Abstract
With the development of sequencing technology and further scientific research, an increasing number of biosynthetic gene clusters associated with secondary Streptomyces metabolites have been identified and characterized. The encoded genes of a family of regulators designated as PAS-LuxR are gradually being discovered in some biosynthetic gene clusters of polyene macrolide, aminoglycoside, and amino acid analogues. PAS-LuxR family regulators affect secondary Streptomyces metabolites by interacting with other family regulators to regulate the transcription of the target genes in the gene cluster. This paper provides a review of the structure, function, regulatory mechanism, and application of these regulators to provide more information on the regulation of secondary metabolite biosynthesis in Streptomyces, and promote the application of PAS-LuxR family regulators in industrial breeding and other directions.
Keywords: Streptomyces, secondary metabolism, PAS-LuxR, regulator
1. Introduction
Secondary Streptomyces metabolites appear in the late stages of growth, when nutrients are insufficient and growth rates are reduced; they provide more than half of all antibiotics in clinical use [1]. The secondary metabolism of Streptomyces is a complex process that is closely linked to the complex differentiation of cells. Thus, various regulatory approaches are used for the metabolic process in Streptomyces in which different regulators interact and form a large and complex regulatory network that is rare in prokaryotes. Depending on the source, the different regulatory factors of a bacterium can be divided into internal and external (e.g., environmental) factors. Environmental factors include carbon, nitrogen, and phosphate, which are essential nutrients for the primary metabolism of the bacterium and serve as regulatory substances on the secondary metabolism of the bacterium. Regulatory substances from the bacterium itself typically include small molecules, such as highly phosphorylated guanosine acids (ppGpp), γ-butyrolactones, small proteins such as σ-factors, and regulatory proteins encoded by regulatory genes’ biosynthetic gene clusters.
The regulatory genes in the biosynthesis of secondary metabolites in Streptomyces can be divided into those that contain only a DNA binding domain (DBD) and those that have an additional signal recognition or energy conversion region in addition to the DBD. Most of the regulators in Streptomyces contain an additional region [2]. According to the range of regulation, most regulators are pathway-specific, while a few regulators are pleiotropic regulators. Depending on the structure and function of the regulatory proteins, they can be classified as tetracycline repression (TetR), xenobiotic response element (XRE), Streptomyces antibiotic regulatory protein (SARP), multiple antibiotic resistance regulator (MarR), large ATP-binding regulators of the LuxR (LAL), PAS-LuxR, and other families [3]. More than 100 TetR family regulators have been identified, rendering it the largest family of regulators available [4]. XRE family regulators are the second most common family and are commonly found in bacteria such as Serratia marcescens, Streptomyces, and Pseudomonas aeruginosa [5]. SARP regulators were the first family to be identified and studied, but they are only found in Actinomycetes and mostly in Streptomyces [6]. MarR family regulators are commonly found in the genomes of Streptomyces with an average of 50 MarR family regulators per genome [7], and only one conserved structural domain was found for binding to DNA in its structure [6]. The LAL family is a large class of regulators that bind to ATP, typically consisting of 900–1000 amino acids. The PAS-LuxR family, a late class of regulators, combines an N-terminal PAS domain with a C-terminal helix–turn–helix (HTH) motif of the LuxR type. PAS domain, a signal module that monitors changes in light, redox potential, oxygen energy level of a cell, and small ligands was first found in eukaryotes and was named after homology to the Drosophila period protein (Per), the aryl hydrocarbon receptor nuclear translocator protein (ARNT), and the Drosophila single-minded protein (Sim) [8]. Similar to other families, the PAS-LuxR family regulators control secondary metabolic processes by influencing the transcription of functional genes. However, considering the presence of PAS, this regulator may play a regulatory role by sensing extracellular environmental changes. In addition, in terms of regulatory mode, the binding site of PAS-LuxR regulators contains a 16-bp palindrome-like region and adjusts to the consensus CTVGGGAWWTCCCBAG (V represents A, C, or G; W stands for A or T; B stands for C, G, or T), which is located in the −35 region in promoters of the regulated genes [9].
This paper provides a review of the structure, function, regulatory mechanism, and application of PAS-LuxR family regulators to improve the study of secondary metabolite biosynthetic regulation in Streptomyces and promote the application of PAS-LuxR family regulators in industrial breeding and other directions. PAS-LuxR family, regulator, and secondary metabolism were selected as the keywords for the search in Google Scholar from 2007 to 2022.
2. PAS-LuxR Family Regulators
The number of PAS-LuxR family regulators is relatively small, and the 18 reported regulators are listed in Table 1. The regulators of this family in different strains with the conserved regulatory function can be exchangeable. The genes encoding PAS-LuxR regulators can be found in all known polyene macrolide biosynthesis gene clusters [10] and in the two nonpolyene products pathways of coronafacoyl-L-isoleucine (CFA-L-Ile) and wuyiencin. The structures of these products are shown in Figure 1.
Figure 1.
Structures of secondary metabolites regulated by the PAS-LuxR family regulators.
2.1. PAS-LuxR Family Regulators Are Present in the Type I Polyketide Synthase (PKS) Pathway
As shown in Figure 2, PAS-LuxR regulatory genes are predominantly found in the PKS pathway. For example, the most well-reported biosynthetic gene cluster of pimaricin (also known as natamycin) has five PKS genes (pimS0, pimS1, pimS2, pimS3, and pimS4), three oxidoreductase genes (pimD, pimF, and pimG), three glycosylation genes (pimC, pimJ, and pimK), three transporter genes (pimA, pimB, and pimH), one pleiotropic effect regulatory gene (pimT) [9], one thioester hydrolase gene (pimI), and one sterol oxidase gene (pimE) [11,12]. In addition to the PKS and postmodifying genes, two regulatory genes, namely, pimM and pimR, encode a PAS-LuxR family regulator and a SARP-LAL family regulator. Reedsmycin is a nonglycosylated polyene macrolide, and its gene cluster includes four PKS genes (rdmG, rdmH, rdmI, and rdmJ), a resistance protein gene (rdmK), a PaaI family thioesterase gene (rdmM), an acyl carrier protein (ACP) gene (rdmN), an acyl coenzyme A synthase gene (rdmO), two genes with the methyltransferase gene (rdmB), the ferritin gene (rdmL), and five regulatory protein genes (rdmA, rdmC, rdmD, rdmE, and rdmF) that encode a PAS-LuxR family protein [13]. The PAS-LuxR family regulators are also present in the biosynthetic gene clusters of all polyene macrolides, including nystatin, filipin, tetramycin, aureofuscin, candicidin/FR-008, and amphotericin. CFA-L-Ile is an amino acid analogue, and the CFA-L-Ile gene cluster consists of two PKS genes (cfa6 and cfa7), one acyl carrier protein (ACP) gene (cfa1), two acyl coenzyme A ligase genes (cfa5 and cfal), one oxidoreductase gene (scab79681), a cytochrome P450 monooxygenase gene (sabc79691), two reductase genes (cfa8 and sabc79721), a hydroxybutyryl coenzyme A dehydrogenase gene (sabc79711), and two regulatory genes (orf1 and cfaR, which encode a PAS-LuxR family protein) [14]. Wuyiencin is an aminoglycoside antibiotic [15,16] that was mainly studied in biocontrol. The gene cluster has only been partially sequenced and it contains PAS-LuxR gene wysR. PAS-LuxR family regulators are mainly present in the PKS pathway.
Figure 2.
Biosynthetic gene clusters containing the PAS-LuxR genes. Sln is a biosynthetic gene cluster that produces pimaricin in S.gilvosporeus. Scn is a biosynthetic gene cluster that produces pimaricin in S. chattanoogensis. Pim is a biosynthetic gene cluster that produces pimaricin from S. natalensis. Ttm is a biosynthetic gene cluster that produces tetramycin from S. ahygroscopicus. Tetr is a biosynthetic gene cluster that produces tetramycin from S. hygrospinosus. Nys is a biosynthetic gene cluster for the production of nystatin by S. noursei, Amph is a biosynthetic gene cluster that produces amphotericin from S. nodosus. Fsc is a biosynthetic gene cluster for the production of candicidin by S. sp. FR-008. Pte (Fil) is a biosynthetic gene cluster producing filipin from S. avermitilis (S. filipinensis). Cfa is a biosynthetic gene cluster for the production of CFA-L-Ile by S. scabiei. Rdm is a biosynthetic gene cluster that produces reedsmycins from S. sp. CHQ-64. Npp is a biosynthetic gene cluster that produces NPPA1 from P. autotrophica. Mar is a biosynthetic gene cluster that produces PF from S. marokkonensis M10. Sal is a biosynthetic gene cluster that produces salinomycin from S. albus. The symbol of Δ and ❙ represent PAS-LuxR regulators coding genes and binding sites.
2.2. Structure of PAS-LuxR Family Regulators
PAS-LuxR family regulators are a class of proteins containing a PAS-sensing structural domain at the N-terminal and a DBD region at the C-terminal with HTH [17]. PAS monitors light and oxygen changes in redox potential, and cellular energy and is a component of histidine and serine/threonine kinases, chemoreceptors, and photoreceptors that are involved in tropism, biological clock, and ion channels [8]. Unlike other sensing elements, proteins containing the PAS region are located in the cytosol and can directly sense signals inside the cell, while the above proteins can cross the cell membrane to sense signals from the external environment. The DBD region at the C-terminus of the PAS-LuxR family regulators is similar to that of LAL family regulators and is also derived from HTH-LuxR. The PAS-LuxR family regulators are highly conserved and generally consist of 152–243 amino acids, as shown in Figure 3. In its primary structure, the conserved region of PAS region is generally present in 1–130 amino acids, and the conserved amino acid residues are AX LDXXLTIXXANXnDXCGRXFXDXHPSVXQPLXRQFXXLXE. All the HTH structural domains are generally located at 117–221 amino acids, and their conserved amino acid residues are LX3DARILEGIAAGXSTXPLAXXLYLSRQGVEYHVTXLLRKLXVPNRAAL. In the secondary structure shown in Figure 4, all PAS domains contain the PAS core, helical connector, and β-scaffold. PAS core has the highest density of conserved residues in the PAS domain and is the key core region of PAS structure. The helical connector and β-scaffold are less conserved than the PAS core is [18]. The β-scaffold forms a long platform with a characteristic β-sheet that supports the PAS core. As illustrated in Figure 5, each regulator contains at least one HTH structure.
Figure 3.
Sequence comparison of PAS-LuxR family regulatory factors. (a) PAS domain; (b) LuxR family HTH motif. X is an undefined amino acid residue.
Figure 4.
Simulated secondary structures of N-terminal PAS structure of PAS-LuxR family regulators by SWISS-MODEL on https://swissmodel.expasy.org/, accessed on 25 July 2022.
Figure 5.
Simulated secondary structures of C-terminal HTH motif of PAS-LuxR family regulators by SWISS-MODEL on https://swissmodel.expasy.org/, accessed on 25 July 2022.
2.3. Developmental Tree Analysis
The phylogenetic tree was constructed using the neighbour-joining algorithm, and the bootstrap test (Bootstrap) was resampled for 500 times to increase the confidence value of the evolutionary tree. All the PAS-LuxR family regulators were derived from the same ancestor. The overall similarity of the PAS-LuxR family regulatory amino acid sequences was high, but the sequences that generate the same sequences of the same antibiotic still differed.
3. Regulation of Related Product Biosynthesis by PAS-LuxR Family Regulators
PAS-LuxR family regulators play a regulatory role together with the regulators of other families. According to the product structure classification, they can be mainly divided into polyene and nonpolyene macrolides, which are most studied in detail in pimaricin, nystatin, filipin, tetramycin, candicidin (also known as FR008), amphotericin, NppA1, and CFA-L-Ile. However, the regulatory mechanisms of reedsmycin and wuyiencin need to be further determined.
3.1. Regulation of Polyene Macrolide Biosynthesis by PAS-LuxR Family Regulators
3.1.1. Vertical Regulatory System Formed with SARP-LAL and PAS-LuxR Family Regulators
The PAS-LuxR family of regulators was first reported in the pimaricin pathway; a tetraene macrolide produced by S. natalensis ATCC 27448 is also produced by S. chattanoogensis, S. lydicus, and S. gilvosporeus [19]. The pimaricin pathway in S. natalensis involves two positive regulators, namely, the PAS-LuxR family regulator PimM and the SARP-LAL family regulator PimR. PimM affects the biosynthesis of pimaricin by regulating the transcription of PKS genes (pimS0, pimS1, pimS2, pimS3, and pimS4), oxidoreductase genes (pimD, pimF, and pimG), glycosylation genes (pimC, pimJ, and pimK), transporter genes (pimA and pimB), and the thioester hydrolase gene (pimI). However, pimE, pimH, pimM, and pimR are not regulated by PimM. PimR affects pimaricin biosynthesis indirectly by regulating pimM through binding to the site of TGGCAAGAAAGCGGCAGGTGTTCGGCAAG with the heptameric repeats in the promoter of pimM. In combination with the regulatory role of PimM, a vertical regulatory system is formed between the two regulators [20]. The pimaricin biosynthetic gene cluster in S. chattanoogensis has 17 open reading frames, including two regulatory genes, namely, scnRI and scnRII, which correspond to pimR and pimM with sequence identities of 85% and 96%, respectively [21,22,23]. ScnRII also belongs to the PAS-LuxR family. The analysis of ScnRII (192aa) revealed that it has 99% sequence identity with the positive regulator AurJ3M of S. aureofuscus and 96% amino acid similarity with PimM. Genes scnA, scnE, scnD, and scnRII are partially regulated by ScnRI, while scnS1 and scnT are not regulated by ScnRI. ScnRII affects pimaricin biosynthesis by regulating eight genes, namely, scnA, scnE, scnD, scnI, scnJ, scnK, scnS1, and scnS2, which bind to the promoters of the above genes and recruit RNA polymerase to initiate their transcription, forming a vertical regulatory system [24]. Considering the difference in the target genes regulated by PimM and ScnRII, the amino acid sequences of these two regulators were analyzed independently. The results reveal that 186aa out of 192aa are identical. The six amino acid residues that did not match appeared in the PAS structural domain, and the genes within the two gene clusters were not identical, which may account for their different regulatory mechanisms. The SlnM in pimaricin producer S. lydicus A02 is a member of the PAS-LuxR family [25]. The identities of slnM with scnRII and pimM genes are both 96%. However, the identity of SlnM with ScnRII was higher than that with PimM or SgnRII, as indicated by the closer relationship between SlnM and ScnRII in Figure 6. The biosynthetic gene clusters of pimaricin have not been reported in S. gilvosporeus [26].
Figure 6.
Phylogenetic tree of PAS-LuxR family regulators.
Filipin is a 28-membered cyclopentenyl macrolide produced by S. avermitilis, S. filipinensis, and S. miharaensis [27,28,29], of which the most detailed biosynthetic process has been reported in S. avermitilis. Similar to pimaricin, the filipin pathway has two different regulators, namely, the SARP-LAL family regulator PteR and the PAS-LuxR family regulator PteF. PteR is homologous to PimR, while pteF is homologous to PimM. The transcription of all PKS genes (pteA1, pteA2, pteA3, pteA4, and pteA5) are significantly reduced in the pteF-disrupted strain (ΔpteF), in which the expression of pteA3, pteA4, and pteA5 significantly differed, suggesting that pteF has a direct or indirect regulatory effect on these genes [30]. The expression of pteB, pteC, and pteD is also reduced, and the downregulated expression of pteB and pteC was consistent with those of pteA3, pteA4, and pteA5. Therefore, they were cotranscribed as pteA3-A4-A5-B-C, and the promoter of pteA3 was regulated by PteF. By contrast, pteR, pteH, and pteG expression levels were upregulated in ΔpteF compared with those in wild-type strain, suggesting that PteF may be a negative regulator or that the disruption of PteF may activate the negative regulator of the genes. For the two other filipin producers, FilF- FilR and PteF-PteR correspond to the regulator combinations of PimM-PimR. SARP-LAL family regulator PimR can bind to heptameric repeats separated by four nucleotides, TGGCAAGAAAGCGGCAGGTGTTCGGCAAG, at least two protein monomers are required for effective binding, and the bound pimM region does not overlap with the −35 box [31]. Considering the potential site of TGGCAAGAAAGCGGCAGGTGTTCGGCAAG in the promoters of petF and filF, the vertical regulatory system formed with SARP-LAL and PAS-LuxR family regulators in the filipin pathway.
3.1.2. Network Regulatory System Formed with LAL and PAS-LuxR Family Regulators
In comparison with the vertical regulatory system, the PAS-LuxR family regulator may form a network regulatory system with the LAL family regulators in polyene macrolides pathway, such as tetramycin, nystatin, amphotericin, candicidin, and NPP. Tetramycin consists of A and B components and is a 26-membered tetraene macrolide produced by S. ahygroscopicus and S. hygrospinosus, respectively [32,33]. The tetramycin pathway in S. ahygroscopicus contains three LAL family regulators (TtmRI, TtmRII, and TtmRIII) and a PAS-LuxR family regulator (TtmRIV). The glycosylation genes (ttmK and ttmC) and PKS genes (ttmS0, ttmS1, ttmS2, ttmS3, and ttmS4) are fully regulated by TtmRIV. The sterol oxidase gene (ttmE), oxidoreductase genes (ttmG and ttmF), glycosylation gene (ttmJ), transporter genes (ttmA and ttmB), and precursor synthesis gene (ttmP) are partially regulated by TtmRIV. The ttmL, ttmD, ttmRIV, ttmRIII, ttmRII and ttmRI genes are not regulated by TtmRIV. TtmRIV affects the biosynthesis of tetramycin by regulating the transcription of the 14 genes above. TtmRI can directly regulate the transcription of ttmK, ttmC, ttmG, ttmF, ttmS0, ttmS1, ttmRIV, ttmRIII, ttmRII, ttmRI, ttmJ, ttmA, ttmB, and ttmP and indirectly regulate the transcription of ttmE, ttmS2, ttmS3, and ttmS4. TtmRII directly regulates the transcription of ttmG, ttmF, ttmS0, ttmRIV, ttmRIII, ttmRII, and ttmRI and indirectly regulate the transcription of ttmE, ttmK, ttmC, ttmS1, ttmS2, ttmS3, ttmS4, ttmJ, ttmA, ttmB, and ttmP. TtmRIII directly regulates the transcription of ttmE, ttmG, ttmF, ttmS0, ttmS1, ttmRIV, ttmRIII, ttmRII, and ttmRI and indirectly regulate the transcription of ttmK, ttmC, ttmS2, ttmS3, ttmS4, ttmJ, ttmA, ttmB, and ttmP. Hence, a network regulatory system formed with TtmRI, TtmRII, TtmRIII, and TtmRIV regulates the biosynthesis of tetramycin [34].
The pathway of the 38-membered tetraene macrolide nystatin in S. noursei has four regulators, namely, LAL family regulators NysRI, NysRII, and NysRIII, and PAS-LuxR family regulator NysRIV. The transcription of the nysH gene, which is responsible for transport, is not regulated by NysRI, but rather by NysRII, NysRIII, and NysRIV [35]. The transcription of glycosylation genes nysDI and nysDII is not regulated by NysR. The transcription of PKS genes nysA and nysI genes is regulated by NysR. The transcription of nysRI and nysRIV is regulated by all the four regulators, although the degree of regulation differs. The transcription of nysRI is moderately regulated by NysRIII, NysRIV, and NysRI and fully regulated by NysRII. The transcription of nysRIV is moderately regulated by NysRIV and fully regulated by NysRI, NysRII, and NysRIII [35]. The regulation of NysR to the structural genes and the regulatory genes indicated that they form a network regulatory system.
The LAL and PAS-LuxR family regulators are also identified in the candicidin, NppB1, and salinomycin pathway. Candicidin is an heptane macrolide that is produced by S. sp. FR-008 [36]. The candicidin biosynthetic gene cluster involves 21 genes, and four regulatory genes encode the PAS-LuxR family regulator FscRI and the LAL family regulators FscRII, FscRIII, and FscRIV. In ΔfscRI, the RT-PCR results show that the transcriptions of the six PKS genes (fscA, fscB, fscC, fscD, fscE, and fscF), the glycosylation genes (fscMI, fscMII, and fscMIII), and the translocation genes (fscTI and fscTII) were reduced compared with the wild-type strain, suggesting that FscRI regulates the biosynthesis of candicidin by affecting the transcription of all the above genes. FscRII and FscRIII belong to the top of the regulatory network in which FscRII negatively regulates the expression of FscRIII and positively regulates the expression of FscRIV. FscRIII has a positive regulatory effect on FscRI and FscRII. Considering that FscRI can unidirectionally compensate for the deletion of FscRIII and FscRIV, and FscRIV can unidirectionally compensate for the deletion of FscRI, FscRIV can partially replace FscRII, while FscRI can partially replace FscRIII and FscRIV [37]. In addition to the abovementioned genes regulated by fscRI, the transcript of both fscRI and the precursor synthesis gene pabC decreased in ΔfscRIV, suggesting that fscRI and fscRIV have direct or indirect regulatory effects on the above genes and they regulate one another [38]. Therefore, the biosynthesis of candicidin is regulated by the regulatory network formed with the four regulators.
In addition, some type I PKS biosynthetic pathways contain several LAL and PAS-LuxR family regulators, and the relationship between their regulatory roles has not been fully determined. A heptaene macrolide amphotericin is produced by S. nodosus and is commonly used clinically. Four regulators were also identified in the amphotericin pathway, including the three LAL family regulators AmphRI, AmphRII, AmphRIII, and PAS-LuxR family regulator AmphRIV. Tetraene macrolide NPPA1 produced by Pseudonocardia autotrophica is 300-fold more water-soluble and 10-fold less hemolytic than nystatin A1 is, but its antimicrobial activity is 50-fold lower [39]. The increased antimicrobial activity NppB1 was obtained with the inactivation of the enolase structure in the fifth module of its biosynthetic gene nppC, but its yield is less 10% than that of NppA1 [40]. The biosynthetic gene cluster contains six regulatory genes, namely, nppRI, nppRII, nppRIII, nppRIV, nppRV, and nppRVI, of which nppRI, nppRIII, and nppRV encode LAL family regulators, and nppRIV encodes a PAS-LuxR family regulator. The sequence identities of NppRIV with nysRIV and pimM are 45.6% and 45%, respectively [41]. Two LAL family regulators encode genes, salRI and salRII, and PAS-luxR family regulator encode gene salRIII, which is also present in the biosynthetic gene cluster of the polyether ion carrier salinomycin produced by S. albus CCM4719. The sequence identities of salRIII with pteF, fscRI, nysRIV, and amphRIV are 44%, 47%, 48%, and 50%, respectively [42]. PF1 and PF2 are polyene macrolides produced by S. marokkonensis M10, and its structure is similar to that of candicidin. The regulators in the PF1 and PF2 pathway correspond to those of candicidin pathway, a PAS-LuxR family regulator MarRI to FscRI (98% identity), three LAL family regulators MarRII to FscRII (99% identity), MarRIII to FscRIII (97% identity), and MarRIV to FscRIV (97% identity) [43,44]. Although the regulatory mechanisms of PAS-LuxR family and LAL family regulators in the above PKS pathway have not been reported, on the basis of the reported regulatory networks in the biosynthetic pathway of the same kind of substances, several of their regulators also play a similar regulatory role.
3.1.3. Regulatory System Formed with PAS-LuxR and Other Family Regulators
In addition to the regulatory system in Section 3.1.1 and Section 3.1.2, other families’ regulators act in conjunction with PAS-LuxR family regulators. For example, the aureofuscin pathway in S. aureofuscus has two regulators, namely, PAS-LuxR family regulator AurJ3M and RhtB family regulator AurT [45,46]. In the aurJ3M gene deletion strain, RT-PCR results showed that aurB, aurC, aurG, aurF, aurS0, aurS1, and aurD are not transcribed, the transcript levels of aurI, aurJ, and aurA genes are reduced compared with the wild-type strain, and almost no effect was observed on aurR, aurE, aurH, and aurJ3M genes. Therefore, the deletion of aurJ3M has no effect on the transcription of genes located downstream of AurJ3M, and AurJ3M regulates the biosynthesis of aureofuscin by affecting the transcription of the PKS gene aurS0. The amino acid transporter protein AurT regulates the biosynthesis of aureofuscin by affecting the secretion of PI factors [11], whose structural analogs activate the expression of related genes by binding to specific receptors within the gene cluster [47]. Hence, the production of aureofuscin in S. aureofuscus is coregulated by two regulators, namely, AurJ3M and AurT, from different transcription factor families. Reedsmycin is a nonglycosylated polyene macrolide produced by the marine Streptomyces of S. sp. CHQ-64. The antifungal activity of reedsmycin is comparable to that of nystatin in the inhibition of Candida albicans. The reedsmycin pathway has five regulators, namely the XRE family regulator RdmA, LuxR family regulators RdmC, RdmD, RdmE, and PAS-LuxR family regulator RdmF [48]. The regulatory mechanism of RdmF has not been reported.
Table 1.
Information regarding the reported PAS-LuxR family regulators.
| Regulator | Streptomyces | Size (aa) |
Product | Type of Product | Target Genes | Yield in Overexpression Strain | Reference |
|---|---|---|---|---|---|---|---|
| PimM ScnRII SgnRII SlnM |
S. natalensis (S.chattanoogensis) (S.gilvosporeus) (S. lydicus) |
192 | Pimaricin | PM |
pimS0, pimS1, pimB, pimC, pimD, pimF, pimG, pimI, pimJ, pimS2, pimS3, pimS4, pimA, pimK scnA, scnE, scnD, scnI, scnJ, scnK, scnS1, scnS2 |
240–460% | [11,12,19] |
| RdmF | S. sp. CHQ-64 | 233 | Reedsmycins | NG-PM | NR | 250% | [13] |
| CfaR | S. scabiei | 152 | CFA-L-Ile | AAA | cfa1(27kb, from cfa1 to scab79721) | 1000% | [14] |
| WysR |
S. wuyiensis CK-15 |
193 | Wuyiencin | AG | wysE, wysRI, wysRIII | [15] | |
| PteF FilF |
S. avermitilis (S. filipinensis) (S. miharaensis) |
192 | Filipin | PM | pteA1, pteA2, pteA3, pteA4, pteA5, pteB, pteC, pteD, pteH, pteG, pteR | NR | [27,28,29] |
| TtmRIV TetrRIV |
S. ahygroscopicus (S. hygrospinosus) |
201 | Tetramycin | PM | ttmK, ttmC, ttmS0, ttmS1, ttmS2, ttmS3, ttmS4, ttmE, ttmG, ttmF, ttmJ, ttmA, ttmB, ttmP | 333% (Tetramycin A) |
[32,33] |
| NysRIV | S. noursei | 210 | Nystatin | PM | nysH, nysA, nysI, nysRI, nysRIV | NR | [35] |
| FscRI | S. sp. FR-008 | 222 | Candicidin | PM | fscA, fscB, fscC, fscD, fscE, fscF, fscMI, fscMII, fscMIII, fscTI, fscTII | NR | [36] |
| AmphRIV | S. nodosus | 243 | Amphotericin | PM | NR | 400% (in ΔamphNM) |
[39] |
| NppRIV | P. autotrophica | 213 | NPPA1 | PM | NR | −50% | [40] |
| SalRIII | S. albus | 231 | Salinomycin | PIC | NR | NR | [42] |
| MarRI | S. marokkonensis M10 | 148 | PF | PM | NR | NR | [43] |
| AurJ3M | S.aureofuscus | 192 | Aureofuscin | PM | aurB, aurC, aurG, aurF, aurS0, aurS1, aurD, aurI, aurJ, aurA | 600% | [45] |
PM, polyene macrolide; AAA, amino acid analogues; NG-PM, nonglycosylated polyene macrolide; AG, aminoglycoside; PIC, polyether ionic carrier; NR, not reported.
3.2. Regulation of the Nonpolyene Macrolides Biosynthesis by PAS-LuxR Family Regulators
CFA-L-Ile, a phytotoxin, is produced by S. scabies and causes the development of potato blast. The biosynthetic gene cluster of CFA-L-Ile contains 15 genes, and 13 of them are cotranscribed in a multicistron, while the two remaining genes, namely, PAS-LuxR family regulator gene cfaR and partial ThiF family gene orf1, are transcribed in another transcript [14]. The cfaR deletion strain has no or low-level transcripts for cfa5, cfa6, and cfl compared with the wild-type strain. The cotranscribed gene orf1 of cfaR is not affected in any way, indicating that cfaR activates the transcription of approximately 27 kb transcripts from cfa1 to scab79721, but it does not regulate itself. EMSA results show that CfaR only binds to the cfa1 promoter region, further demonstrating that CfaR regulates the CFA-L-Ile pathway directly through a vertical regulatory system [49].
Wuyiencin is an aminoglycoside antibiotic produced by S.wuyiensis CK-15, and a PAS-LuxR gene wysR is present in the biosynthetic gene cluster. Wuyiencin is widely used for fungal control in crops and has low toxicity. The sequencing analysis of WysR (193 amino acids) revealed 84.27% identity with NysRIV and more than 60% identity with other PAS-LuxR family regulatory protein sequences. The transcript levels of wysE (thioesterase), wysRI (LAL family regulator), and wysRIII (DeoR family regulator) were analyzed in the wuyiencin biosynthetic gene cluster, and the results show that the transcript levels of wysRIII and wysE are remarkably lower in wysR deletion strain than that in the wild-type strain, while the transcript levels of wysRI remarkably increased compared with wild-type strains [16]. In the wysR overexpressing strain, the transcript levels of wysRIII and wysE remarkably increased, whereas the transcript levels of wysRI are significantly reduced compared with the wild-type strain [15]. Therefore, WysR directly or indirectly regulates the expression of other potential regulatory genes such as wysRI and wysRIII to affect the transcription of early wuyiencin PKS genes and regulates wysE to affect the late biosynthetic enzymes in wuyiencin production [16]. Moreover, WysR regulates wuyiencin biosynthesis and morphological development by influencing possible regulatory genes such as bld, whi, chp, rd1, and ram family genes, indicating its crucial role in the morphological development [15].
3.3. Regulatory Mechanisms of PAS-LuxR Family Regulators
As the prototype of a PAS-LuxR family regulator, the regulatory mechanism of PimM in pimaricin biosynthesis has been widely studied. PimM affects the transcription of target genes by binding to their promoters [50]. A comprehensive study on PAS-LuxR regulators has been conducted in the biosynthesis of polyene macrolides of pimaricin, nystatin, amphotericin, and filipin. Results show that the expression of amphRIV, nysRIV, or pteF in pimM deletion strains can restore the production of pimaricin. The expression of pimM in S. nodosus and S. avermitilis can increase the yield of amphotericin and filipin, respectively. The expression of pimM in pteF deletion strain can also restore the production of filipin [30]. GST-PimM could bind with the promoters of controlled biosynthetic genes of amphotericin (amphA, amphDI, amphI, amphH, and amphDIII), nystatin (nysA, nysDI, nysI, nysH, and nysDIII), filipin (pteA1), and pimaricin (pimK, pimS2, pimI, pimJ, pimA, pimE, pimS1, and pimD). The binding site of the PAS-LuxR class regulator is located in a 16-bp palindromic conserved sequence 5′-CTVGGGAWWTCCCBAG-3′ (V stands for A, C, or G; W stands for A or T; B stands for C, G or T) [50]. Therefore, PAS-LuxR family proteins are regulators with relatively conserved regulatory functions.
The relatively conserved function of PAS-LuxR family regulators can be attributed to their regulatory role across gene clusters and antibiotic varieties. FscRI can regulate both candicidin and antimycins across gene clusters in S. albus S4. In addition, FscRI is required for the heterologous expression of antimycin biosynthetic gene clusters in S. coelicolor. Notably, the 16 bp binding sites of PAS-LuxR family regulator exist in the promoters of antB2, antB1, and antC, which are important genes in antimycin biosynthesis [51]. The increment of pimM copies increased the production of candicidin and antimycin at the same time in S. albus J1074 [52].
Following the above characteristic sequences, the potential binding sites of unspecified PAS-LuxR family regulators were searched, and the results show similar binding sites in the promoters of nysDIII, nysH, nysI, nysA, nysRI, and nysRIV in the biosynthetic gene cluster of nystatin in S. noursei ATCC 11455, the promoters of amphH, amphI, amphL, amphM, amphDI, amphA, and amphB in the biosynthetic gene cluster of amphotericin in S. nodosus, the promoters of scnK, scnS4, scnS3, scnS2, scnI, scnJ, scnA, scnB, scnE, scnC, scnF, scnS0, scnS1, and scnD in the biosynthetic gene cluster of pimaricin in S. chattanoogensis L10, the promoters of rdmA, rdmC, rdmF, rdmG, rdmH, rdmI, rdmK, rdmL, and rdmN in the biosynthetic gene cluster of reedsmycins in S.sp. strain OUC6819, and the promoters of pteA1 and pteA2 in the biosynthetic gene cluster of filipin in S. avermitilis. The sequence logo is shown in Figure 7. Therefore, the PAS-LuxR family regulators derived from different secondary metabolites in different Streptomyces are functionally conserved and can be substituted for each other.
Figure 7.
Prediction of binding sites of the PAS-LuxR family regulators.
However, these findings were all obtained from different strains. In S. ahygroscopicus, although TtmRIV is present together with NysRIV, when ttmRIV is deleted, tetramycin is no longer produced when nystatin production is enhanced [34]. Similarly, when nysRIV is deleted, nystatin is no longer produced, and tetramycin production is enhanced (unpublished results). Therefore, NysRIV and TtmRIV cannot achieve functional substitution but can exhibit independent and precise regulation in S. ahygroscopicus. Therefore, although TtmRIV and NysRIV belong to the same PAS-LuxR family regulators, their regulatory mechanisms differ. On the basis of the comparison of the amino acid sequences of TtmRIV with other PAS-LuxR family regulators, amino acids at 25–43 aa at the N-terminus of the PAS region of TtmRIV had 19 additional amino acid residues compared with the corresponding positions of other regulators (Figure 8), the same observation was made in the LuxR at the C-terminus. On the basis of the comparison of the secondary structures, the PAS regions of AmphRIV, FscRI, NysRIV, and PimM all contain three α-helices and two β-folded structures in the PAS region, while the PAS region of TtmRIV contains three α-helices and one β-folded structure. Structurally, TtmRIV do not form another β-fold structure because of the 19 additional amino acid residues, indicating that the PAS structure in TtmRIV differs from the normal PAS structure that has been reported. As shown in Figure 9, on the basis of the comparison of the conserved sequence 5′-YVSGGAWWTCCSBR-3′ of the TtmRIV binding sites sequence with the conserved sequence 5’-CTVGGGAWWTCCCBAG-3′ of the PAS-LuxR family regulator binding site sequence reported (Y for C or T; V for A, C or G; S for C or G; W for A or T; B for C, G or T; R for A or G), difference was observed at the −5/4 and −7/6 bases. In S. avermitilis, PteF formed vertical regulatory system with SARP-LAL family regulator in the filipin pathway. In addition, PteF affected the transcriptions of genes related to various metabolic processes, including genetic information processing; DNA, energy, carbohydrate, and lipid metabolism; morphological differentiation; and transcriptional regulation, among others, but were particularly related to 10 potential secondary metabolites [53]. Therefore, the study on the regulatory mechanism of PAS-LuxR family regulators is still incomplete, thus requiring further studies on the presence of two PAS-LuxR family regulators in the same strain without functional crossover for the understanding of the precise regulation of such family regulators.
Figure 8.
Comparison of amino acid sequences in the PAS region. (a), TtmRIV; (b), FscRI; (c), AmphRIV; (d), NysRIV; (e), PimM.
Figure 9.
Sequence logo comparison of TtmRIV and PAS-LuxR family regulon binding sites. (a) Sequence logo of TtmRIV binding sites. (b) Sequence logo of PAS-LuxR family regulator binding sites reported in the literature.
4. Application of PAS-LuxR Family Regulators
PAS-LuxR family regulators influence the biosynthesis of target products by regulating the transcription of target genes. On the basis of this feature, the production of metabolites can be changed by the over-expression of PAS-LuxR family regulator genes in the biosynthetic gene cluster or knocking out them in the non-target gene cluster.
As shown in Table 1, the production of pimaricin is completely eliminated by blocking pimM in S. natalensis. After pimM complementation, pimaricin production could be restored to the wild-type level, and PimM overexpression could reach 2.4 times of the wild-type level. Upon the overexpression of ScnRII in S. chattanoogensis, compared with the wild-type strain, the yield of pimaricin on YSG medium is 3.3 times higher and that of pimaricin on YEME medium is 4.6 times higher. When slnM is overexpressed in S.lydicus, the production rates of pimaricin in the overexpressing strains containing ermEp* promoter, native promoter, and ermEp*- native promoter are 2.4, 1.9, and 3 times higher than those in the wild-type strain, respectively, on the YEME medium without sucrose. On the YSG medium, slnM overexpressing strains containing ermEp*-native promoter produced 2.1 times more pimaricin than wild-type strains do [25].
S. ahygroscopicus produces two polyene macrolides, namely, tetramycin and nystatin. In the ttmRIV deletion strain, nystatin production increased 2.1 times, and a high-production nystatin strain was obtained [46]. When the ttmRIV gene was overexpressed, the yield of tetramycin A was 3.33 times that of the wild-type strain, but the yield of tetramycin B did not change, because the ttmD gene, which is responsible for the transformation of tetramycin A to tetramycin B, is not regulated by TtmRIV. When nysRIV was disrupted, the yield of nystatin was completely eliminated, and the yield of tetramycin increased by 1.28 times. In S. aureofuscus SYAU0709, blocking AurJ3M resulted in stopped the production of aureofuscin, and the overexpression of AurJ3M could increase the production of aureofuscin by six times [54]. The pteF deletion mutant resulted in a 38% loss of filipin yield and delayed spore formation in the starting strain. The complementation of pteF restored the yield to wild-type levels and restored the rate of spore formation. The heterologous complementation of pimM to the deletion mutant strain of pteF fully restored filipin to wild-type levels. The overexpression of the amphRIV gene in the S. nodosus ΔamphNM mutant strain resulted in an approximately three-fold increase in the yield of the related derivative [55]. The loss of rdmF also completely deprives the yield of reedsmycin, in which the level was almost restored to wild-type levels after complementation, and the overexpression of rdmF resulted in 2.5 times increase in reedsmycin yield [33]. PAS-LuxR transcriptional activators share the similarity regulatory pattern. By contrast, the overexpression of NppRIV in the P. autotrophica reduces NPP production [40]. This phenomenon may be related to the different regulatory networks composed of six regulators present in P. autotrophica.
For nonpolyene products, neither ΔcfaRΔPAS nor ΔcfaRΔLuxR produces CFA-L-Ile in S. scabies. cfaR+orf1 overexpression strains produced more than 10 times the yield of cfaR overexpression strains, whereas the overexpression of orf1 alone did not remarkably affect the yield of CFA-L-Ile [49]. wysR gene deletion resulted in the complete disappearance of wuyiencin yield. Subsequently, the wild-type level was restored after complementation, and the overexpression of wysR resulted in an increase in wuyiencin yield with a value that was thrice that of the wild-type yield [15].
Aside from improving the product yield and species, PAS-LuxR family regulators are also used to regulate the heterologous expression of gene clusters. For example, the heterologous expression of antimycin biosynthetic gene clusters in S. coelicolor is required to simultaneously express FscRI and thus activate the antimycin biosynthetic gene clusters. The heterologous expression of AmphRIV, NysRIV, or PteF can restore the production of pimaricin in pimM deletion strains. The expression of PimM can increase the yield of amphotericin and filipin in S. nodosus and S. avermitilis, respectively. The expression of pimM in pteF deletion strain also restored the production of filipin [30]. These findings broaden the potential applications of PAS-LuxR family regulators, such as the activation of silenced gene clusters to obtain new products and the regulation of gene expression from different sources in combinatorial biosynthesis.
5. Conclusions
PAS-LuxR family regulators are a class of regulators that have recently been discovered, and most of them exist in the biosynthetic pathway of PKS type I products. They regulate the transcription of the target gene by binding to the characteristic 5′-CTVGGGAWWTCCCBAG-3′ sequence on the promoters of target genes. Except for PteF, which indirectly affects the morphological differentiation, all other regulators are pathway-specific. When playing regulatory roles, PAS-LuxR family regulators need to cooperate with other family regulators, mainly including the SARP-LAL-PAS-LuxR vertical regulatory system and LAL-PAS-LuxR network regulatory system. In the regulatory system, the PAS-LuxR regulators locate in the core position and have the potential role of corresponding extracellular environment changes, which increase the complexity and accuracy of the regulatory system to ensure the normal metabolism of Streptomyces. The PAS-LuxR family regulator has a similar structure and function that can realize cross-strain inter-replacement. Although the regulatory mechanism of PAS-LuxR family regulator has been widely studied, PAS-LuxR family regulators TtmRIV and NysRIV play independent regulatory functions in S. ahygroscopicus, which is rare, and the precise regulatory mechanism is not clear. Therefore, the regulators of this family need to be further studied. The precise regulation of TtmRIV and NysRIV is the stability factor that maintains S. ahygroscopicus metabolism. Further studies on the independent regulation of PAS-LuxR family regulators in Streptomyces would contribute to a deeper understanding of polyene macrolides biosynthesis of regulation, and more comprehensive understanding of the precise regulation of gene expression in Streptomyces. This study also provides a theoretical foundation for the use of precise regulation to synthesis of new antibiotics by synthetic biology means in the efficiently and directly. Lastly, it may play a positive role in promoting the research and development of new antibiotics.
Author Contributions
Conceptualization, H.C. and H.Z.; methodology, N.Z.; software, Y.D.; validation, N.Z., Y.D. and H.C.; formal analysis, H.Z.; investigation, Y.D.; resources, H.C.; data curation, Y.D.; writing—original draft preparation, N.Z.; writing—review and editing, H.C.; visualization, N.Z.; supervision, H.Z.; project administration, Y.D.; funding acquisition, H.C. All authors have read and agreed to the published version of the manuscript.
Institutional Review Board Statement
Not applicable.
Informed Consent Statement
Not applicable.
Data Availability Statement
Not applicable.
Conflicts of Interest
The authors declare no conflict of interest.
Funding Statement
This work was funded by the Department of Science and Technology of Jilin province, grant number YDZJ202201ZYTS440, the National Natural Science Foundation of China, grant number 81903528, the Program of Jilin Provincial Development and Reform Commission, grant number 2022C043, the Jilin Provincial Department of Education, grant number JJKH2021238KJ, and the Major Scientific Research Foundation of Jilin Institute of Chemical Technology, grant numbers 2020017.
Footnotes
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Clardy J., Fischbach M.A., Walsh C.T. New antibiotics from bacterial natural products. Nat. Biotechnol. 2006;24:1541–1550. doi: 10.1038/nbt1266. [DOI] [PubMed] [Google Scholar]
- 2.Novakova R., Rehakova A., Kutas P., Feckova L., Kormanec J. The role of two SARP family transcriptional regulators in regulation of the auricin gene cluster in Streptomyces aureofaciens CCM 3239. Microbiology. 2011;157:1629–1639. doi: 10.1099/mic.0.047795-0. [DOI] [PubMed] [Google Scholar]
- 3.Wei J., He L., Niu G. Regulation of antibiotic biosynthesis in actinomycetes: Perspectives and challenges. Synth. Syst. Biotechnol. 2018;3:229–235. doi: 10.1016/j.synbio.2018.10.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Bhukya H., Jana A.K., Sengupta N., Anand R. Structural and dynamics studies of the TetR family protein, CprB from Streptomyces coelicolor in complex with its biological operator sequence. J. Struct. Biol. 2017;198:134–146. doi: 10.1016/j.jsb.2017.03.006. [DOI] [PubMed] [Google Scholar]
- 5.Novichkov P.S., Kazakov A.E., Ravcheev D.A., Leyn S.A., Kovaleva G.Y., Sutormin R.A., Kazanov M.D., Riehl W., Arkin A.P., Dubchak I., et al. RegPrecise 3.0—A resource for genome-scale exploration of transcriptional regulation in bacteria. BMC Genom. 2013;14:745. doi: 10.1186/1471-2164-14-745. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Romero-Rodriguez A., Robledo-Casados I., Sanchez S. An overview on transcriptional regulators in Streptomyces. Biochim. Biophys. Acta. 2015;1849:1017–1039. doi: 10.1016/j.bbagrm.2015.06.007. [DOI] [PubMed] [Google Scholar]
- 7.Liu G., Chater K.F., Chandra G., Niu G., Tan H. Molecular regulation of antibiotic biosynthesis in Streptomyces. Microbiol. Mol. Biol. Rev. 2013;77:112–143. doi: 10.1128/MMBR.00054-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Taylor B.L., Zhulin I.B.J.M., Reviews M.B. PAS domains: Internal sensors of oxygen, redox potential, and light. Microbiol. Mol. Biol. Rev. 1999;63:479–506. doi: 10.1128/MMBR.63.2.479-506.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Santos-Aberturas J., Vicente C.M., Guerra S.M., Payero T.D., Martín J.F., Aparicio J.F. Molecular control of polyene macrolide biosynthesis: Direct binding of the regulator PimM to eight promoters of pimaricin genes and identification of binding boxes. J. Boil. Chem. 2011;286:9150–9161. doi: 10.1074/jbc.M110.182428. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Xiong W., Duan Y., Yan X., Huang Y. Improvement of natural product production in Streptomyces by manipulating pathway-specific regulators. Sheng Wu Gong Cheng Xue Bao. 2021;37:2127–2146. doi: 10.13345/j.cjb.200777. [DOI] [PubMed] [Google Scholar]
- 11.Vicente C.M., Santos-Aberturas J., Guerra S.M., Payero T.D., Martin J.F., Aparicio J.F. PimT, an amino acid exporter controls polyene production via secretion of the quorum sensing pimaricin-inducer PI-factor in Streptomyces natalensis. Microb. Cell Fact. 2009;8:33. doi: 10.1186/1475-2859-8-33. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Wang Z. Proceedings of pimaricin biosynthesis. Chin. J. Antibiot. 2012;37:728–732. doi: 10.13461/j.cnki.cja.005071. [DOI] [Google Scholar]
- 13.Yao T., Liu Z., Li T., Zhang H., Liu J., Li H., Che Q., Zhu T., Li D., Li W. Characterization of the biosynthetic gene cluster of the polyene macrolide antibiotic reedsmycins from a marine-derived Streptomyces strain. Microb. Cell Fact. 2018;17:98. doi: 10.1186/s12934-018-0943-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Bignell D.R.D., Seipke R.F., Huguet-Tapia J.C., Chambers A.H., Parry R.J., Loria R. Streptomyces scabies 87-22 contains a coronafacic acid-like biosynthetic cluster that contributes to plant–microbe interactions. Mol. Plant Microbe Interact. 2010;23:161–175. doi: 10.1094/MPMI-23-2-0161. [DOI] [PubMed] [Google Scholar]
- 15.Wei Q., Aung A., Liu B., Ma J., Shi L., Zhang K., Ge B. Overexpression of wysR gene enhances wuyiencin production in DeltawysR3 mutant strain of Streptomyces albulus var. wuyiensis strain CK-15. J. Appl. Microbiol. 2020;129:565–574. doi: 10.1111/jam.14629. [DOI] [PubMed] [Google Scholar]
- 16.Liu Y., Ryu H., Ge B., Pan G., Sun L., Park K., Zhang K. Improvement of Wuyiencin biosynthesis in Streptomyces wuyiensis CK-15 by identification of a key regulator, WysR. J. Microbiol. Biotechnol. 2014;24:1644–1653. doi: 10.4014/jmb.1405.05017. [DOI] [PubMed] [Google Scholar]
- 17.Mizuno T., Tanaka I. Structure of the DNA-binding domain of the OmpR family of response regulators. Mol. Microbiol. 1997;24:665–667. doi: 10.1046/j.1365-2958.1997.3571723.x. [DOI] [PubMed] [Google Scholar]
- 18.Hefti M.H., Francoijs K.J., de Vries S.C., Dixon R., Vervoort J. The PAS fold. A redefinition of the PAS domain based upon structural prediction. Eur. J. Biochem. 2004;271:1198–1208. doi: 10.1111/j.1432-1033.2004.04023.x. [DOI] [PubMed] [Google Scholar]
- 19.Li H.D., Jin Z.H., Zhang H.G., Jin H. Protoplast formation, regeneration and UV mutagenesis of natamycin producing Streptomyces gilvosporeus. J. Ind. Microbiol. Biot. 2008;38:43–46. doi: 10.3969/j.issn.1001-6678.2008.03.009. [DOI] [Google Scholar]
- 20.Santos-Aberturas J., Vicente C.M., Payero T.D., Martin-Sanchez L., Canibano C., Martin J.F., Aparicio J.F. Hierarchical control on polyene macrolide biosynthesis: PimR modulates pimaricin production via the PAS-LuxR transcriptional activator PimM. PLoS ONE. 2012;7:e38536. doi: 10.1371/journal.pone.0038536. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Du Y.L., Chen S.F., Cheng L.Y., Shen X.L., Tian Y., Li Y.Q. Identification of a novel Streptomyces chattanoogensis L10 and enhancing its natamycin production by overexpressing positive regulator ScnRII. J. Microbiol. 2009;47:506–513. doi: 10.1007/s12275-009-0014-0. [DOI] [PubMed] [Google Scholar]
- 22.Du Y.L., Li S.Z., Zhou Z., Chen S.F., Fan W.M., Li Y.Q. The pleitropic regulator AdpAch is required for natamycin biosynthesis and morphological differentiation in Streptomyces chattanoogensis. Microbiology. 2011;157:1300–1311. doi: 10.1099/mic.0.046607-0. [DOI] [PubMed] [Google Scholar]
- 23.Du Y.L., Shen X.L., Yu P., Bai L.Q., Li Y.Q. Gamma-butyrolactone regulatory system of Streptomyces chattanoogensis links nutrient utilization, metabolism, and development. Appl. Environ. Microbiol. 2011;77:8415–8426. doi: 10.1128/AEM.05898-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Sun Z. Master’s Thesis. Zhejiang University; Hangzhou, China: 2013. The Study of the Pathway Specific Regulation of Natamycin Biosynthesis in Streptomyces chattanoogensis. [Google Scholar]
- 25.Wu H., Liu W., Dong D., Li J., Zhang D., Lu C. SlnM gene overexpression with different promoters on natamycin production in Streptomyces lydicus A02. J. Ind. Microbiol. Biotechnol. 2014;41:163–172. doi: 10.1007/s10295-013-1370-7. [DOI] [PubMed] [Google Scholar]
- 26.Wang Y., Tao Z., Zheng H., Zhang F., Long Q., Deng Z., Tao M. Iteratively improving natamycin production in Streptomyces gilvosporeus by a large operon-reporter based strategy. Metab. Eng. 2016;38:418–426. doi: 10.1016/j.ymben.2016.10.005. [DOI] [PubMed] [Google Scholar]
- 27.Ikeda H., Shin-ya K., Omura S. Genome mining of the Streptomyces avermitilis genome and development of genome-minimized hosts for heterologous expression of biosynthetic gene clusters. J. Ind. Microbiol. Biotechnol. 2014;41:233–250. doi: 10.1007/s10295-013-1327-x. [DOI] [PubMed] [Google Scholar]
- 28.Payero T.D., Vicente C.M., Rumbero Á., Barreales E.G., Santos-Aberturas J., de Pedro A., Aparicio J.F. Functional analysis of filipin tailoring genes from Streptomyces filipinensis reveals alternative routes in filipin III biosynthesis and yields bioactive derivatives. Microb. Cell Factories. 2015;14:114. doi: 10.1186/s12934-015-0307-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Kim J.D., Han J.W., Hwang I.C., Lee D., Kim B.S. Identification and biocontrol efficacy of Streptomyces miharaensis producing filipin III against Fusarium wilt. J. Basic Microbiol. 2012;52:150–159. doi: 10.1002/jobm.201100134. [DOI] [PubMed] [Google Scholar]
- 30.Vicente C.M., Santos-Aberturas J., Payero T.D., Barreales E.G., de Pedro A., Aparicio J.F. PAS-LuxR transcriptional control of filipin biosynthesis in S. avermitilis. Appl. Microbiol. Biotechnol. 2014;98:9311–9324. doi: 10.1007/s00253-014-5998-7. [DOI] [PubMed] [Google Scholar]
- 31.Barreales E.G., Vicente C.M., de Pedro A., Santos-Aberturas J., Aparicio J.F. Promoter Engineering Reveals the Importance of Heptameric Direct Repeats for DNA Binding by Streptomyces Antibiotic Regulatory Protein-Large ATP-Binding Regulator of the LuxR Family (SARP-LAL) Regulators in Streptomyces natalensis. Appl. Environ. Microbiol. 2018;84:e00246-18. doi: 10.1128/AEM.00246-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Cui H., Ni X., Liu S., Wang J., Sun Z., Ren J., Su J., Chen G., Xia H. Characterization of three positive regulators for tetramycin biosynthesis in Streptomyces ahygroscopicus. FEMS Microbiol. Lett. 2016;363:fnw109. doi: 10.1093/femsle/fnw109. [DOI] [PubMed] [Google Scholar]
- 33.Cao B., Yao F., Zheng X., Cui D., Shao Y., Zhu C., Deng Z., You D. Genome mining of the biosynthetic gene cluster of the polyene macrolide antibiotic tetramycin and characterization of a P450 monooxygenase involved in the hydroxylation of the tetramycin B polyol segment. Chembiochem. 2012;13:2234–2242. doi: 10.1002/cbic.201200402. [DOI] [PubMed] [Google Scholar]
- 34.Cui H., Ni X., Shao W., Su J., Su J., Ren J., Xia H. Functional manipulations of the tetramycin positive regulatory gene ttmRIV to enhance the production of tetramycin A and nystatin A1 in Streptomyces ahygroscopicus. J. Ind. Microbiol. Biotechnol. 2015;42:1273–1282. doi: 10.1007/s10295-015-1660-3. [DOI] [PubMed] [Google Scholar]
- 35.Sekurova O.N., Brautaset T., Sletta H., Borgos S.E., Jakobsen M.O., Ellingsen T.E., Strom A.R., Valla S., Zotchev S.B. In vivo analysis of the regulatory genes in the nystatin biosynthetic gene cluster of Streptomyces noursei ATCC 11455 reveals their differential control over antibiotic biosynthesis. J. Bacteriol. 2004;186:1345–1354. doi: 10.1128/JB.186.5.1345-1354.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Chen S., Huang X., Zhou X., Bai L., He J., Jeong K.J., Lee S.Y., Deng Z. Organizational and mutational analysis of a complete FR-008/candicidin gene cluster encoding a structurally related polyene complex. Chem. Biol. 2003;10:1065–1076. doi: 10.1016/j.chembiol.2003.10.007. [DOI] [PubMed] [Google Scholar]
- 37.Zhu Y., Xu W., Zhang J., Zhang P., Zhao Z., Sheng D., Ma W., Zhang Y.Z., Bai L., Pang X. A Hierarchical Network of Four Regulatory Genes Controlling Production of the Polyene Antibiotic Candicidin in Streptomyces sp. Strain FR-008. Appl. Environ. Microbiol. 2020;86:e00055-20. doi: 10.1128/AEM.00055-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Zhang P., Zhao Z., Li H., Chen X.L., Deng Z., Bai L., Pang X. Production of the antibiotic FR-008/candicidin in Streptomyces sp. FR-008 is co-regulated by two regulators, FscRI and FscRIV, from different transcription factor families. Microbiology. 2015;161:539–552. doi: 10.1099/mic.0.000033. [DOI] [PubMed] [Google Scholar]
- 39.Kim H.J., Han C.Y., Park J.S., Oh S.H., Kang S.H., Choi S.S., Kim J.M., Kwak J.H., Kim E.S. Nystatin-like Pseudonocardia polyene B1, a novel disaccharide-containing antifungal heptaene antibiotic. Sci. Rep. 2018;8:13584. doi: 10.1038/s41598-018-31801-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Jeon H.G., Seo J., Lee M.J., Han K., Kim E.S. Analysis and functional expression of NPP pathway-specific regulatory genes in Pseudonocardia autotrophica. J. Ind. Microbiol. Biotechnol. 2011;38:573–579. doi: 10.1007/s10295-011-0939-2. [DOI] [PubMed] [Google Scholar]
- 41.Han C.Y., Jang J.Y., Kim H.J., Choi S., Kim E.S. Pseudonocardia strain improvement for stimulation of the disugar heptaene Nystatin-like Pseudonocardia polyene B1 biosynthesis. J. Ind. Microbiol. Biotechnol. 2019;46:649–655. doi: 10.1007/s10295-019-02149-7. [DOI] [PubMed] [Google Scholar]
- 42.Knirschová R., Nováková R., Fecková L., Timko J., Turňa J., Bistáková J., Kormanec J. Multiple regulatory genes in the salinomycin biosynthetic gene cluster of Streptomyces albus CCM 4719. Folia Microbiol. 2007;52:359–365. doi: 10.1007/BF02932090. [DOI] [PubMed] [Google Scholar]
- 43.Chen L., Lai Y.M., Yang Y.L., Zhao X. Genome mining reveals the biosynthetic potential of the marine-derived strain Streptomyces marokkonensis M10. Synth. Syst. Biotechnol. 2016;1:56–65. doi: 10.1016/j.synbio.2016.02.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Tang J., Liu X., Peng J., Tang Y., Zhang Y. Genome sequence and genome mining of a marine-derived antifungal bacterium Streptomyces sp. M10. Appl. Microbiol. Biotechnol. 2015;99:2763–2772. doi: 10.1007/s00253-015-6453-0. [DOI] [PubMed] [Google Scholar]
- 45.Yang J., Xu D., Yu W., Hao R., Wei J. Regulation of aureofuscin production by the PAS-LuxR family regulator AurJ3M. Enzym. Microb. Technol. 2020;137:109532. doi: 10.1016/j.enzmictec.2020.109532. [DOI] [PubMed] [Google Scholar]
- 46.Wei J., Meng X., Wang Q. Enhanced production of aureofuscin by over-expression of AURJ3M, positive regulator of aureofuscin biosynthesis in Streptomyces aureofuscus. Lett. Appl. Microbiol. 2011;52:322–329. doi: 10.1111/j.1472-765X.2011.03003.x. [DOI] [PubMed] [Google Scholar]
- 47.Wei J., Yu W., Hao R., Yang J., Xu D., Gao J.J. Regulatory effect and mechanism of aurT gene on biosynthesis of aureofuscin. Food. Sci. Technol. Mys. 2021;39:70–77. doi: 10.12301/j.issn.2095-6002.2021.01.008. [DOI] [Google Scholar]
- 48.Han X., Liu Z., Zhang Z., Zhang X., Zhu T., Gu Q., Li W., Che Q., Li D. Geranylpyrrol A and Piericidin F from Streptomyces sp. CHQ-64 DeltardmF. J. Nat. Prod. 2017;80:1684–1687. doi: 10.1021/acs.jnatprod.7b00016. [DOI] [PubMed] [Google Scholar]
- 49.Cheng Z., Bown L., Tahlan K., Bignell D.R. Regulation of coronafacoyl phytotoxin production by the PAS-LuxR family regulator CfaR in the common scab pathogen Streptomyces scabies. PLoS ONE. 2015;10:e0122450. doi: 10.1371/journal.pone.0122450. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Santos-Aberturas J., Payero T.D., Vicente C.M., Guerra S.M., Canibano C., Martin J.F., Aparicio J.F. Functional conservation of PAS-LuxR transcriptional regulators in polyene macrolide biosynthesis. Metab. Eng. 2011;13:756–767. doi: 10.1016/j.ymben.2011.09.011. [DOI] [PubMed] [Google Scholar]
- 51.McLean Thomas C., Hoskisson Paul A., Seipke Ryan F. Coordinate Regulation of Antimycin and Candicidin Biosynthesis. mSphere. 2016;1:e00305-16. doi: 10.1128/mSphere.00305-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Olano C., García I., González A., Rodriguez M., Rozas D., Rubio J., Sánchez-Hidalgo M., Braña A.F., Méndez C., Salas J.A. Activation and identification of five clusters for secondary metabolites in Streptomyces albus J1074. Microb. Biotechnol. 2014;7:242–256. doi: 10.1111/1751-7915.12116. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Vicente C.M., Payero T.D., Rodríguez-García A., Barreales E.G., Pedro A.d., Santos-Beneit F., Aparicio J.F.J.A. Modulation of multiple gene clusters’ expression by the PAS-LuxR transcriptional regulator PteF. Antibiotics. 2022;11:994. doi: 10.3390/antibiotics11080994. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Sweeney P., Murphy C.D., Caffrey P. Exploiting the genome sequence of Streptomyces nodosus for enhanced antibiotic production. Appl. Microbiol. Biotechnol. 2016;100:1285–1295. doi: 10.1007/s00253-015-7060-9. [DOI] [PubMed] [Google Scholar]
- 55.Kim B.G., Lee M.J., Seo J., Hwang Y.B., Lee M.Y., Han K., Sherman D.H., Kim E.S. Identification of functionally clustered nystatin-like biosynthetic genes in a rare actinomycetes, Pseudonocardia autotrophica. J. Ind. Microbiol. Biotechnol. 2009;36:1425–1434. doi: 10.1007/s10295-009-0629-5. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
Not applicable.









