Abstract
Loquat [Eriobotrya japonica (Thunb.) Lindl.] is an important fruit crop in Pakistan; however, a constant decline in its production is noted due biotic and abiotic stresses, particularly disease infestation. Fungal pathogens are the major disease-causing agents; therefore, their identification is necessary for devising management options. This study explored Taxila, Wah-Cantt, Tret, Chatar, Murree, Kalar-Kahar, Choa-Saidan-Shah and Khan-Pur districts in the Punjab and Khyber Paktoon Khawa (KPK) provinces of Pakistan to explore the diversity of fungal pathogens associated with loquat. The samples were collected from these districts and their microscopic characterizations were accomplished for reliable identification. Alternaria alternata, Curvularia lunata, Lasiodiplodia theobromae, Aspergilus flavis, Botrytis cinerea, Chaetomium globosum, Pestalotiopsis mangiferae and Phomopsis sp. were the fungal pathogens infesting loquat in the study area. The isolates of A. alternata and C. lunata were isolated from leaf spots and fruit rot, while the isolates of L. theobromae were associated with twig dieback. The remaining pathogens were allied with fruit rot. The nucleotide evidence of internal transcribed spacer (ITS) regions (ITS1, 5.8S, and ITS2) were computed from all the pathogens and submitted in the database of National Center for Biotechnology Information (NCBI). For multigene analysis, beta-tubulin (BT) gene and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) regions were explored for A. alternata and C. lunata isolates, respectively. The virulence scales of leaf spots, fruit rot, and twig dieback diseases of loquat were developed for the first time through this study. It is the first comprehensive study with morpho-molecular identification, and newly developed virulence scales of the fungal pathogens associated with loquat, which improves the understanding of these destructive diseases.
Introduction
Loquat [Eriobotrya japonica (Thunb.) Lindl] belongs to the Rosaceae family. It is a subtropical evergreen tree, and its fruit is used in fresh and processed forms. It is cultivated in Australia, Brazil, China, India, Japan, Madagascar, Mauritius, Mediterranean countries, United States, and Pakistan [1]. China is the largest producer of loquat in the world, while it was introduced in Pakistan from China [2]. In Pakistan, Taxila, Wah-Cantt, Khan-Pur, Tret, Chatar, Muree, Kalar Kahar and Choa Saiden Shah are the loquat growing areas. However, the losses caused by fungi infestation in loquat are still unknown [3]. Loquat is produced on an area of 10000 hectares in Pakistan with annual production 8,823 tons of fruits. However, this production is very low as compared to other loquat growing countries of the world. This low production is attributed to various biotic and abiotic stresses, including disease infestation [4]. Loquat fruit is a good source of minerals and carotenoids, and higher phenolic contents are present in the flesh responsible for rapid browning of the fruits [5].
Loquat fruit has a very short shelf life and sensitive to loss of nutrients, moisture, mechanical and physical damage, and microbial decay [6]. Several fungal pathogens, including Alternaria alternata, Aspergillus niger, Botrytis cinerea, Colletotrichum gloeosporioides, Curlaria lunata, Diplocarpon mespili, Diplodia natalensis, Diplodia seriata, Geotrichum candidum, Fusarium solani, Mucor fragilis, Pestalotia sp., Phytophthora palmivora and Spilocaea pyracanthae infest loquat [7–19].
Several fungi genera are difficult to identify at the species level based on morphological characteristics and require considerable expertise for distinguishing closely-related species since their morphological features overlap [20]. The recent introduction of molecular techniques has advanced the detection, reliable identification and screening of many pathogens [21]. Sequence analysis of internal transcribed spacer (ITS) regions (ITS1, 5.8S and ITS2) has been developed for quicker and specific identification of fungi [22, 23]. Although loquat is an important fruit crop in Pakistan, little is known about fungal pathogens causing leaf spots, fruit rot, and twig dieback in the major loquat growing areas of the country. The successful disease management in fruit crops depends on the species’ diagnosis and infestation level of casual organisms. There is no database in Pakistan providing such information. Nevertheless, no literature is currently available on the fungal pathogens associated with loquat. Likewise, the detection of casual organisms through molecular techniques and disease rating scales have not been explored yet.
Therefore, current study was conducted to determine the fungal pathogens associated with loquat in major loquat growing areas of Pakistan. The objectives of this study were; i) to determine fungal pathogens associated with fruit rot, leaf spots and twig dieback of loquat, ii), identification of the pathogens through morpho-molecular methods and iii) and development of the virulence scales for the pathogens through pathogenicity tests. The results will help in future disease management strategies for loquat production areas of the country.
Materials and methods
Survey and sample collection
The surveys were conducted during the summer season, 2015 in loquat growing areas of Taxila (33.74° N, 72.78° E), Wah-Cantt (33.77° N, 72.75° E), Tret (33.83° N, 73.30° E), Chatar (33.77° N, 73.24° E), Murree (33.90° N, 73.39° E), Kalar-Kahar (32.78° N, 72.70° E), Choa-Saidan-Shah (32.71° N, 72.98° E) and Khan-Pur (33.80° N, 72.93° E) districts situated in Punjab and Khyber Phakton Khawa (KPK) provinces of Pakistan. A total 20 loquat trees were selected randomly from each district and suspected leaves, fruits, and twigs were collected. The samples were placed in sterile polythene bags mentioned with time, date, and locations [16]. There were no permits required for sample collection as survey studies aimed at collecting the samples and analyzing them within the country is exempt from the permit requirements.
Isolation and frequency of pathogens
The tissue segments from leaves, fruits, and twigs containing symptomatic and asymptomatic area (5 mm3) were surface sterilized with 1% sodium hypochlorite for 1 minute, dipped thrice into sterile distilled water and dried on double layer of sterile filter papers. The segments were transferred to potato dextrose agar (PDA) and incubated at 24 ± 2°C for 7 days in the dark. Cultural characteristics such as colony color, growth rate and texture were checked with three days interval and microscopic characteristics were used for the identification of the pathogens. A single spore method was used for the purification of the pathogens and preserved in silica gel. The frequency of pathogen was computed with the following formula [16].
Virulence scale on detached leaf
One to two-years old loquat plants with healthy leaves were purchased from the local nursery. The alternate leaves were disinfected with sodium hypochlorite (1%) and its traces were eliminated with double sterile distilled water. The spore suspension of C. lunata (1×104 spore/mL) and A. alternata (106 spores/mL) were sprayed on healthy leaves and the mean infected leaf area (mm) was recorded after 7 days [23].
Virulence scale on fruit
Healthy fruits were initially surface sterilized with 1% sodium hypochlorite for 30 sec and its traces were eliminated by dipping them into sterile distilled water for 1 min. The fruits were dried on three layers of sterile filter paper. Single spore from each isolate was grown on PDA and 100μL spore suspension from an individual isolate of C. lunata (1×104 spore/mL), A. alternata (106 conidia/mL), A. flavis (1×104 spore/mL), B. cinerea (1×104 spore/mL), C. globosum (1×104 spore/mL) and Phomopsis sp. (1×104 spore/mL) was poured to wounded and non-wounded fruits at top, middle and bottom. Artificially inoculated fruits were incubated at 24 ± 2°C with 75% relative humidity in sterile chambers and observed daily.
Virulence scale on twigs
Three loquat plants (one to two-years old) with healthy twigs were obtained from the local nursery and superficial wounds (5 mm long, 2 mm deep and 30 cm below the tip) were made on twigs. The spore suspension (100 μL) of L. theobromae (1×106 spore /mL) was dispensed on wounded twigs and covered with plastic bags. The death of the twig was recorded after 15-day intervals. All treatments had three replications and sterile distilled water (without spore suspension) was used as a negative control. The pathogen was re-isolated from the artificially inoculated fruits, leaves, and twigs and compared with the inoculated culture. The virulence categories such as slightly virulent (+), moderately virulent (++), and highly virulent (+++) of fruit rot, leaf spots, and twig dieback were noted with a newly developed scale (Table 1).
Table 1. Virulence scales of fungal pathogens causing leaf spots, fruit rot, and twig dieback of loquat.
| Virulence category of leaf spots | ||
| Mean infected leaf area (mm) | Virulence category | |
| 50–70 | Highly virulent (+++) | |
| 20–49 | Moderately virulent (++) | |
| 01–19 | Slightly virulent (+) | |
| Virulence category of fruit rot | ||
| Wounded fruits (days) | Non-wounded (days) | Virulence category |
| 3 | 4 | Highly virulent (+++) |
| 5 | 6 | Moderately virulent (++) |
| ≥ 7 | 8 | Slightly virulent (+) |
| Virulence category of twig dieback | ||
| Death of twigs (Days) | Virulence category | |
| 45–60 | Highly virulent (+++) | |
| 61–75 | Moderately virulent (++) | |
| >75 | Slightly virulent (+) | |
Molecular identification
The genomic DNA from purified fungal isolates was extracted with the standard protocol specified in the PrepMan®Ultra sample preparation reagent. A total volume of 50 μL comprising of 1× PCR reaction buffer, 0.5 μM each forward and reverse primer, 0.2 mM of each deoxynucleotide triphosphate (dNTPs), 2.5 mM magnesium chloride (MgCl2), 1 U Taq DNA polymerase, and 20 ng DNA template was used in PCR assay. A negative control (without DNA template) was carried out in the PCR. The PCR conditions of each gene loci were optimized according to the details given in Table 2 and 1Kb DNA ladder was used as a marker. The amplified products were electrophoresed on 1% (w/v) agarose gel stained with ethidium bromide. The amplified products were visualized under ultraviolet light and target DNA fragments were purified with Thermo Scientific GeneJET PCR Purification Kit (#K0701) [16].
Table 2. PCR reaction and conditions for the amplification of gene loci.
| Locus | Designation | Sequence (5´ → 3´) | PCR reaction conditions | Fungal Pathogens Identified | Reference |
|---|---|---|---|---|---|
| Inter transcribed spacer regions (ITS) | ITS1 | TCCGTAGGTGAACCTGCGG | 94°C 120 s; 30 cycles of 94°C, 55°C and 72°C 1 min each; 72°C 7 min | C. lunata, A. alternata, B. cinerea, Phomopsi sp., A. flavis, L. theobromae, P. mangiferae and C. globosum | White et al. [22] |
| ITS1 | TCCTCCGCTTTATTGATATG | ||||
| Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) | GAPDH1 | ACCACAGTCCATGCCATCAC | 95°C 3 min; 30 cycles of 94°C 1 min, 56°C 2 min, 72°C 2 min; 72°C 7 min | C. lunata | Jeon et al. [39] |
| GAPDH2 | TCCACCACCCTG TTGCTGTA | ||||
| Beta Tublin (BT) | BT1 | AACATGCGTGAGATTGTAAG | 95°C 3 min; 30 cycles of 94°C 1 min, 55°C 1.5 min, 72°C 2 min; 72°C 7 min | A. alternata | |
| BT2 | TCTGGATGTTGTTGGGAATC |
Sequencing and sequence analysis
The purified products were sequenced in forward and reverse directions from a DNA facility of Iowa State University, USA, and Macrogen Korea. Both sequences from individual isolate were aligned and manipulated with BioEdit version 7 and final sequences were submitted in the GenBank of National Center for Biotechnological Information (NCBI) to obtain the GenBank accessions numbers (Table 3). The Basic Local Alignment Search Tool (BLAST) network services (https://blast.ncbi.nlm.nih.gov/Blast.cgi) was used to determine the genetic similarity between sequenced and earlier reported isolates. The ITS and GAPDH for Curvularia isolates and ITS and BT for Alternaria isolate to conduct a multi-locus phylogenetic analysis.
Table 3. Total number of fungal isolates isolated from major loquat growing areas of Pakistan.
| Sr. No. | Species identification | Isolate | Isolation source | Symptoms | Pathogenicity tests | Location | ||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Wounded fruit | Non-wounded Fruit | Leaf spot | Twig dieback | ITS | GPDH | BT | ||||||
| 1 | A. flavis | AF1 | Fruit | Fruit rot | +++ | +++ | - | - | Taxila | MN893384 | - | - |
| 2 | A. flavis | AF2 | Fruit | Fruit rot | ++ | ++ | - | - | Taxila | MN893385 | - | - |
| 3 | A. flavis | AF3 | Fruit | Fruit rot | +++ | +++ | - | - | Wah-Cant | MN893386 | - | - |
| 4 | A. flavis | AF4 | Fruit | Fruit rot | +++ | +++ | - | - | Khan-Pur | MN893387 | - | - |
| 5 | B. cinerea | BC | Fruit | Fruit rot | +++ | +++ | - | - | Taxila | MN891765 | - | - |
| 6 | C. globosum | CG1 | Fruit | Fruit rot | ++ | ++ | - | - | Taxila | MN891844 | - | - |
| 7 | C. globosum | CG2 | Fruit | Fruit rot | +++ | +++ | - | - | WahCant | MN891845 | - | - |
| 8 | C. lunata | CUR7 | Leaf | Leaf spot | - | - | +++ | - | Khan-Pur | MN897731 | MN894806 | - |
| 9 | C. lunata | CUR11 | Leaf | Leaf spot | - | - | +++ | - | Wah-Cant | MN897732 | MN894807 | - |
| 10 | C. lunata | CUR15 | Leaf | Leaf spot | - | - | + | - | Taxila | MN897733 | MN894808 | - |
| 11 | C. lunata | CUR19 | Fruit | Fruit rot | +++ | +++ | - | - | Taxila | MN897734 | MN894809 | - |
| 12 | C. lunata | CUR23 | Fruit | Fruit rot | +++ | +++ | - | - | Taxila | MN897735 | MN894810 | - |
| 13 | C. lunata | CUR29 | Fruit | Fruit rot | + | + | - | - | Tret | MN897736 | MN894811 | - |
| 14 | C. lunata | CUR33 | Fruit | Fruit rot | +++ | ++ | - | - | Taxila | MN897737 | MN894812 | - |
| 15 | C. lunata | CUR45 | Fruit | Fruit rot | +++ | +++ | - | - | Khan-Pur | MN897738 | MN894813 | - |
| 26 | C. lunata | CUR49 | Leaf | Leaf spot | - | - | ++ | - | Wah-Cant | MN897739 | MN894814 | - |
| 17 | C. lunata | CUR53 | Fruit | Fruit rot | ++ | ++ | - | - | Murree | MN897740 | MN894815 | - |
| 18 | C. lunata | CUR58 | Fruit | Fruit rot | +++ | +++ | - | - | Taxila | MN897741 | MN894816 | - |
| 19 | C. lunata | CUR63 | Leaf | Leaf spot | - | - | +++ | - | Khan-Pur | MN897742 | MN894817 | - |
| 20 | C. lunata | CUR65 | Fruit | Fruit rot | ++ | ++ | - | - | Khan-Pur | MN897743 | MN894818 | - |
| 21 | C. lunata | CUR69 | Fruit | Fruit rot | +++ | +++ | - | - | Taxila | MN897744 | MN894819 | - |
| 22 | C. lunata | CUR71 | Fruit | Fruit rot | +++ | +++ | - | - | Kalar-Kahar | MN897745 | MN894820 | - |
| 23 | C. lunata | CUR75 | Leaf | Leaf spot | - | - | +++ | - | Wah-Cant | MN897746 | MN894821 | - |
| 24 | C. lunata | CUR80 | Fruit | Fruit rot | +++ | +++ | - | - | Khan-Pur | MN897747 | MN894822 | - |
| 25 | C. lunata | CUR99 | Leaf | Leaf spot | - | - | ++ | - | Choa-Saidan-Shah | MN897748 | MN894823 | - |
| 26 | L. theobromae | PAK9 | Twig | TDB | - | - | - | +++ | Murree | KR259518 | - | - |
| 27 | L. theobromae | PAK8 | Twig | TDB | - | - | - | ++ | Choa-Saidan-Shah | KR259517 | - | - |
| 28 | L. theobromae | PK7 | Twig | TDB | - | - | - | +++ | Wah-Cant | KR259516 | - | - |
| 29 | L. theobromae | PAK40 | Twig | TDB | - | - | - | +++ | Taxila | KT312819 | - | - |
| 30 | L. theobromae | TR-73 | Twig | TDB | - | - | - | ++ | Tret | KR092218 | - | - |
| 31 | L. theobromae | TR-80 | Twig | TDB | - | - | - | ++ | Tret | KR092217 | - | - |
| 32 | P. mangiferae | PM | Fruit | Fruit rot | +++ | +++ | - | - | Taxila | MN888956 | - | - |
| 33 | Phomopsis sp. | PS1 | Fruit | Fruit rot | +++ | +++ | - | - | Khan-Pur | MN892356 | - | - |
| 34 | Phomopsis sp. | PS2 | Fruit | Fruit rot | + | + | - | - | Taxila | MN892357 | - | - |
| 35 | Phomopsis sp. | PS3 | Fruit | Fruit rot | + | + | - | - | Wah-Cant | MN892358 | - | - |
| 36 | Phomopsis sp. | PS4 | Fruit | Fruit rot | ++ | ++ | - | - | WahCant | MN892359 | - | - |
| 37 | Phomopsis sp. | PS5 | Fruit | Fruit rot | +++ | +++ | - | - | Taxila | MN892360 | - | - |
| 38 | A. alternate | ALT1 | Fruit | Fruit rot | +++ | +++ | - | - | Taxila | MN944580 | - | MT003125 |
| 39 | A. alternate | ALT2 | Fruit | Fruit rot | +++ | +++ | ++ | - | Khan-Pur | MN944581 | - | MT003126 |
| 40 | A. alternate | ALT3 | Leaf | Leaf spot | ++ | ++ | +++ | - | Wah-Cant | MN944582 | - | MT003127 |
| 41 | A. alternate | ALT4 | Leaf | Leaf spot | ++ | ++ | +++ | - | Wah-Cant | MN944583 | - | MT003128 |
| 42 | A. alternate | ALT5 | Fruit | Fruit rot | +++ | +++ | ++ | - | Taxila | MN944584 | - | MT003129 |
| 43 | A. alternate | ALT6 | Leaf | Leaf spot | ++ | ++ | ++ | - | Taxila | MN944585 | - | MT003130 |
| 44 | A. alternate | ALT7 | Fruit | Fruit rot | ++ | ++ | ++ | - | Choa-Saidan-Shah | MN944586 | - | MT003131 |
| 45 | A. alternate | ALT8 | Leaf | Leaf spot | ++ | ++ | + | - | Kalar-Kahar | MN944587 | - | MT003132 |
ITS = Internal Transcribed spacer region, GAPDH = glyceraldehyde 3-phosphate dehydrogenase (GAPDH) BT = beta tubulin, - = negative, + = slightly virulent, ++ = moderately virulent and +++ highly Virulent.
The Molecular Evolutionary (ME) tree of single ITS and combined sequences were inferred for 1000 replicates to assess the stability and robustness of each branch by using the Maximum Likelihood method based on the Tamura 3-parameter model. The tree was computed by Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using the Maximum Composite Likelihood (MCL) approach. The analysis was conducted in Molecular Evolutionary for Genetic Analysis (MEGA) version 7.0 [24].
Results
Symptoms
Soft, dark brown to black lesions were observed in immature and mature fruits and entire fruit rot was recorded at later stage of infection. The necrotic leaf spots were visualized on infected leaves, which varied from brown to yellow. Leaf spots and fruit rot were recorded in all locations, while samples collected from Chatar and Kalar-Kahar were free from twig dieback.
Morpho-molecular identification of Curvulaira leaf spots and fruit rot
A total eighteen isolates were morphologically identified as the causal agents of Curvularia leaf spots and fruit rot. The fungal colonies were fast-growing with fluffy or velvety and suede-like to downy texture, as well as brown to blackish brown with a black reverse.
Pale brown conidia were slightly curved or cylindrical with dark and large central and three or more transverse septa were formed apically through a pore. The range of average conidial length and width was 28.02 ± 2.280 μm to 9.97 ± 1.99 μm, respectively.
The isolates were obtained from Khan-Pur (CUR7, CUR45, CUR63, CUR65, and CUR80), Wah-Cantt (CUR11, CUR49, and CUR75), Tret (CUR29), Murree (CUR53), Kalar-Kahar (CUR71), Choa-Saidan-Shah (CUR99), and Taxila (CUR15, CUR19, CUR23, CUR33, CUR58, and CUR69) with different virulence categories (Table 2). These isolates were confirmed with the amplification of ITS regions (650bp) through PCR assay and sequences were submitted at NCBI with GenBank accession numbers MN897731 to MN897748. The C. lunata exhibited 40% pathogen frequency. For multigene identification, GAPDH genes were also amplified through PCR assay and sequences were submitted at NCBI with GenBank accession numbers MN894806 to MN894823.
Morph-molecular identification of Alternate leaf spots and fruit rot
A total eight isolates of A. alternata were isolated from Taxila (ALT1, ALT5, and ALT6), Wah Cantt (ALT3 and ALT4), Khan-Pur (ALT2), Kalar-Kahar (ALT8), and Choa-Saidan-Shah (ALT7). At the initial growth stage, white colonies with slight variations and regular to irregular margins were observed on media. The colonies turned black to golden brown after seven days due to sporulation. The conidia were light to dark brown to black, obclavate, and obpyriform with a short conical or cylindrical beak and the range of conidial length was 9.40 to 39.84 μm. The number of longitudinal septa ranged from 0 to 4, whereas the number of transverse septa ranged from 1 to 6. The isolates formed both beaked and non-beaked conidia. Maximum and minimum conidial breadth was recorded as 13.98 ± 1.74 μm and 8.73 ± 2.49 μm, respectively. The ITS regions (650bp) were used for the confirmation of all isolates through PCR assay and sequences were submitted with the GenBank accession number MN944580 to MN944587. The maximum 17.8% pathogen frequency was recorded for A. alternata isolates. For multigene identification, BT gene was amplified through PCR assay, and sequences were submitted at NCBI with GenBank accession numbers MT003125 to MT003132.
Morpho-molecular identification of twig dieback
Dark brown to black colonies in six isolates of L. theobromae were observed in PDA and Pycnidia were dark brown to black. Two celled thin-walled oval conidia averaging 25.3 μm length by 12.9 μm width were observed. Six isolates were obtained from Tret (TR-73 and TR-80), Wah-Cantt (PK7), Taxila (PAK40), and Choa-Saidan Shah (PAK8). The amplification of 650bp of ITS regions confirmed these isolates in PCR and sequences were submitted at NCBI with GenBank accession number KR259516 to KR259519 and KR092217 to KR092220. The frequency was 13.3%.
Morpho-molecular identification of Phomopsis fruit rot
Five isolates of Phomopsis sp. were recorded from Khan-Pur (PS1), Taxila (PS2 and PS5), and Wah-Cantt (PS3 and PS4). The isolates were yielding colonies with a dark mycelium and abundant black, globose pycnidia 70 to 300 μm in diameter. Hyphae were septate and conidia were hyaline, one-celled, ellipsoid to ovoid (average 5–11 × 2–4μm). The amplification of ITS regions (650bp) in PCR assay confirmed the molecular identification and sequences were submitted with the GenBank accession number MN892356 to MN892360. The frequency was computed as 11.1%.
Morpho-molecular identification of Aspergillus fruit rots
Four isolates of A. flavis were obtained from Taxila (AF1 and AF2), Wah-Cantt (AF3), and Khan-Pur (AF4). The isolates were exhibiting yellow colonies which later became bright to dark yellow green. Colonies were granular, flat, often with radial grooves, and covered by a layer of brown to black conidial heads. The conidial heads were radiate (400 to 800 μm), hyaline conidiophore stipes were coarsely roughened, and conidia (10 spores per sample) were globose to sub-globose (3 to 6 μm in diameter). The 650bp amplification of the ITS region was recorded from each isolate in PCR assay and GenBank accession numbers were obtained as MN893384 to MN893387. The frequency was recorded as 17.8%.
Morph-molecular identification of Chaetomium fruit rots
After 1 week of incubation at 25 ± 2°C with a 12-h photoperiod, colonies from two isolates of Chaetomium globosum were pale yellow with olivaceous green aerial mycelium, later producing a greenish pigment that diffused into the medium. Ascomata were olivaceous green, globose or ovoidal to obovoidal (140 to 201 μm × 113 to 229 μm), with numerous nonbranched brownish setae (470 μm in length). The ascomata wall was brown and composed of septate hyphae. Terminal and lateral setae were abundant, brown, and tapering toward the tips (3.9 to 5.9μm). Asci were clavate (23 to 35 μm × 10 to 15 μm) with eight limoniform, bilaterally flattened, brown ascospores (6.1 to 8.2 μm × 5.9 to 7.8 μm in size). Isolates were obtained from Taxila (CG1) and Wah-Cantt (CG1). The molecular identification was confirmed with the amplification of the ITS regions and GenBank accession numbers were obtained as MN891844 and MN891845. The frequency was 4.4%.
Morpho-molecular identification of Botrytis fruit rot
Light to the dark gray colony was recorded in the single isolate of Botrytis cinerea obtained from Taxila (BC). The single-celled conidia were globose or ellipsoidal shaped, ranging from 5.92 to 11.15 μm × 5.74 to 7.30 μm. More or less straight conidiophores directly emerged from the mycelia ranging from 594 to 3,284 μm in length. Conidiophores were septate, branched at the apex, and producing grape clusters shape conidia. The frequency of B. cinerea was 2.2%. The ITS regions (650bp) were amplified through PCR assay and the sequence was submitted with GenBank Accession number MN891765.
Morpho-molecular identification and frequency Pestalotiopsis fruit rot
White fungal colony of sparse aerial mycelium with acervuli containing black, slimy spore masses on the surface of PDA was observed in the single isolate of Pestalotiopsis mangiferae obtained from Taxila (PM). The colony reached 8 cm diameter after 7-days of culture on PDA at 24°C. Conidia produced in the culture were five-celled, narrow fusiform, straight or slightly curved, with a tapering base and 2 to 4 hyaline appentages (apical appentages measured 15 to 34 μm long and a single basal appentage were 5 to 9 μm long). Conidia were 24 to 32 × 5 to 8 μm with median cells 15 to 20 μm and two hyaline, cylindrical to conical apical cells. The ITS regions were confirmed with the amplification of 650bp in PCR assay and the GenBank accession number was MN888956. The frequency was recorded as 2.2%.
Pathogenicity tests
Disease symptoms were recorded on artificially inoculated leaves, twigs and fruits, while no symptoms were found on healthy fruits and plants.
Sequencing and sequence analysis
Initially, the ITS sequences from all fungal pathogens associated with loquat were used for the sequence analysis. The tree with the highest log-likelihood is presented in Fig 1A. The tree was drawn to scale, with branch lengths measured in the number of substitutions per site. The isolates exhibiting the maximum genetic similarity were found in a similar cluster. The combined sequence analysis of ITS and GAPDH of C. lunata isolates was conducted and all isolates were recorded in C. lunata cluster with reference isolates CIMAP SB-8213 (Fig 1B). The other reference isolates of C. coatesiae were recorded in C. coatesiae cluster. The combined sequence analysis of ITS and BT gene from all A. alternata isolates were recorded in A. alternata cluster with reference isolates GZU-BCEC154 due to maximum genetic homology between the isolates. The combined sequences of reference isolates of A. panax were recorded in A. panax cluster (Fig 1C).
Fig 1. Evolutionary history of ITS region from all isolates (a) and multigene sequence analysis of Curvularia (b) and Alternaria (c) isolates.
Discussion
Pakistan has the largest area under loquat production in southern Asia [11] and it is considered a major fruit crop of the country for local and export markets. Loquat fruit has a very short postharvest life and about 500 tones reduction in the loquat yield has been attributed to different biotic and abiotic factors [4]. An inappropriate post-harvest handling, poor storage conditions, unavailability of suitable transport vehicles, and inadequate marketing strategies are responsible for changing the physiological state of the fruit and seriously affecting its quality. Nevertheless, information on diversity of fungal pathogens associated with loquat is insufficient. The current study describes information regarding diversity of fungal pathogens associated with leaf spots, fruit rot, and twig dieback of loquat in Pakistan. The study was conducted to identify the isolated fungi based on morphological as well as molecular approaches.
Ascomycota and Deuteromycota are two phyla associated with loquat. The identified pathogens belonged to the families Botryosphaeriaceae, Cerambycidae, Nectriaceae, Pleosporaceae, Sclerotiniaceae, and Venturiaceae. The pathogens associated with Pleosporaceae cause leaf spots and fruit rot, while the remaining were associated with fruit rot. The occurrence of A. alternata, C. lunata, L. theobromae, A. flavis, B. cinerea, C. globosum, P. mangiferae and Phomopsis sp. Was confirmed in the major loquat growing areas of Pakistan. The A. flavus, B. cinerea, P. mangiferae, C. globosum and Phomopsis sp. were minor pathogenic species. The C. lunata and A. alternata were majorly associated with leaf spots and fruit rot and L. theobromae with twig dieback. This may indicate that variation in environmental conditions results in different fungal species [25].
Earlier, gray mold and black spot rot have been reported from loquat fruit [26]. A. alternata has been reported to cause decay of loquat in Palestina [27], China [28], Taiwan [26], Greece [29], and Iran [30]. This study also represents the first attempt to characterize the virulence of these fungal species. The frequency of associated pathogens was determined in each growing location because they depend on local pre-harvest, harvest, and postharvest factors. The samples were collected based on the visual disease symptoms as they play a significant role in diagnosis [9]. The symptoms from a single pathogen were somewhat like other locations and a relationship between symptoms and the different fungal pathogens isolated was observed to a certain extent.
The symptoms associated with Alternaria leaf spots and fruit rot of loquat in Pakistan were similar to the symptoms recorded in different locations of Taiwan [26], Greece [29], Iran [30], and Pakistan [19]. The leaf spots associated with C. lunata were similar to the previously described symptoms of loquat in Pakistan [12]; however, this pathogen was isolated first time from the fruit. Circular to elongated sunken spots were recorded on the loquat fruit infected with Pestalotiopsis sp. and the symptoms were similar to the description of Pestalotiopsis fruit rot of loquat in China [31]. The occurrence of gray mold caused by B. cinerea was also recorded on loquat [32] and it is an aggressive airborne pathogen and can cause massive losses in the field conditions [33]. Circular to elongated, sunken spots were recorded over the surface of loquat fruit infected with P. mangiferae and similar symptoms were observed in Argentina [34]. Aspergillus sp. [35], Chaetomium sp. [36], and L. theobromae [11] were also reported from loquat.
Symptomology is not an appropriate criterion because symptom development might be due to several biotic as well as abiotic factors. To reduce this doubt, physiological and microscopic characters were further adapted for the identification of fungal pathogens associated with loquat. These characters are limited to describe species boundaries due to high level of cryptic speciation and extreme morphological homoplasy. The species identification in the genus is confusing and a high level of expertise is mandatory to distinguish these at species level based on morphological characters. To remove this confusion, new molecular approaches, i.e., sequence analysis of the universal ITS region was further proposed for the identification of fungal pathogens at species level [22]. A. flavus is common in crops producing most important mycotoxins [37]. This is the first evidence of A. flavus, B. cinerea, P. mangiferae, C. globosum and Phomopsis sp. decay in loquat growing areas of Pakistan, and morpho-molecular identification was used to confirm of these pathogens in Spain [32, 38].
Traditional diagnostic methods for detection and identification of fungal pathogens were based on specific media, temperature, and lighting for sporulation and morphological characterization. Alternaria and Curvularia isolates were difficult to differentiate based on morphological characteristics and sequence analysis of the ITS regions. The multi-gene phylogenetic analyses can positively separate them. The multiple sequence analysis of Curvularia sp. (Fig 1B) and Alternaria sp., (Fig 1C) confirmed that all isolates from a single species were recorded in a similar cluster. In pathogenicity tests, the rot was recorded on wounded and non-wounded fruits, while no symptoms were recorded on negative control. All the fungal pathogens isolated from fruit rot, leaf spots, and twig dieback of loquat were pathogenic with different virulence categories. The spreading of the diseases in loquat growing areas of Pakistan probably occurs by the transportation of contaminated loquat fruit and it could help to disperse the fungal pathogens to other locations. The dispersal might also occur through the movement of plant material and fruit from neighboring countries due to the inadequate quarantine department facility in the country.
Conclusion
In conclusion, this study identified fungal species isolated from loquat trees with symptoms of leaf spots, fruit rot, and twig dieback. The present study depicted that the fruit rot of loquat can occur as a result of infection by A. flavis, B. cinerea, C. globosum, P. mangiferae, Phomopsis sp., whereas A. alternata, C. lunata and L. theobromae was infecting twigs. The development of new loquat cultivars should consider the diversity of fungal species associated with the fruit rot. The current study provides a framework for phylogenetic analysis of fungal pathogens associated with fruit rot, leaf spots, and twig dieback of loquat. The morphological characteristics, multigene sequence analysis, and pathogenicity testing can assist the Pakistan loquat industry to implement control strategies to minimize economic losses and attention should be devoted to the treatment of loquat growing areas to reduce the incidence of fungal infections. The proper management will increase the production of loquat fruit and improve the economic condition of the growers.
Data Availability
All relevant data are within the manuscript.
Funding Statement
This work was supported by projects of the national Nature Science Foundation (No. 32060679) and projects of Guizhou University (No. GuidapeiYU[2019]52 and No. [2017]50).This study was financed by Taif University Researchers Supporting Project number (TURSP-2020/38), Taif University, Taif, Saudi Arabia. There were no additional external funding involved in the study. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1.Hussain A, Abbasi N, Akhtar A. Fruit characteristics of different loquat genotypes cultivated in Pakistan; 2006. pp. 287–292. [Google Scholar]
- 2.Khan I. The history of loquat growing and future prospects of its commercial cultivation and marketing in Pakistan; 2003. pp. 25–26. [Google Scholar]
- 3.Hussain A, Abbasi NA, Hafiz IA, Ahmad Z, Naqvi SSJPJB (2009) Molecular characterization and genetic relationship among loquat (Eriobotrya japonica Lindl.) genotypes of Pakistan assessed by RAPD markers. 41: 2437–2444. [Google Scholar]
- 4.GOP (2016) Fruits, vegetables and condiments statistics of Pakistan. Govt of Pak Mini. Food Agri. Livest: 1–10. [Google Scholar]
- 5.Cai C, Xu C, Shan L, Li X, Zhou C, et al. (2006) Low temperature conditioning reduces postharvest chilling injury in loquat fruit. Post Biol Tech 41: 252–259. [Google Scholar]
- 6.Cao S, Cai Y, Yang Z, Joyce DC, Zheng Y (2014) Effect of MeJA treatment on polyamine, energy status and anthracnose rot of loquat fruit. Food Chem 145: 86–89. doi: 10.1016/j.foodchem.2013.08.019 [DOI] [PubMed] [Google Scholar]
- 7.Liu A, Chen W, Gu H, Shi J, Li J. Biological characteristic of pathogenic fungus causing anthracnose of loquat fruit; 2006. pp. 465–470. [Google Scholar]
- 8.Yahia EM (2011) Postharvest biology and technology of tropical and subtropical fruits: fundamental issues: Elsevier. [Google Scholar]
- 9.Batool M, Mukhtar T, Butt H (2014) First report of Diplocarpon mespili on loquat (Eriobotrya japonica) in Pakistan. Österreichische Zeitschrift für Pilzkunde 23: 143–147. [Google Scholar]
- 10.Hafeez R, Akhtar N, Shoaib A, Bashir U, Haider M, et al. (2015) First report of Geotrichum candidum from Pakistan causing postharvest sour rot in loquat (Eriobotrya Japonica). Anim Plant Sci 25: 1737–1740. [Google Scholar]
- 11.Butt H, Mukhtar T, Batool M, Aslam MN, Kayani MZ, et al. (2015) Occurrence of leaf scab caused by Spilocaea pyracanthae on loquat (Eriobotrya japonica) in the Pothowar region of Pakistan. Mycopath 13: 29–32. [Google Scholar]
- 12.Abbas M, Naz F, Tariq A, Mumtaz A, Irshad G, et al. (2016) First report of Curvularia lunata causing leaf spots on loquat from Pakistan. J Plant Pathol 98. [Google Scholar]
- 13.Abbas MF, Naz F, Rauf CA, Khan MA (2016) Cultural, morphological, pathogenic and molecular characterization of Alternaria mali associated with necrotic leaf spot of loquat. Int J Biosci 9: 271–281. [Google Scholar]
- 14.Mehmood N, Riaz A, Jabeen N, Anwaar S, Hussain S, et al. (2017) First report of Fusarium solani causing fruit rot of strawberry in Pakistan. Plant Dis 101: 1681–1681. [Google Scholar]
- 15.Abbas M, Naz F, Rauf CA, Mehmood N, Zhang X, et al. (2017) First report of Fusarium solani causing fruit rot of loquat (Eriobotrya japonica) in Pakistan. Plant Dis 101: 839. [Google Scholar]
- 16.Naz F, Abbas M, Rauf C, Tariq A, Mumtaz A, et al. (2017) First report of Colletotrichum gloeosporioides causing anthracnose on loquat in Pakistan. Plant Dis 101: 1550–1550. [Google Scholar]
- 17.Abbas MF, Naz F (2018) First report of Diplodia seriata causing fruit rot of loquat in Pakistan. J Plant Pathol 100: 325–325. [Google Scholar]
- 18.Abbas MF, Naz F, Batool S, Naeem M, Qamar MI (2018) First evidence of Mucor rot infecting loquat (Eriobotrya japonica L.) in Pakistan. Mycopath 16. [Google Scholar]
- 19.Abbas MF, Naz F, Batool S, Qamar MI, Moosa A (2020) Morpho-molecular identification of Alternaria alternata causing leaf spot on loquat in Pakistan. J Plant Pathol: 1–1. doi: 10.1007/s42161-020-00644-w [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Leslie JF, Summerell BA (2008) The Fusarium laboratory manual: John Wiley & Sons. [Google Scholar]
- 21.Arif M, Atta S, Bashir MA, Khan MI, Hussain A, et al. (2021) The impact of Fosetyl-Aluminium application timing on Karnal bunt suppression and economic returns of bread wheat (Triticum aestivum L.). Plos one 16: e0244931. doi: 10.1371/journal.pone.0244931 [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
- 22.White TJ, Bruns T, Lee S, Taylor J (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. CR protocols: a guide to methods applications 18: 315–322. [Google Scholar]
- 23.Abbas MF, Rafiq M, Al-Sadi AM, Alfarraj S, Alharbi SA, et al. (2021) Molecular characterization of leaf spot caused by Alternaria alternata on buttonwood (Conocarpus erectus L.) and determination of pathogenicity by a novel disease rating scale. Plos one 16: e0251471. doi: 10.1371/journal.pone.0251471 [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
- 24.Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: molecular evolutionary genetics analysis version 6.0. Mol Biol Evol 30: 2725–2729. doi: 10.1093/molbev/mst197 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Saikkonen K (2007) Forest structure and fungal endophytes. fUNG Biol Rev 21: 67–74. [Google Scholar]
- 26.Ko Y, Liu C, Chen S, Chen C, Yao K, et al. (2010) First report of fruit rot of loquat caused by an Alternaria sp. in Taiwan. Plant Dis 94: 481–481. doi: 10.1094/PDIS-94-4-0481B [DOI] [PubMed] [Google Scholar]
- 27.Batta Y (2005) Control of Alternaria spot disease on loquat (Eriobotrya japonica Lindl.) using detached fruits and leaf-disk assay. An-Najah University Journal for Research Natural. [Google Scholar]
- 28.Gu H, Liu A, Chen W, Feng S, Shi J. Development and control of postharvest diseases of loquat fruit; 2006. pp. 437–444. [Google Scholar]
- 29.Tziros GT (2013) Alternaria alternata causes leaf spot and fruit rot on loquat (Eriobotrya japonica) in Greece. Aust Plant Dis Not 8: 123–124. [Google Scholar]
- 30.Mirhosseini HA, Babaeizad V, Basavand E (2015) Identification and detection of agent of loquat leaf spot and fruit rot in north of Iran. J New Biol Repor 4: 135–138. [Google Scholar]
- 31.Chen Y, Wang W-X, Zhang A-F, Yang X, Xu Y-L (2013) First report of Pestalotiopsis theae on Loquat (Eriobotrya japonica) in Anhui province of China. Plant Dis 97: 558–558. doi: 10.1094/PDIS-08-12-0710-PDN [DOI] [PubMed] [Google Scholar]
- 32.Palou L, Sánchez-Torres P, Montesinos-Herrero C, Taberner V (2016) Incidence and etiology of postharvest fungal diseases of loquat fruit (Eriobotrya japonica (Thunb.) Lindl. cv.‘Algerie’) in Alacant province (Spain). Eur J Plant Pathol 146: 847–860. [Google Scholar]
- 33.Williamson B, Tudzynski B, Tudzynski P, van Kan JA (2007) Botrytis cinerea: the cause of grey mould disease. Mol Plant Pathol 8: 561–580. doi: 10.1111/j.1364-3703.2007.00417.x [DOI] [PubMed] [Google Scholar]
- 34.Perelló A, Larran S (1999) First report of Pestalotiopsis guepini on loquat in Argentina. Plant Dis 83: 695–695. doi: 10.1094/PDIS.1999.83.7.695A [DOI] [PubMed] [Google Scholar]
- 35.Rana O, Upadhyaya J (1972) A new fruit rot of loquat (Eriobotrya japonica L.). Sci Cult 38: 35–36. [Google Scholar]
- 36.Wang X, Lombard L, Groenewald J, Li J, Videira S, et al. (2016) Phylogenetic reassessment of the Chaetomium globosum species complex. Mol Phyl Evol Fungi 36: 83. doi: 10.3767/003158516X689657 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Frisvad JC, Hubka V, Ezekiel C, Hong S-B, Nováková A, et al. (2019) Taxonomy of Aspergillus section Flavi and their production of aflatoxins, ochratoxins and other mycotoxins. Stud in Mycol 93: 1–63. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.González‐Domínguez E, León M, Armengol J, Berbegal M (2015) A nested polymerase chain reaction protocol for in planta detection of Fusicladium eriobotryae, causal agent of loquat scab. J Phytopath 163: 415–418. [Google Scholar]
- 39.Jeon SJ, Nguyen TTT, Lee HB (2015) Phylogenetic status of an unrecorded species of Curvularia, C. spicifera, based on current classification system of Curvularia and Bipolaris group using multi loci. Mycologia 43: 210–217. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
All relevant data are within the manuscript.

