔΔ | M2248 | kex1::HIS1/kex1::ARG4 RPS1/rps1::URA3 | Incomplete processing of candidalysin, reduced damage on ECs. | (Moyes et al., 2016) |
| ece1ΔΔ | M2057 | ece1::ARG4/ece1::HIS1 RPS1/rps1::URA3 | No damage on ECs. | (Moyes et al., 2016) |
| cph1ΔΔ/efg1ΔΔ+pENO1-ECE1 | M2360 | cph1::hisG/cph1::hisG efg1::hisG/efg1::hisG-URA3-hisG caSAT1-pENO1-ECE1/ECE1 | Yeast-locked. Forced transcription of ECE1. | (Westman et al., 2018) |
| BWP17/CIp30+pENO1-ECE1 | M2682 | caSAT1-pENO1-ECE1/ECE1 | Wild type expressing ECE1 from constitutive promoter, but in original ECE1 locus. Control strain. Also transcribes ECE1 from native promoter (second allele). | This study |
| ece1Δ+pENO1-ECE1 | M2725 | caSAT1-pENO1-ECE1/ece1::ARG4 | Only transcribing ECE1 from constitutive promoter, but in original ECE1 locus. Second allele is disrupted. | This study |
ECs, epithelial cells; HAGs, hypha-specific genes.
Figure 1. C. albicans mutants showing reduced oral epithelial damage do not necessarily correlate with reduced ECE1 transcription rates.
A) Damage was assessed 24 h post infection of TR146 oral epithelial cells. Data are presented as % damage relative to the BWP17/CIp30 isogenic wild type (dotted line, fold damage vs vehicle control = 5.8×) + standard deviation (n≥3 biological replicates). Statistical significance was calculated using a one-way ANOVA post hoc Dunnett’s multiple comparisons test (vs BWP17/CIp30) on log-transformed data. Colors indicate differences vs BWP17/CIp30 isogenic wild type: green – no difference (<20%); light green – mild difference (20–40%); yellow – intermediate difference (40–60%); orange – high difference (60–80%); red – very high difference (>80%). B) ECE1 transcription was recorded after 3 h growth in hypha-inducing medium. ECE1 gene transcript levels are normalized to the ACT1 housekeeping gene (ΔCt). The control condition is the yeast morphology of the isogenic wild type BWP17/CIp30 (ΔΔCt). Data are presented as −ΔΔCt + standard deviation (n≥3 biological replicates). Statistical significance was calculated using a one-way ANOVA post hoc Dunnett’s multiple comparisons test (vs BWP17/CIp30). Colors indicate differences vs BWP17/CIp30 isogenic wild type (ΔΔΔCt): green – no difference (ΔΔΔCt≤1); light green – mild difference (1<ΔΔΔCt≤2); yellow – intermediate difference (2<ΔΔΔCt≤4); orange – high difference (4<ΔΔΔCt≤7); red – very high difference (ΔΔΔCt>7). The dotted line represents the BWP17/CIp30 isogenic wild type levels of ECE1 transcription (−ΔΔCt ≈ 10). *, p≤0.05; ****, p≤0.0001; no stars, not significant.
2.2. High ECE1 transcription rates are necessary but not sufficient to predict damage
Hypha formation is strongly linked to the transcription of ECE1 (Martin et al., 2013). Therefore, the inability of yeast-locked mutants (such as cph1ΔΔ/efg1ΔΔ) to cause full epithelial damage may be solely linked to the silenced transcription of ECE1. We thus quantified ECE1 transcription (in the absence of epithelial cells but in strong hyphae-inducing conditions) in the selected mutants (Figure 1B). Almost all mutants with strongly reduced damage potential also showed no or severely/highly impaired ECE1 transcription (cph1ΔΔ/efg1ΔΔ, eed1ΔΔ, kex2ΔΔ and ece1ΔΔ). Thus, strongly reduced ECE1 transcription levels strongly correlate with reduced damage potential. Notably, other mutants with a strong/intermediate reduction in their damage capacity (hgc1ΔΔ, bud2ΔΔ, als3ΔΔ, kex1ΔΔ) had ECE1 transcript levels similar to the isogenic wild type, or only mildly reduced.
2.3. Reduced adhesion, invasion, and hypha length are confirmed phenotypes predictive for reduced damage potential
We next investigated which virulence parameters were required to facilitate candidalysin-induced epithelial damage by quantifying the ability of each mutant to adhere, invade, and produce hyphae (Figure 2). Only the two mutants lacking the transcription factors Cph1/Efg1 or the adhesin Als3 showed adhesion defects (Figure 2A). The same mutants also showed significantly reduced invasion potential, in line with (Wachtler et al., 2011), where adhesion was shown to be a prerequisite for invasion. All other mutants invaded at similar rates, or only mildly reduced compared with the wild type (Figure 2B), confirming that invasion per se does not necessarily cause epithelial damage (Moyes et al., 2016). We thus hypothesized that hypha extension, hyphal length, and delivery of candidalysin are all essential attributes required for invasive hyphae to cause damage. As expected, a significant reduction in the ability to produce full length hyphae, at 3 h p.i. (relative to wild type cells), was observed for mutants lacking Cph1/Efg1, Hgc1, or Kex2 (Figure 2C). The mutant lacking Eed1 showed a mild reduction in hyphal length. In fact, this mutant is known to switch to yeast growth after approximately three hours (Zakikhany et al., 2007).
Figure 2. Reduced adhesion, invasion, and hypha length are predictive of reduced damage potential.
Data presented as % relative to the BWP17/CIp30 isogenic wild type (dotted line) + standard deviation (n≥3 biological replicates). A) Adhesion at 1 h post infection (p.i.), recorded as % adherent cells compared to initial inoculum (mean adhesion of the BWP17/CIp30 isogenic wild type = 35.6%). B) Invasion at 3 h p.i., recorded as % of hyphae that invaded into the TR146 OECs, (mean invasion of the BWP17/CIp30 isogenic wild type = 34.6%). C) Hypha length at 3 h p.i., (mean hypha length of BWP17/CIp30 isogenic wild type = 30.2μm). Statistical significance was calculated using a one-way ANOVA post hoc Dunnett’s multiple comparisons test (vs BWP17/CIp30) on log-transformed data. **, p≤0.01; ***, p≤0.001; ****, p≤0.0001; no stars, not significant. Colors indicate differences vs BWP17/CIp30 isogenic wild type: green – no difference (<20%); light green – mild difference (20–40%); yellow – intermediate difference (40–60%); orange – high difference (60–80%); red – very high difference (>80%).
These data suggest that the ability to produce full length hyphae in combination with high ECE1 transcription is critical for the full potential to damage epithelial cells. This explains why the hgc1ΔΔ mutant can cause intermediate epithelial damage despite not producing full length hyphae, as it also transcribes ECE1 at levels similar to the isogenic wild type.
2.4. Constitutive transcription of ECE1 in a yeast-locked mutant does not rescue its damaging phenotype
Given that hgc1ΔΔ caused an intermediate level of epithelial damage despite expressing ECE1 at high levels, we next determined whether filamentation and ECE1 transcription are linked to enable epithelial cell damage. To achieve this, we generated a yeast-locked strain that constitutively transcribes ECE1: cph1ΔΔ/efg1ΔΔ+pENO1-ECE1 (Westman et al., 2018). Hypha-producing control strains were transformed with the same construct, obtaining BWP17/CIp30+pENO1-ECE1 (contains 1 copy of ECE1 driven by its original promoter, and 1 copy driven by the enolase promoter) and ece1Δ+pENO1-ECE1 (contains only 1 copy of ECE1 driven by the enolase promoter). As shown in Figure 1A, both BWP17/CIp30+pENO1-ECE1 and ece1Δ+pENO1-ECE1 were able to damage at levels similar to the isogenic wild type. However, the cph1ΔΔ/efg1ΔΔ+pENO1-ECE1 mutant was unable to cause damage. RT-qPCR analysis showed that the enolase promoter was able to induce transcription of ECE1 mRNA to levels only mildly reduced compared to the isogenic wild type (Figure 1B) in both cph1ΔΔ/efg1ΔΔ+pENO1-ECE1 and ece1Δ+pENO1-ECE1. BWP17/CIp30+pENO1-ECE1 showed ECE1 transcript levels similar to the BWP17/CIp30 isogenic wild type. Since the forced expression of ECE1 in the yeast-locked strain cph1ΔΔ/efg1ΔΔ was insufficient to enable this mutant to induce damage but it sufficient to enable damage in the hypha-producing strain ece1Δ+pENO1-ECE1, we conclude that filamentation in combination with ECE1 expression is required for inducing damage.
2.5. Secretion of candidalysin does not always predict damage
Next, we considered the importance of candidalysin secretion, as producing high levels of ECE1 transcripts does not necessarily mean that the transcripts are efficiently translated, or that the translated toxin is properly secreted. To test this, mutant strains were cultured in strong hypha-inducing conditions and their supernatants analyzed by LC-MS/MS. Detailed results are available in Supplementary Table S1, and a summary of the results is shown in Table 3. Candidalysin secretion was measured as “Peptide Spectrum Matches” (PSMs), which allows semi-quantitative analysis of peptide abundances. Candidalysin was not secreted by cph1ΔΔ/efg1ΔΔ, kex2ΔΔ or ece1ΔΔ and was negligible/low in eed1ΔΔ, bud2ΔΔ, and kex1ΔΔ. Of these, only bud2ΔΔ and kex1ΔΔ expressed moderate levels of ECE1 transcripts (Figure 1B). For kex1ΔΔ, it is known that the toxin’s precursor is produced, and the low levels of candidalysin in the supernatant are due to the fact that the precursor is not processed into the final toxin (Richardson et al., 2018). Mutant bud2ΔΔ probably either poorly translates ECE1 transcripts or is impaired in efficient Ece1 processing or candidalysin secretion. The reduced secretion of candidalysin explains why bud2ΔΔ induces moderate levels of damage.
Table 3.
LC-MS/MS analysis of secreted candidalysin and its precursor.
| Strain name | PSMs for candidalysina | PSMs for Ece1-III |
|---|---|---|
| BWP17/CIp30 | 633 | 16 |
| cph1ΔΔ/efg1ΔΔ | 0 | 0 |
| hgc1ΔΔ | 71 | 0 |
| eed1ΔΔ | 1 | 0 |
| bud2ΔΔ | 11 | 0 |
| als3ΔΔ | 238 | 1 |
| kex2ΔΔ | 0 | 0 |
| kex1ΔΔ | 14 | 65 |
| ece1ΔΔ | 0 | 0 |
| cph1ΔΔ/efg1ΔΔ+pENO1-ECE1 | 637 | 0 |
| BWP17/CIp30+pENO1-ECE1 | 405 | 0 |
| ece1Δ+pENO1-ECE1 | 61 | 0 |
PSM = Peptide Spectrum Match.
PSMs are normalized to 100 ml hyphal supernatant; shown is the average of PSMs obtained in two independent sample preparations and subsequent LC-MS/MS runs. Full details of LC-MS/MS datasets are provided in Supplementary Table S1.
All mutants with reduced PSM counts for candidalysin were also severely impaired in their ability to damage epithelial cells. Only als3ΔΔ secreted sufficient levels of candidalysin; however, since this mutant cannot efficiently adhere or invade epithelial cells, candidalysin is not delivered to the invasion pocket and hence als3ΔΔ does not damage. This further supports the view that efficient adhesion and invasion are pre-requisites to enable full damage-inducing capacity of C. albicans. This was further confirmed with the yeast-locked mutant cph1ΔΔ/efg1ΔΔ+pENO1-ECE1, which expressed substantial amounts of ECE1 transcripts (Figure 1B) but was unable to adhere, invade (Figure 2) or damage epithelial cells (Figure 1A).
2.6. Secreted candidalysin localizes and accumulates in the invasion pocket
Our data suggest that while candidalysin is the fungal factor that induces damage, the toxin must be secreted by hyphae in the invasion pocket to optimize damage induced by C. albicans. The secretion of candidalysin (or any protein or peptide) is expected to primarily occur at the tip of the invading hypha (Crampin et al., 2005, Brand et al., 2008, Jones et al., 2010). To visualize candidalysin in situ, we generated Llama-derived (camelid) anti-candidalysin nanobodies. After phage-display selection, two VHH clones with binding affinity towards synthetic candidalysin were isolated, named CAL1-F1 and CAL1-H1. Clone CAL1-F1 gave brighter signals in immunofluorescence infection experiments and was used to visualize candidalysin during epithelial infection by C. albicans. Indirect immunofluorescence demonstrated that candidalysin localizes and accumulates at the invasion site and throughout the invasion pocket (Figure 3A), confirming that candidalysin is delivered to the invasion pocket.
Figure 3. Secreted candidalysin localizes and accumulates in the invasion pocket.

Candidalysin is stained after infection (4 h) of TR146 oral epithelial cells. After fixation, extracellular, non-invasive fungal components were stained with Concanavalin A-AlexaFluor 647 (magenta), permeabilized, and candidalysin was then stained with the anti-candidalysin VHH CAL-F1 (green). A) Detail about C. albicans BWP17/CIp30 isogenic wild type; B) Quantification of candidalysin positive/negative staining around invasive/non-invasive hyphae; C) Representative micrographs of the selected C. albicans mutants. Scale bar = 10 μm.
We next investigated candidalysin localization with the panel of mutants and quantified the percentage of invasive/non-invasive hyphae that showed positive/negative candidalysin staining. For the wild type BWP17/CIp30, the majority of invasive hyphae were candidalysin-positive, and the majority of non-invasive hyphae were candidalysin-negative (Figure 3B). This holds true for most mutants that invaded to any extent, except ece1ΔΔ, which does not produce candidalysin, kex1ΔΔ, and the ece1Δ+pENO1-ECE1. Figure 3C shows a representative micrograph for each mutant stained with CAL1-F1. A visual evaluation of candidalysin fluorescence allowed us to arbitrarily assign the mutants into five categories: “+++” (wild type BWP17/CIp30 and BWP17/CIp30+pENO1-ECE1); “++” (als3ΔΔ and kex1ΔΔ); “+” (hgc1ΔΔ and bud2ΔΔ); “+/−” (eed1ΔΔ and ece1Δ+pENO1-ECE1); and “−” (cph1ΔΔ/efg1ΔΔ, kex2ΔΔ, ece1ΔΔ, and cph1ΔΔ/efg1ΔΔ+pENO1-ECE1). When comparing the damage data (Figure 1A) with subjective immunofluorescence intensity evaluation from Figure 3C, there is a correlation between the intensity of the candidalysin fluorescence signal around the hypha and damage induction. One exception is mutant kex1ΔΔ, which does not secrete candidalysin but does secrete the precursor (Ece1-III, only differing from candidalysin by the additional Arg residue at the C terminus (Moyes et al., 2016, Richardson et al., 2018)). This indicates that, not surprisingly, the anti-candidalysin nanobody also recognizes Ece1-III. Another exception is als3ΔΔ, which is defective in adhesion and invasion compared with the wild type, but when this mutant does manage to invade, it secretes and accumulates reasonable amounts of candidalysin in the invasion pocket. Also, the ece1Δ+pENO1-ECE1 mutant induces levels of damage comparable to the wild type at 24 h (Figure 1A), but far less extracellular candidalysin can be detected at 4 h (Figure 3B, C). Possibly, the kinetics of translation of ECE1 transcripts produced by the enolase promotor are slower than the native ECE1 promotor, hence extracellular candidalysin levels accumulate at a slower rate in the invasion pocket.
In conclusion, epithelial damage during C. albicans infection is the result of a combination of virulence attributes that work in concert to deliver candidalysin to the invasion pocket (Table 4).
Table 4.
Visual summary of phenotypes.
| Strain (mutant) name | Damage | ECE1 transcription | Adhesion | Invasion | Hypha length | CaL secretion | CaL visual quantification from stainings |
|---|---|---|---|---|---|---|---|
| BWP17/CIp30 | |||||||
| cph1ΔΔ/efg1ΔΔ | |||||||
| hgc1ΔΔ | |||||||
| eed1ΔΔ | |||||||
| bud2ΔΔ | |||||||
| als3ΔΔ | |||||||
| kex2ΔΔ | |||||||
| kex1ΔΔ | |||||||
| ece1ΔΔ | |||||||
| cph1ΔΔ/efg1ΔΔ + pENO1-ECE1 | |||||||
| BWP17/CIp30 + pENO1-ECE1 | |||||||
| ece1Δ + pENO1-ECE1 | |||||||
| Color code for observed phenotypes: | |||||||
| Damage / Adhesion / Invasion / Hypha length (difference vs BWP17/CIp30 isogenic wild type) | no (<20%) | mild (20–40%) | intermediate (40–60%) | high (60–80%) | very high (>80%) | ||
| ECE1 transcription (difference vs BWP17/CIp30 isogenic wild type) | no (ΔΔΔCt≤1) | mild (1<ΔΔΔCt≤2) | intermediate (2<ΔΔΔCt≤4) | high (4<ΔΔΔCt≤7) | very high (ΔΔΔCt>7) | ||
| CaL secretion (PSMs) | very high (>200) | high (101–200) | medium (51–100) | low (21–50) | negligible (0–20) | ||
| CaL signal from stainings | very bright (+++) | bright (++) | visible, not so bright (+) | barely visible (+/−) | not visible (−) | ||
CaL = Candidalysin.
3. Discussion
Mucosal C. albicans infections are associated with several virulence attributes, are initiated by hypha formation and culminate in host cell damage induced by the peptide toxin candidalysin (Moyes et al., 2016), which subsequently activates protective innate immune responses (Naglik et al., 2017, Verma et al., 2017, Naglik et al., 2019). Hyphal invasion was long thought to be sufficient to cause damage, but the discovery of candidalysin made it possible to decouple hypha formation from damage (Wilson et al., 2016). Likewise, ECE1 transcription does not necessarily correlate with the ability of clinical C. albicans strains to induce epithelial damage (Schonherr et al., 2017). Interestingly, while synthetic candidalysin can damage host cells by direct application, its damage potential does not reach the level of damage induced by invading wild type C. albicans (Allert et al., 2018). Also, the damage induced by synthetic, exogenously added candidalysin is higher in the presence of an ece1ΔΔ mutant than in its absence (Allert et al., 2018), indicating that fungal hyphae facilitate candidalysin toxicity. This led us to hypothesize that several virulence attributes work in concert to facilitate C. albicans-induced damage through candidalysin activity. Utilizing a panel of C. albicans mutants and a camelid VHH (nanobody) specific for candidalysin, this study demonstrates that candidalysin needs to be delivered to the invasion pocket by filamenting cells to enable the full damage potential of C. albicans during mucosal infection.
C. albicans infection of epithelial cells requires multiple steps, including hypha formation, adhesion, induced endocytosis, hyphal growth into an invasion pocket, and candidalysin secretion (Mayer et al., 2013, Moyes et al., 2016). However, it was unclear whether hyphae are required to deliver candidalysin and whether the toxin mediated damage from the epithelial surface or from within the invasion pocket. Therefore, the contribution of each virulence attribute was assessed for its importance to enable C. albicans to induce epithelial damage via candidalysin activity. As expected, a yeast-locked C. albicans mutant (cph1ΔΔ/efg1ΔΔ) was unable to adhere, invade, express ECE1 or secrete candidalysin, and was thus unable to damage epithelial cells. To demonstrate that the absence of damage was not due to the lack of ECE1 expression, we generated cph1ΔΔ/efg1ΔΔ+pENO1-ECE1, where ECE1 is expressed under the control of the constitutive ENO1 (encoding enolase 1) promotor. This yeast-locked strain expressed substantial levels of ECE1 transcripts, but was unable to cause epithelial damage. This provided strong evidence that damage induction requires candidalysin to be delivered by hyphae. This is supported by the phenotypes of the hgc1ΔΔ and eed1ΔΔ mutants. Mutant hgc1ΔΔ forms short germ tubes but can nevertheless adhere, invade, and express moderate levels of ECE1 transcripts, but notably is unable to secrete high amounts of candidalysin and hence induces limited damage. Mutant eed1ΔΔ initially produces normal hyphae and thus adheres to and invades normally (Zakikhany et al., 2007). However, after ≈3 h eed1Δ reverts to yeast phase growth, shutting down the transcription of HAGs (Polke et al., 2017), including ECE1, and candidalysin secretion, and is unable to induce damage. This confirms not only that candidalysin needs to be delivered by hyphae but also transient ECE1 transcription is not sufficient to cause damage, additionally suggesting that hyphal maintenance is critical for sustained damage during infection. This could also explain why some clinical C. albicans strains poorly induce epithelial damage, as they are impaired in hypha formation (Schonherr et al., 2017).
Given that candidalysin delivery by hyphae appears critical for damage, we investigated the role of hyphal adhesion and invasion (pocket formation) in enabling candidalysin-induced damage by assessing the als3ΔΔ mutant. In agreement with previous studies, mutant als3ΔΔ produces normal hyphae and strongly expresses ECE1 (Cleary et al., 2011), but very poorly adheres to and invades into epithelial cells. Notably, als3ΔΔ is also very poor at inducing epithelial damage, indicating that hyphae need to adhere and subsequently invade epithelial cells to enable candidalysin’s cytolytic effects on host membranes. The data support our previous studies (Wachtler et al., 2011, Murciano et al., 2012) and indicate that candidalysin needs to be delivered to the invasion pocket in order to accumulate at sufficient concentrations to induce epithelial cell damage. Furthermore, our data are supported by a recent study showing that Als3 promotes the targeting of candidalysin to host cells by inducing the formation of an endocytic vacuole (the “invasion pocket”) in which candidalysin accumulates (Swidergall et al., 2021).
Once the invasion pocket is formed, hyphae need to grow into the pocket via a process that may be linked to thigmotropism (contact sensing). To assess the importance of thigmotropism in candidalysin-induced epithelial damage we used bud2ΔΔ, which is required for directional growth of hyphae (Brand et al., 2008). Notably, we found that bud2ΔΔ had no defect in hypha formation, adhesion, or invasion of epithelial cells, indicating that thigmotropism may not be critical for hyphal growth into the pocket. However, while bud2ΔΔ expressed only mildly reduced levels of ECE1 transcripts, it secreted candidalysin in very low amounts and thus was impaired in inducing damage. The reduced candidalysin secretion may derive from bud2ΔΔ also having suspected defects in the secretory pathway (Brand et al., 2008) and may, as a consequence, not efficiently transport candidalysin to the hyphal tip for delivery/secretion. Therefore, the intermediate damage induced by bud2ΔΔ may be due to impaired candidalysin secretion.
The data demonstrate that hyphae need to deliver candidalysin into the invasion pocket to induce epithelial damage. However, candidalysin delivery and secretion first requires the parent protein Ece1 to be sequentially processed by the Golgi-located serine proteases Kex2 and Kex1 (Moyes et al., 2016, Richardson et al., 2018). Kex2 is critical for processing several C. albicans proteins in addition to Ece1 (Bader et al., 2008) and, therefore, kex2ΔΔ has a general fitness defect that manifests in lack of hypha formation (Newport et al., 1997), ECE1 expression, and candidalysin secretion, thus explaining its defective damage phenotype. After Kex2 generates peptides terminating in Lys-Arg amino acid residues, Kex1 removes the terminal Arg to form fully matured candidalysin terminating in Lys. The mature candidalysin is then thought to be packaged and transported to the hyphal tip for secretion. We found that, while kex1ΔΔ exhibits normal adhesion, invasion, and hyphal phenotypes, and expresses only mildly reduced levels of ECE1 transcripts, it poorly secretes candidalysin and hence induces low levels of damage. On the other hand, kex1ΔΔ produces substantial amounts of the candidalysin precursor terminating in Lys-Arg, as detected by LC-MS/MS (Table 3 and Supplementary Table S1) and by the α-candidalysin nanobody, which is as damaging as candidalysin (Moyes et al., 2016). Given that Kex1 is probably also involved in the processing of numerous other hitherto unknown and unrelated proteins (with possible roles in virulence), kex1ΔΔ likely has other defects in packing fungal peptides to the secretory pathway and may not efficiently transport the candidalysin precursor to the hyphal tip for secretion and delivery. These data indicate that correct Ece1 processing and packaging/transport of candidalysin to the hyphal tip for secretion is essential for induction of epithelial damage.
To confirm our supposition that candidalysin needs to be secreted into the invasion pocket to induce damage, we generated novel anti-candidalysin camelid VHHs (nanobodies) to detect candidalysin in situ. Indirect immunofluorescence demonstrated that candidalysin is secreted at the hyphal tip at the point of epithelial entry and subsequently throughout the invasion pocket as the hypha extends into it. The strength of immunofluorescence in situ directly correlated with the amount of candidalysin secreted in vitro by the C. albicans mutant strains. Together, the data demonstrate that during C. albicans mucosal infection, a combination of virulence attributes work in concert to deliver candidalysin to the invasion pocket via the hyphal tip. Sustained hypha formation and extension permit candidalysin to accumulate at concentrations sufficient to induce host cell damage and subsequent immunopathology. This is in agreement with the concept of “The cards of virulence, where each virulence factor is considered a card that contributes to the overall virulence phenotype” of a pathogenic microbe (Casadevall, 2006). Even a strong card like candidalysin alone is not sufficient for full virulence and to win the game – from the perspective of a pathogen.
4. Experimental procedures
4.1. Fungal strains and culture conditions
C. albicans strains used in this study are described in Table 1. Strains were cultured in YPD medium [1% (w/v) yeast extract, 2% (w/v) peptone, 2% (w/v) dextrose, with 1.5% (w/v) agar for solid medium] at 30°C, shaking at 180 rpm for liquid cultures. Hyphal growth was induced in RPMI 1640 medium (Life Technologies) for 3 h at 37°C and 5% CO2. Cells from overnight cultures were washed twice with phosphate-buffered saline (PBS), and the concentration of cells was adjusted as indicated in each experiment.
4.2. Construction of pENO1-ECE1 mutants
Similar to (Westman et al., 2018), pENO1-ECE1 strains transcribing ECE1 under the control of the C. albicans enolase promoter (pENO1) were generated from the parent strains BWP17/CIp30 (contains 2 copies of ECE1 at their original positions) and ece1Δ (heterozygous ece1 knockout strain, contains only 1 copy of ECE1 at its original position). A cassette containing the Candida-adapted NAT1 (CaNAT1) marker and pENO1 was amplified from pNAT-ENO1 using primers ECE1_ENO1_PF (containing 80 nts of ECE1 gene-specific sequence starting from the start codon) and ECE1_ENO1_PR (containing 80 nts homologous to the ECE1 5’ promoter region, starting 692 nts before the start codon, Table 2). The PCR product was then integrated before the ECE1 gene. Integration was confirmed with primers ENO1p-S (ENO1-specific) and ECE1-IR (internal to the ECE1 gene, Table 2). A PCR product of ≈450 bp indicated a positive transformant.
Table 2.
Primers used in this study.
| Primer Name | Sequence (5’-3’) |
|---|---|
| ACT1-F | tcagaccagctgatttaggtttg |
| ACT1-R | gtgaacaatggatggaccag |
| ECE1-F | atcgaaaatgccaagagag |
| ECE1-R | agcattttcaataccgacag |
| ECE1_ENO1_PR | aattctggagcatggtggatgatggcagcttgagaagataaagcaaaaacagtagcacaggcaattttggagaatttcattgttgtaatattcctgaattatc |
| ECE1_ENO1_PF | agcgaagtaagacatattacaaaaatttccagccactattttgtacctgtaactttcaaaaatgattacactttttgactcgttagtatcgaatcgacagc |
| ENO1p-S | ttgataattcaggaatattacaac |
| ECE1-IR | gtagaagcaacagaagtcatg |
4.3. Mammalian cell culture
The human oral epithelial cell (OEC) line TR146 was chosen to evaluate the damage potential of the selected C. albicans mutants, since it is a versatile cell line often used for damage screening purposes (Moyes et al., 2016). TR146 OECs were purchased from the European Collection of Authenticated Cell Cultures (Rupniak et al., 1985) and used throughout the study. Cells were cultured at 37°C and 5% CO2 in Dulbecco’s modified Eagle medium (DMEM)–F12 medium (Life Technologies) supplemented with 10% (v/v) heat-inactivated (10 min at 56°C) fetal bovine serum (Life Technologies).
4.4. Adhesion, invasion, and hyphal length assay
Adhesion, invasion, and hyphal length assays were performed similar to (Allert et al., 2018). C. albicans cells were added to confluent TR146 OECs in 24-well plates to a final concentration of 1×105 cells/well. Adhesion of C. albicans to OECs was determined 1 h post infection (p.i.). Non-attached C. albicans cells were removed by washing 3× with PBS. Samples were fixed with Histofix (Roth) for 15 min at room temperature (RT) or overnight at 4°C and rinsed 3× with PBS. Adherent fungi were stained with Calcofluor white [10 μg/ml in 0.1 M Tris-HCl (pH 9); Sigma-Aldrich] for 20 min at RT in the dark. Samples were then washed 3× with water, mounted on glass slides with ProLong Gold antifade mountant (ThermoFisher Scientific), and analyzed by fluorescence microscopy. Pictures of each sample were taken until a total of at least 50 adherent C. albicans cells were counted. The total number of adherent cells on the entire coverslip was calculated based on the average of Candida cells counted in each picture within a defined area. This number was expressed as a percentage of adhered cells versus inoculated C. albicans cells. Invasion of C. albicans into TR146 cells was analyzed by differential staining. After 3 h of C. albicans infection, TR146 cells were washed 3× with PBS and fixed with Histofix. Extracellular, non-invasive fungal components were stained with Concanavalin A-AlexaFluor 647 (ThermoFisher Scientific) for 45 min, in the dark, on an orbital shaker (70 rpm). OECs were rinsed 3× with PBS, permeabilized with 0.5% Triton X-100 for 10 min at RT and washed again 3× with PBS. C. albicans cells were then stained with Calcofluor white. After mounting, samples were visualized by fluorescence microscopy. The percentage of invasive C. albicans hyphae (only calcofluor white-stained) was counted from at least 50 hyphae per strain in at least three independent experiments. The hyphae lengths were also recorded, using the Zeiss proprietary ZEN 3 software.
4.5. Anti-candidalysin Llama VHHs (nanobodies)
Anti-Candidalysin Llama VHHs (i.e. variable domains of the heavy chain of the heavy-chain antibody, also termed nanobodies) were produced by QVQ B.V. (Utrecht, The Netherlands) using phage-display technology (Verheesen et al., 2012, Kuhn et al., 2016). For this purpose, two llamas were immunized with heat- or formaldehyde-inactivated C. albicans SC5314 yeast, germ tube and hypha cells, followed by VHH library construction in the phagemid vector pUR8100 for transformation into E. coli TG1. Phage-display selections were conducted on synthetic FLAG-tagged candidalysin peptides immobilized by affinity capture with an anti-FLAG M2 antibody (Sigma-Aldrich). After two sequential rounds of biopanning phage-display selection, 2 independent clones were identified by ELISA screening on affinity captured candidalysin. VHH clones CAL1-F1 and CAL1-H1 exhibited high apparent affinity towards synthetic candidalysin or its recombinant parent protein rEce1 in ELISAs.
4.6. Immunofluorescence staining for visualization of candidalysin
TR146 OECs grown to confluency in a 24-well plate were infected for 4 h with C. albicans strains (initial inoculum 1×105/well). TR146 cells were washed 3× with PBS and fixed with Histofix. Extracellular, non-invasive fungal components were stained with Concanavalin A-AlexaFluor 647 (ThermoFisher Scientific) for 20 min, in the dark, on an orbital shaker (70 rpm). After the OECs were rinsed 1× with PBS, they were permeabilized with 0.1% saponin in PBS (0.1% PBSS) for 5 min at RT and washed again 1× with PBS. Samples were then blocked with 1% BSA in 0.05% PBSS for 1 h at RT, shaking at 70 rpm and washed again 1× with PBS. Candidalysin was stained with a primary, a secondary, and a tertiary antibody. All antibodies were diluted in 0.5% BSA in 0.05% PBSS, and all incubations with antibodies were performed at RT for 1 h, with shaking at 70 rpms, followed by 1× wash with PBS. The primary antibody used was the anti-candidalysin VHH CAL1-F1, at 1 μM concentration. The secondary antibody was a polyclonal rabbit-α-VHH IgG (1 mg/ml, QVQ B.V., 1:50). The tertiary antibody was a goat-α-rabbit IgG coupled with AlexaFluor 488 (Cat. no. A32731, 2 mg/ml, ThermoFisher, 1:400). Samples were then mounted with ProLong Gold antifade mountant (ThermoFisher Scientific) and visualized by fluorescence microscopy.
4.7. Quantification of candidalysin staining
The same samples prepared for visualization of candidalysin were used to qualitatively record the percentage of hyphae with any candidalysin staining, and whether these were invasive or non-invasive. At least 100 hyphae per strain were counted, in three independent experiments, except for the less adhesive mutants, where 100 cells were not always found in the same sample.
4.8. Damage assay
Damage of TR146 OECs was determined by quantification of lactate dehydrogenase activity in the supernatant using a Cytotoxicity Detection Kit (Roche) according to the manufacturer’s instructions. Results are presented as % damage relative to the BWP17/CIp30 isogenic wild type, after subtraction of the vehicle only.
4.9. Fungal RNA extraction
C. albicans strains were adjusted to 1×107 cells/ml in 25 ml RPMI 1640 (hypha-inducing) or 5 ml YPD (yeast-maintaining). For hyphae samples, fungal suspensions were distributed in 150 cm2 petri dishes and incubated at 37°C and 5% CO2 for 3 h. After incubation, medium and non-adherent Candida cells were discarded. Adherent Candida cells were rinsed once with ice-cold PBS, loosened with a cell scraper, and collected. For yeast samples, fungal suspensions were cultured at 30°C for 3 h in a shaking incubator (180 rpm). After incubation, cells were collected by centrifugation (4,000 × g for 2 min at 4°C) and resuspended in 10 ml ice-cold PBS. Hyphae and yeast samples were washed again with 1 ml ice-cold PBS and centrifuged (20,000 × g, 2 min, 4°C), the supernatant was discarded, and cell pellets were frozen in liquid nitrogen. Frozen Candida pellets were thawed in 600 μl RLT buffer (Qiagen) containing 1% β-mercaptoethanol, mixed with 300 μl acid-washed glass beads (0.5 mm Ø), and run through a Precellys homogenizer (Bertin instruments) twice at 5,500 beats/min for 15 sec, with 20 sec pause in between. Lysates were centrifuged for 2 min at 20,000 × g, 4°C, the supernatant was mixed with an equal volume of 70% ethanol (prepared in diethyl pyrocarbonate [DEPC]-treated water), and total RNA was isolated using the RNeasy minikit (Qiagen) according to the manufacturer’s instructions. RNA integrity and concentration were confirmed using a Bioanalyzer (Agilent).
4.10. ECE1 transcription analysis
RNA (500 ng) was treated with DNase (Epicentre), confirmed DNA free, and cDNA was synthesized using Superscript III reverse transcriptase (Invitrogen) according to the manufacturer’s protocol. cDNA samples were used for qPCR with EvaGreen mix (Bio&Sell). Primers [ACT1-F and ACT1-R for ACT1 and ECE1-F and ECE1-R for ECE1 (Table 2)] were used at a final concentration of 500 nM. qPCR amplifications were performed using a CFX96 thermocycler (Bio-Rad). ECE1 transcription was calculated using the threshold cycle (ΔΔCt) method, with ACT1 as the reference gene and C. albicans isogenic wild type strain (yeast morphology) as the control sample. Data are presented as % relative to the BWP17/CIp30 isogenic wild type strain.
4.11. Candidalysin detection in hyphal supernatants by LC-MS/MS analysis
Analysis of hypha-secreted Ece1 peptides was optimized for the detection of candidalysin and performed as previously described (Moyes et al., 2016). The method is aims at the detection of peptides with highly hydrophobic moieties such as candidalysin. Briefly, C. albicans strains were cultured for 18 h under strong hypha-inducing conditions [yeast nitrogen base (YNB) medium containing 2% sucrose, 75 mM MOPSO (3-(N-morpholino)-2-hydroxypropanesulfonic acid) buffer, pH 7.2, 5 mM N-acetyl-D-glucosamine, 37°C]. Secreted peptides were enriched from culture supernatants by solid-phase extraction (SPE) using a silica-based n-butyl C4 sorbent, dried in a vacuum concentrator, dissolved in 0.2% formic acid in 71:27:2 (v/v/v) acetonitrile (ACN)-H2O-dimethyl sulfoxide (DMSO), and passed through a 10-kDa-molecular-mass cutoff filter in order to remove intact proteins. LC-MS/MS analysis was carried out on an Ultimate 3000 nano-LC coupled to a Q Exactive Plus mass spectrometer (Thermo). Peptide separation was performed on an Accucore C4 column (75 μm I.D. × 150 mm, 2.6 μm) with eluents (A) 0.2% HCOOH in 95:5 H2O-DMSO and (B) 0.2% HCOOH in 85:10:5 ACN-H2O-DMSO using the following gradient: 0–1.5 min at 60% B, 35–45 min at 96% B, and 45.1–60 min at 60% B. The top 10 precursor ions (full scan at m/z 300–1,600, R=70k [full width at half maximum, FWHM]) per scan cycle underwent HCD (high energy collisional dissociation) fragmentation at 30% normalized collision energy. Resulting MS2 spectra were monitored at R=17.5k (FWHM). Proteome Discoverer 2.4 (Thermo) and the Sequest HT algorithm were used to search against the protein database of C. albicans SC5314 (http://www.candidagenome.org). Mass spectra were searched for both unspecific cleavages (no enzyme) and tryptic peptides up to 4 missed cleavages. Precursor and fragment mass tolerances were 10 ppm and 0.02 Da, respectively. At least 2 unique peptides per protein, a false discovery rate of <1%, and cross-correlation (Xcorr) validation (from 2.0 at z=2 up to 3.0 at z=6) were required for identification.
Supplementary Material
Take Aways.
Candidalysin is a peptide toxin secreted by C. albicans causing epithelial damage.
Candidalysin delivery to host cell membranes requires specific fungal attributes.
Candidalysin accumulates in invasion pockets created by invasive hyphae.
Camelid nanobodies enabled visualization of candidalysin in the invasion pocket.
Acknowledgements
This work was supported by the European Union Horizon 2020 research and innovation program under the Marie Skłodowska Curie grant agreement No 642095 (OPATHY) to FS, ED and BH. BH, TK and OK further received support from the Deutsche Forschungsgemeinschaft (DFG, German Research Foundation) within the Collaborative Research Centre (CRC)/Transregio 124 FungiNet (project number 210879364, Projects C1 and Z2) and BH within the Cluster of Excellence “Balance of the Microverse”, funded by the DFG under Germany’s Excellence Strategy – EXC 2051 – Project-ID 390713860. J.R.N was supported by grants from the Wellcome Trust (214229_Z_18_Z), National Institutes of Health (R37-DE022550), and the NIH Research at Guys and St. Thomas’s NHS Foundation Trust and the King’s College London Biomedical Research Centre (IS-BRC-1215-20006).
Footnotes
Conflict of interest statement
The authors have no conflict of interest to declare.
Data availability statement
The data that support the findings of this study are available from the corresponding author upon reasonable request.
References
- Allert S, Forster TM, Svensson CM, Richardson JP, Pawlik T, Hebecker B, et al. (2018). Candida albicans-induced epithelial damage mediates translocation through intestinal barriers. mBio 9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bader O, Krauke Y and Hube B (2008). Processing of predicted substrates of fungal Kex2 proteinases from Candida albicans, C. glabrata, Saccharomyces cerevisiae and Pichia pastoris. BMC Microbiol 8, 116. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Birse CE, Irwin MY, Fonzi WA and Sypherd PS (1993). Cloning and characterization of ECE1, a gene expressed in association with cell elongation of the dimorphic pathogen Candida albicans. Infect Immun 61, 3648–3655. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Brand A, Shanks S, Duncan VM, Yang M, Mackenzie K and Gow NA (2007). Hyphal orientation of Candida albicans is regulated by a calcium-dependent mechanism. Curr Biol 17, 347–352. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Brand A, Vacharaksa A, Bendel C, Norton J, Haynes P, Henry-Stanley M, et al. (2008). An internal polarity landmark is important for externally induced hyphal behaviors in Candida albicans. Eukaryot Cell 7, 712–720. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Brown GD, Denning DW, Gow NA, Levitz SM, Netea MG and White TC (2012). Hidden killers: human fungal infections. Sci Transl Med 4, 165rv113. [DOI] [PubMed] [Google Scholar]
- Brunke S, Mogavero S, Kasper L and Hube B (2016). Virulence factors in fungal pathogens of man. Curr Opin Microbiol 32, 89–95. [DOI] [PubMed] [Google Scholar]
- Casadevall A (2006). Cards of virulence and the global virulome for humans. Microbe Magazine. [Google Scholar]
- Cleary IA, Reinhard SM, Miller CL, Murdoch C, Thornhill MH, Lazzell AL, et al. (2011). Candida albicans adhesin Als3p is dispensable for virulence in the mouse model of disseminated candidiasis. Microbiology (Reading) 157, 1806–1815. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Crampin H, Finley K, Gerami-Nejad M, Court H, Gale C, Berman J and Sudbery P (2005). Candida albicans hyphae have a Spitzenkörper that is distinct from the polarisome found in yeast and pseudohyphae. J Cell Sci 118, 2935–2947. [DOI] [PubMed] [Google Scholar]
- Dalle F, Wachtler B, L’Ollivier C, Holland G, Bannert N, Wilson D, et al. (2010). Cellular interactions of Candida albicans with human oral epithelial cells and enterocytes. Cell Microbiol 12, 248–271. [DOI] [PubMed] [Google Scholar]
- Gow NA (1997). Germ tube growth of Candida albicans. Curr Top Med Mycol 8, 43–55. [PubMed] [Google Scholar]
- Hausauer DL, Gerami-Nejad M, Kistler-Anderson C and Gale CA (2005). Hyphal guidance and invasive growth in Candida albicans require the Ras-like GTPase Rsr1p and its GTPase-activating protein Bud2p. Eukaryot Cell 4, 1273–1286. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hoyer LL, Payne TL, Bell M, Myers AM and Scherer S (1998). Candida albicans ALS3 and insights into the nature of the ALS gene family. Curr Genet 33, 451–459. [DOI] [PubMed] [Google Scholar]
- Jacobsen ID, Wilson D, Wachtler B, Brunke S, Naglik JR and Hube B (2012). Candida albicans dimorphism as a therapeutic target. Expert Rev Anti Infect Ther 10, 85–93. [DOI] [PubMed] [Google Scholar]
- Jones LA and Sudbery PE (2010). Spitzenkörper, exocyst, and polarisome components in Candida albicans hyphae show different patterns of localization and have distinct dynamic properties. Eukaryot Cell 9, 1455–1465. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kornitzer D (2019). Regulation of Candida albicans hyphal morphogenesis by endogenous signals. J Fungi (Basel) 5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kuhn P, Fuhner V, Unkauf T, Moreira GM, Frenzel A, Miethe S and Hust M (2016). Recombinant antibodies for diagnostics and therapy against pathogens and toxins generated by phage display. Proteomics Clin Appl 10, 922–948. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lo HJ, Kohler JR, DiDomenico B, Loebenberg D, Cacciapuoti A and Fink GR (1997). Nonfilamentous C. albicans mutants are avirulent. Cell 90, 939–949. [DOI] [PubMed] [Google Scholar]
- Martin R, Albrecht-Eckardt D, Brunke S, Hube B, Hunniger K and Kurzai O (2013). A core filamentation response network in Candida albicans is restricted to eight genes. PLOS One 8, e58613. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Martin R, Moran GP, Jacobsen ID, Heyken A, Domey J, Sullivan DJ, et al. (2011). The Candida albicans-specific gene EED1 encodes a key regulator of hyphal extension. PLOS One 6, e18394. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mayer FL, Wilson D and Hube B (2013). Candida albicans pathogenicity mechanisms. Virulence 4, 119–128. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Moyes DL, Wilson D, Richardson JP, Mogavero S, Tang SX, Wernecke J, et al. (2016). Candidalysin is a fungal peptide toxin critical for mucosal infection. Nature 532, 64–68. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Murciano C, Moyes DL, Runglall M, Tobouti P, Islam A, Hoyer LL and Naglik JR (2012). Evaluation of the role of Candida albicans agglutinin-like sequence (Als) proteins in human oral epithelial cell interactions. PLOS One 7, e33362. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Naglik JR, Challacombe SJ and Hube B (2003). Candida albicans secreted aspartyl proteinases in virulence and pathogenesis. Microbiol Mol Biol Rev 67, 400–428, table of contents. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Naglik JR, Gaffen SL and Hube B (2019). Candidalysin: discovery and function in Candida albicans infections. Curr Opin Microbiol 52, 100–109. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Naglik JR, Konig A, Hube B and Gaffen SL (2017). Candida albicans-epithelial interactions and induction of mucosal innate immunity. Curr Opin Microbiol 40, 104–112. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Newport G and Agabian N (1997). KEX2 influences Candida albicans proteinase secretion and hyphal formation. J Biol Chem 272, 28954–28961. [DOI] [PubMed] [Google Scholar]
- Newport G, Kuo A, Flattery A, Gill C, Blake JJ, Kurtz MB, et al. (2003). Inactivation of Kex2p diminishes the virulence of Candida albicans. J Biol Chem 278, 1713–1720. [DOI] [PubMed] [Google Scholar]
- Nobile CJ, Andes DR, Nett JE, Smith FJ, Yue F, Phan QT, et al. (2006). Critical role of Bcr1-dependent adhesins in C. albicans biofilm formation in vitro and in vivo. PLOS Pathog 2, e63. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Phan QT, Belanger PH and Filler SG (2000). Role of hyphal formation in interactions of Candida albicans with endothelial cells. Infect Immun 68, 3485–3490. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Polke M, Sprenger M, Scherlach K, Alban-Proano MC, Martin R, Hertweck C, et al. (2017). A functional link between hyphal maintenance and quorum sensing in Candida albicans. Molecular microbiology 103, 595–617. [DOI] [PubMed] [Google Scholar]
- Ramage G, VandeWalle K, Lopez-Ribot JL and Wickes BL (2002). The filamentation pathway controlled by the Efg1 regulator protein is required for normal biofilm formation and development in Candida albicans. FEMS Microbiol Lett 214, 95–100. [DOI] [PubMed] [Google Scholar]
- Richardson JP, Mogavero S, Moyes DL, Blagojevic M, Kruger T, Verma AH, et al. (2018). Processing of Candida albicans Ece1p is critical for candidalysin maturation and fungal virulence. mBio 9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Richardson JP, Willems HME, Moyes DL, Shoaie S, Barker KS, Tan SL, et al. (2017). Candidalysin drives epithelial signaling, neutrophil recruitment, and immunopathology at the vaginal mucosa. Infect Immun. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rupniak HT, Rowlatt C, Lane EB, Steele JG, Trejdosiewicz LK, Laskiewicz B, et al. (1985). Characteristics of four new human cell lines derived from squamous cell carcinomas of the head and neck. J Natl Cancer Inst 75, 621–635. [PubMed] [Google Scholar]
- Schonherr FA, Sparber F, Kirchner FR, Guiducci E, Trautwein-Weidner K, Gladiator A, et al. (2017). The intraspecies diversity of C. albicans triggers qualitatively and temporally distinct host responses that determine the balance between commensalism and pathogenicity. Mucosal Immunol 10, 1335–1350. [DOI] [PubMed] [Google Scholar]
- Sudbery PE (2011). Growth of Candida albicans hyphae. Nat Rev Microbiol 9, 737–748. [DOI] [PubMed] [Google Scholar]
- Swidergall M, Solis NV, Millet N, Huang MY, Lin J, Phan QT, et al. (2021). Activation of EphA2-EGFR signaling in oral epithelial cells by Candida albicans virulence factors. PLOS Pathog 17, e1009221. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Verheesen P and Laeremans T (2012). Selection by phage display of single domain antibodies specific to antigens in their native conformation. Methods Mol Biol 911, 81–104. [DOI] [PubMed] [Google Scholar]
- Verma AH, Richardson JP, Zhou C, Coleman BM, Moyes DL, Ho J, et al. (2017). Oral epithelial cells orchestrate innate type 17 responses to Candida albicans through the virulence factor candidalysin. Sci Immunol 2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wachtler B, Citiulo F, Jablonowski N, Forster S, Dalle F, Schaller M, et al. (2012). Candida albicans-epithelial interactions: dissecting the roles of active penetration, induced endocytosis and host factors on the infection process. PLOS One 7, e36952. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wachtler B, Wilson D, Haedicke K, Dalle F and Hube B (2011). From attachment to damage: defined genes of Candida albicans mediate adhesion, invasion and damage during interaction with oral epithelial cells. PLOS One 6, e17046. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wartenberg A, Linde J, Martin R, Schreiner M, Horn F, Jacobsen ID, et al. (2014). Microevolution of Candida albicans in macrophages restores filamentation in a nonfilamentous mutant. PLOS Genet 10, e1004824. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Weiner A, Orange F, Lacas-Gervais S, Rechav K, Ghugtyal V, Bassilana M and Arkowitz RA (2019). On-site secretory vesicle delivery drives filamentous growth in the fungal pathogen Candida albicans. Cell Microbiol 21, e12963. [DOI] [PubMed] [Google Scholar]
- Westman J, Moran G, Mogavero S, Hube B and Grinstein S (2018). Candida albicans hyphal expansion causes phagosomal membrane damage and luminal alkalinization. mBio 9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wilson D, Naglik JR and Hube B (2016). The missing link between Candida albicans hyphal morphogenesis and host cell damage. PLOS Pathog 12, e1005867. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zakikhany K, Naglik JR, Schmidt-Westhausen A, Holland G, Schaller M and Hube B (2007). In vivo transcript profiling of Candida albicans identifies a gene essential for interepithelial dissemination. Cell Microbiol 9, 2938–2954. [DOI] [PubMed] [Google Scholar]
- Zakikhany K, Thewes S, Wilson D, Martin R, Albrecht A and Hube B (2008). From attachment to invasion: infection associated genes of Candida albicans. Nihon Ishinkin Gakkai Zasshi 49, 245–251. [DOI] [PubMed] [Google Scholar]
- Zheng X, Wang Y and Wang Y (2004). Hgc1, a novel hypha-specific G1 cyclin-related protein regulates Candida albicans hyphal morphogenesis. EMBO J 23, 1845–1856. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The data that support the findings of this study are available from the corresponding author upon reasonable request.



