Abstract
Giardia duodenalis is a protozoan parasite that infects humans, companion animals, livestock, and wildlife. Infections in cattle caused by this parasite are often asymptomatic, but such infections can cause diarrhea, reduced weight gain, and ill-thrift in young calves. Although G. duodenalis causes diarrhea in calves, only a few studies have been conducted on calves in the Republic of Korea (ROK). Here, we aimed to determine the prevalence and distribution of G. duodenalis assemblages in pre-weaned calves with diarrhea in the ROK, identify the association between the occurrence of G. duodenalis and the age of calf, and perform molecular characterization of G. duodenalis. We collected 455 fecal samples from pre-weaned native Korean calves (≤60 days old) with diarrhea in four different regions. G. duodenalis was detected using nested PCR targeting the beta-giardin (bg) gene, and positive samples were further genotyped for the glutamate dehydrogenase (gdh) and triosephosphate isomerase (tpi) genes. The overall prevalence of G. duodenalis in calves with diarrhea was 4.4% (20/455) based on the analysis of bg. The highest prevalence was observed in calves aged 11−30 days (7.5%; 95% confidence interval: 3.7%–11.3%), whereas the lowest prevalence was observed in neonatal calves. From the 20 samples that were positive for bg, 16, 5, and 6 sequences were obtained following genotyping of bg, gdh, and tpi, respectively. Sequencing analysis of the bg gene revealed the presence of assemblage E (n = 15) and sub-assemblage AⅠ (n = 1) in the samples. Moreover, we detected mixed infections with assemblages E and A in two calves for the first time. Among the sequences obtained herein, two new subtypes of assemblage E were detected in gdh and tpi sequences each. The results suggest that G. duodenalis is an infectious agent causing diarrhea in calves, and pre-weaned calves are at a higher risk of infection than neonatal calves. Multilocus genotyping should be performed to confirm the presence of potentially zoonotic genotypes. These results highlight the importance of cattle as a source of zoonotic transmission of G. duodenalis to humans.
Introduction
Giardia duodenalis is a zoonotic enteric protozoan parasite that can infect a wide range of animals, including humans [1]. G. duodenalis infection in humans and animals causes watery diarrhea, malabsorption, and weight loss and may result in death in extreme cases [2, 3]. This parasite is mainly transmitted via the fecal−oral route or via the ingestion of cyst-contaminated food or water; moreover, it can be transmitted through direct contact with infected animals [4]. G. duodenalis is currently classified into eight host-specific assemblages (A−H) based on molecular characterization. Assemblages A and B are zoonotic and have broad host ranges, which include livestock, companion animals, and humans, whereas assemblages C−H have the following specific hosts: C and D in canids, E in livestock, F in felids, G in rodents, and H in marine mammals [3, 5]. Assemblage E is the dominant genotype in hoofed farm animals, such as pigs, sheep, goats, and cattle, and recent studies have also identified this assemblage in humans in Australia, Brazil, and Egypt [6–8], highlighting potential zoonotic transmission.
Giardia duodenalis is an important pathogen in young calves and causes diarrhea and ill-thrift, leading to enormous economic loss in the livestock industry [9–12]. Its worldwide prevalence ranges from 5% to 55.4%, as determined using molecular analysis [13]. Meanwhile, its prevalence in farms varies between 45% and 100% [11]. Notably, cattle are known to be potential reservoir of human infections, increasing the public health significance of G. duodenalis infection in cattle, which excrete high numbers of cysts into the environment. Assemblages A, B, and E have been identified in cattle to date [1, 14, 15], with assemblage E being the most prevalent [16]. Assemblages A and B are further divided into three (AI, AII, and AIII) and two (BIII and BⅣ) sub-assemblages, respectively, that are genetically similar and closely associated with each other [17]. A recent study reported the presence of 34 subtypes within assemblage E based on the analysis of the beta-giardin (bg) gene [18]. In particular, assemblage E is characterized by a high degree of genetic variation [15, 19, 20]. However, studies identifying the subtypes of assemblage E remain insufficient [19, 21–23]. In addition, the phylogenetic tree-based nomenclature for the subtypes of assemblage E is ambiguous.
For the detection and molecular characterization of G. duodenalis, several studies have involved the targeting of various genes, such as the small subunit rRNA (SSU rRNA), bg, glutamate dehydrogenase (gdh), and triosephosphate isomerase (tpi) genes [3, 12]. These genes can be used to differentiate between assemblages involved in mixed infections [3, 24]. Although G. duodenalis is known to cause diarrhea in calves, only few studies have been conducted in the Republic of Korean (ROK) regarding its prevalence, relationship with diarrhea, genotyping, and intra-assemblage variation [25–28]. Therefore, the present study aimed to determine the prevalence and distribution of G. duodenalis assemblages in calves with diarrhea in the ROK, identify the association between the occurrence of G. duodenalis infection and the age of calf, and assess the genotypes within assemblage E based on the analysis of three genes.
Materials and methods
Ethics statement
All animal procedures were conducted according to ethical guidelines for the use of animal samples and were approved by the Jeonbuk National University (Institutional Animal Care and Use Committee Decision No. CBNU 2020–052). All procedures and possible consequences were explained to the managers of the surveyed farm, and written consent was obtained.
Sample collection
From August 2019 to February 2022, fecal samples were collected from 455 individual pre-weaned native Korean calves aged ≤60 days. The fecal samples were divided into three groups according to the age of the calves: 1−10 days (n = 219), 11−30 days (n = 186), and 31−60 days (n = 50). Fecal samples were collected from four different regions (Gyeonggi, Jeonbuk, Gyeongbuk, and Gyeongnam provinces) in the ROK. These fecal samples were directly collected from the rectum of each diarrheic calf by a veterinarian using sterile disposal latex glove into a specimen cup, labeled, placed onto ice, and transported to the laboratory in Kyungpook National University as soon as possible. For each animal, age, gender, geographical location, sampling date, and fecal consistency were recorded. The number of samples collected in different seasons were as follows: spring (n = 98), summer (n = 135), fall (n = 150), and winter (n = 72). Each animal was sampled only once during the study period. Before DNA extraction, all samples were stored at −20°C.
DNA extraction and polymerase chain reaction (PCR)
Genomic DNA was extracted from 100−200 mg of each fecal sample using the AccuPrep® Stool DNA Extraction Kit (Bioneer, Daejeon, ROK) in accordance with the manufacturer’s instructions. These DNA extracts were frozen at −20°C until further analysis. The samples were first screened for G. duodenalis using nested PCR targeting the bg gene, and the positive samples were further analyzed for the gdh, and tpi genes. Information regarding each primer is listed in Table 1. bg was amplified under different annealing temperatures in the primary and secondary PCRs as follows: 94°C for 15 min; followed by 35 cycles of 95°C for 30 s, 65°C and 55°C for 30 s for primary and secondary PCRs, respectively, and 72°C for 60 s; and a final extension at 72°C for 7 min. The PCR conditions for gdh were as follows: 94°C for 2 min; followed by 35 cycles of 95°C for 30 s, 58°C for 30 s, and 72°C for 60 s; and a final extension of 72°C for 7 min. tpi was amplified under the following conditions: 94°C for 5 min; followed by 35 cycles of 94°C for 45 s, 50°C for 45 s, and 72°C for 60 s; and a final extension at 72°C for 10 min. Distilled water was used as a negative control in all PCRs. Amplified PCR products were visualized on 1.5% agarose gels stained with ethidium bromide.
Table 1. Primers used to amplify bg, gdh, and tpi.
| Gene | Primer | Sequence (5′–3′) | Annealing temp. (°C) | Ampliconsize (bp) |
|---|---|---|---|---|
| bg | G7F | AAGCCCGACGACCTCACCCGCAGTGC | 65 | 753 |
| G759R | GAGGCCGCCCTGGATCTTCGAGACGAC | |||
| G7nF | GAACGAACGAGATCGAGGTCCG | 55 | 511 | |
| G759nR | CTCGACGAGCTTCGTGTT | |||
| gdh | GDH1 | TTCCGTRTYCAGTACAACTC | 55 | 754 |
| GDH2 | ACCTCGTTCTGRGTGGCGCA | |||
| GDH3 | ATGACYGAGCTYCAGAGGCACGT | 520 | ||
| GDH4 | GTGGCGCARGGCATGATGCA | |||
| tpi | AL3543 | AAATIATGCCTGCTCGTCG | 50 | 605 |
| AL3546 | CAAACCTTITCCGCAAACC | |||
| AL3544 | CCCTTCATCGGIGGTAACTT | 532 | ||
| AL3545 | GTGGCCACCACICCCGTGCC |
Sequencing and phylogenetic analysis
All secondary PCR amplicons were purified using an AccuPrep® PCR Purification Kit (Bioneer, Daejeon, ROK) according to the manufacturer’s instructions. The purified amplicons were used for direct sequencing (Macrogen, Daejeon, ROK), and the resulting sequences were aligned using BioEdit software. The aligned sequences were compared with the reference sequences from GenBank to identify G. duodenalis assemblages. Samples that yielded bg, tpi, and gdh amplicons were further analyzed via multilocus genotyping (MLG) to reveal their genetic diversity. If one or more variants were detected using MLG, then the sequence was referred to as a novel sequence subtype [16, 18–20, 29].
Phylogenetic analysis based on each gene was conducted using the maximum-likelihood method implemented in MEGA11 using the best substitution model. Bootstrap values were calculated by analyzing 1,000 replicates to evaluate the reliability of clusters. The models used in this study were Tamura-Nei 93 (TN93) for bg and tpi, and Tamura-3-parameter (T92) for gdh. Novel sequence subtypes were identified, and these sequences were named according to previous studies [14, 19].
Statistical analysis
Data were analyzed using the SPSS package version 26 (IBM Corp.; Armonk, NY, USA). Chi-square test was used to determine the association between the prevalence of G. duodenalis and each age group (i.e., 1−10, 11−30, or 31−60 days). P < 0.05 was considered statistically significant.
Nucleotide sequence accession numbers
The nucleotide sequences obtained in the present study have been deposited in the GenBank database under the accession numbers: ON677352−ON677367 for bg, OP271725−OP271729 for gdh, and OP271719−OP271724 for tpi.
Results
Prevalence of G. duodenalis
The overall prevalence of G. duodenalis in pre-weaned calves with diarrhea was 4.4% (20/455) based on the analysis of bg. According to the regions, the highest and lowest prevalence of G. duodenalis was observed in Gyeongnam (6.6%) and Gyeonggi (2.5%) provinces, respectively (Table 2). However, this regional difference was not statistically significant. Based on the age group of calves, G. duodenalis was the most prevalent in calves aged 11–30 days (7.5%; 95% confidence interval [CI]: 3.7%–11.3%), followed by those aged 31–60 days (6%; 95% CI: 0%–12.6%) and 1–10 days (1.4%; 95% CI: 0%–2.9%) (Table 3). The G. duodenalis infection rate in calves aged 11−60 days was significantly higher than that in neonatal calves aged 1−10 days (χ2 = 9.417, P = 0.009). G. duodenalis was found to be associated with diarrhea in pre-weaned calves but not in neonatal calves.
Table 2. Prevalence and subtypes of G. duodenalis among pre-weaned calves according to region.
| Region | No. of positive samples | Prevalence (95% CI) | No. of subtypes a (No. of sequenced sample) | MLG |
|---|---|---|---|---|
| Gyeonggi (n = 40) | 1 | 2.5% (0.0%−7.3%) | AI (0), E1 (0), E3 (1), E5 (0), E11 (0) | |
| Jeonbuk (n = 273) | 10 | 3.7% (1.4%–5.9%) | AI (0), E1 (3), E3 (3), E5 (3), E11 (0) | MLG-E1 (1), MLG-E2 (1) |
| Gyeongnam (n = 91) | 6 | 6.6% (1.5%–11.7%) | AI (1), E1 (0), E3 (1), E5 (0), E11 (4) | |
| Gyeongbuk (n = 51) | 3 | 5.9% (0.0%–12.3%) | – | |
| Total (n = 455) | 20 | 4.4% (2.5%–6.3%) | AI (1), E1 (3), E3 (5), E5 (3), E11 (4) | E1 (1), E2 (1) |
“a”: subtype based on the bg locus.
“−”: none of the samples sequenced.
Table 3. Prevalence of G. duodenalis among pre-weaned calves with diarrhea according to age.
| Age (days) | No. of samples | No. of positive samples | χ2 (P-value) |
|---|---|---|---|
| 1−10 | 219 | 3 (1.4%) | 9.417 (0.009) |
| 11−30 | 186 | 14 (7.5%) | |
| 31−60 | 50 | 3 (6.0%) | |
| Total | 455 | 20 (4.4%) |
Subtypes of assemblages A and E
From the 20 samples that were positive for bg, 16, 5, and 6 sequences were obtained following genotyping of bg, gdh, and tpi, respectively. The sequence analysis of these genes revealed that G. duodenalis in our samples consisted of assemblages A and E (Table 4); this result was confirmed by phylogenetic tree of each gene (Figs 1–3). Assemblage E was more prevalent than assemblage A in pre-weaned calves with diarrhea. Moreover, the distribution of subtypes varied by region, with the E3 subtype detected in three regions (Table 2). Sequence analysis of the bg locus showed the presence of assemblage E (n = 15) and A (n = 1) in the samples. Further subtype analysis revealed that assemblage A was classified into sub-assemblage AI, whereas assemblage E were divided into the four subtypes, E1 (n = 3), E3 (n = 5), E5 (n = 3), and E11 (n = 4) (Table 5). We detected no novel bg subtype, and the subtypes detected were identical to those reported in a previous study [27]. Sequencing analysis at the gdh locus revealed the presence of five subtypes: of these, AI (n = 1), E1 (n = 1), and E12 (n = 1) were previously known, and E45 (n = 1) and E46 (n = 1) were identified as two novel subtypes (Table 6). Based on the analysis of the tpi locus, two and four sequences belonging to assemblages A and E, respectively, were identified. These assemblages consisted of three previously reported subtypes, namely AI (n = 2), E11 (n = 1), and E24 (n = 1). The remaining two sequences were novel subtypes, named as E57 (n = 1) and E58 (n = 1) (Table 7). Overall, our results revealed a higher prevalence of assemblage E than assemblage A in pre-weaned calves.
Table 4. Multilocus genotyping of G. duodenalis identified in this study based on three loci.
| Sample ID | MLG | Genotype | ||
|---|---|---|---|---|
| bg | gdh | tpi | ||
| JB7_33d* | MLG-E1 | E5 | E12 | E57a |
| JB10_33d | MLG-E2 | E5 | E1 | E58a |
| JB34_30d | E3 | − | + | |
| JB12_15d | E3 | − | − | |
| GB1_30d | E3 | − | E24 | |
| JB16_3d | E1 | − | − | |
| JB3_30d | E1 | − | E11 | |
| JB6_10d | E3 | N/A | N/A | |
| JB4_30d | E1 | + | − | |
| GN25_13d | E11 | E45b | + | |
| GN22_13d | E11 | − | + | |
| GN24_17d (Mixed A+E) | E11 | − | AI | |
| GN27_20d | AI | AI | + | |
| GN53_12d (Mixed A+E) | E3 | − | AI | |
| GN56_11d | E11 | E46b | + | |
| JB2_22d | E5 | + | − | |
| Sequenced samples | 16 | 5 | 6 | |
“+”: PCR positive but sequencing is not good.
“−”: not detected.
“N/A”: not tested.
“*”: day.
“a, b”: novel subtype.
Fig 1. Phylogenetic analysis based on bg of Giardia duodenalis using the Maximum-likelihood method with Tamura-Nei (TN93) model.
The numbers over branches indicate bootstrap values as a percentage of 1000 replicates that support each phylogenetic branch. Only bootstrap values >70% are shown. G. duodenalis sequences identified in this study are indicated by a bold circle symbol.
Fig 3. Phylogenetic analysis based on tpi of Giardia duodenalis using the Maximum-likelihood method with Tamura-Nei (TN93) model.
The numbers over branches indicate bootstrap values as a percentage of 1000 replicates that support each phylogenetic branch. Only bootstrap values >70% are shown. G. duodenalis sequences identified in this study are indicated by a bold circle symbol.
Table 5. Sequence variations in the bg locus of G. duodenalis assemblage E among pre-weaned calves in the ROK.
| Subtype | Sample | Nucleotide at position | |||
|---|---|---|---|---|---|
| 117 | 222 | 324 | 465 | ||
| Ref. | DQ116624 | T | A | C | T |
| E1 | JB16_3d* | T | A | T | T |
| JB3_30d* | T | A | T | T | |
| JB4_30d* | T | A | T | T | |
| E3 | JB34_30d* | T | A | C | C |
| JB12_15d* | T | A | C | C | |
| GB1_30d* | T | A | C | C | |
| JB6_10d* | T | A | C | C | |
| GN53_12d* | T | A | C | C | |
| E5 | JB7_33d* | C | A | C | T |
| JB2_22d* | C | A | C | T | |
| JB10_30d* | C | A | C | T | |
| E11 | GN25_13d* | T | G | C | C |
| GN22_13d* | T | G | C | C | |
| GN24_17d* | T | G | C | C | |
| GN56_11d* | T | G | C | C | |
“*”: sequences obtained in this study.
Table 6. Sequence variations in the gdh locus of G. duodenalis assemblage E among pre-weaned calves in the ROK.
| Subtype | Sample | Nucleotide at position | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 271 | 277 | 418 | 440 | 454 | 463 | 508 | 538 | 589 | 591 | 608 | ||
| Ref. | KX813711 | G | A | G | C | G | T | T | T | T | G | A |
| E1 | JB10_30d* | G | A | T | C | G | T | T | T | T | G | G |
| E12 | JB7_33d* | G | G | G | C | G | T | T | T | T | G | G |
| E45a | GN25_13d* | G | G | T | C | A | T | T | T | T | A | G |
| E46a | GN56_11d* | A | A | T | A | G | C | C | C | A | G | G |
“*”: sequences obtained in this study.
“a”: novel subtype.
Table 7. Sequence variations in the tpi locus of G. duodenalis assemblage E among pre-weaned calves in the ROK.
| Subtype | Sample | Nucleotide at position | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| 26 | 28 | 32 | 88 | 98 | 113 | 313 | 320 | 331 | 357 | ||
| Ref. | DQ157270 | T | T | C | T | C | C | T | G | G | C |
| E11 | JB3_30d* | C | C | G | T | T | C | T | G | A | C |
| E24 | GB1_30d* | C | C | G | T | C | C | T | G | A | C |
| E57a | JB7_33d* | C | C | G | T | C | C | T | A | A | C |
| E58a | JB10_30* | C | C | G | G | T | A | C | G | A | A |
“*”: sequences obtained in this study.
“a”: novel subtype.
Fig 2. Phylogenetic analysis based on gdh of Giardia duodenalis using the Maximum-likelihood method with Tamura-3-parameter (TN92) model.
The numbers over branches indicate bootstrap values as a percentage of 1000 replicates that support each phylogenetic branch. Only bootstrap values >70% are shown. G. duodenalis sequences identified in this study are indicated by a bold circle symbol.
Multilocus genotypes of G. duodenalis
Of the 16 samples, only two assemblage E-positive samples yielded amplicons from all three loci, and these were named MLG-E1 and MLG-E2. These two (MLG-E1 and MLG-E2) were found in calves aged 30 and 33 days, respectively, in Jeonbuk province (Table 4). Seven samples yielded amplicons from two loci (Table 4), with high degrees of genetic heterogeneity within each gene fragment. The tpi locus contained more polymorphic regions than the other two loci (Table 7). Interestingly, two samples showed discordant genotyping results among two loci (bg and tpi), indicating mixed infections involving assemblages A and E (Table 4). Mixed infections were found in 12- and 17-day-old calves from Gyeongnam province. This is the first study to report mixed infections in calves in the ROK.
Discussion
This study showed that the prevalence of G. duodenalis was relatively low compared with the results of previous studies in the ROK [25, 27, 30–32]. Moreover, the infection rate of G. duodenalis was considerably lower than that reported globally [3, 13, 33, 34]. These variations may be attributed to the differences in geographical location, age, sample size, sampling period, management systems of farms, and detection method. Analysis of the SSU rRNA gene provides the highest sensitivity and has been commonly used for the detection of G. duodenalis; however, the sequence information obtained using this gene might be inadequate for the accurate identification of assemblages [3]. In contrast, analysis of bg is appropriate for the detection and multilocus genotyping of G. duodenalis. Most of all, the primary reason for the low prevalence of G. duodenalis in this study may be the implementation of improved management practices, such as the provision of clean water, disinfection, and hygiene (frequent removal of feces) in the farms involved in this study. In general, Giardia is associated with low hygiene conditions [35, 36]. Unlike farms using the old management systems, current livestock farms are larger and more specialized; thus, the management system in the ROK is highly focused on animal health.
The results of the present study revealed that the prevalence of G. duodenalis was different across regions, although its prevalence was not statistically significant. The highest infection rate of G. duodenalis was observed in Gyeongnam province in the southern part of the country. This may be because the occurrence of G. duodenalis is associated with climate, and due to climate change, the climate of the ROK has become increasingly hot and humid, particularly in the south. Cysts of Giardia are highly resistant to humid conditions [37, 38], and this may allow them to survive longer in the south [37–39]. It is possible that the high prevalence of G. duodenalis in this south is due to factors associated with climate; however, further studies are needed to evaluate the relationship between survival of G. duodenalis and environmental conditions.
The association between the prevalence of G. duodenalis and age of calves has been reported in several studies [27, 28, 40]. These reports indicate that G. duodenalis is relatively more prevalent in calves aged >1 month. However, our findings showed that the prevalence of G. duodenalis was the highest in calves aged 11–30 days. This finding is consistent with that of other studies that revealed significantly higher prevalence of G. duodenalis in young calves than in older animals [41–43]. Interestingly, the lowest infection rate of G. duodenalis was detected in neonatal calves and this result was consistent with our previous findings [27]. As the criteria for age classification in this study differed from that of a previous study [27], no firm conclusions could be drawn. However, our results strongly suggest that pre-weaned calves are at a higher risk of G. duodenalis infection than neonatal calves. The role of G. duodenalis as a primary cause of diarrhea remains controversial. Nevertheless, giardiasis is a condition that essentially leads to alterations in the microvilli, including a decreased crypt to villus ratio and brush border enzyme deficiencies [11], resulting in malabsorption, ill-thrift, and diarrhea. These results indicate that G. duodenalis should be considered as a causative agent of diarrhea, particularly in pre-weaned calves.
Our findings revealed that assemblage E is the most predominant in the ROK. This result is consistent with the findings of our previous study [28] and those of other studies [13, 41, 44, 45]. Currently, assemblage E is considered to have the potential of a zoonotic transmission. However, it has not yet been identified in humans in the ROK. Assemblage A, also identified in the present study, is capable of zoonotic transmission and is classified into three subtypes, AI, AII, and AIII, which have been mainly reported in livestock, humans, and wildlife, respectively [12]. Sub-assemblage AI is not only found in ruminants but can also infect humans. Interestingly, assemblage A is widespread in the United States cattle population [46], whereas it is relatively rare in calves in other countries [20, 35, 47, 48]. This suggests that different assemblages of G. duodenalis are circulating in different countries. In the present study, we identified four subtypes of assemblage E (E1, E3, E5, and E11) and this result is consistent with the findings of our previous study [27], indicating that these subtypes are prevalent in pre-weaned calves in the ROK. Cattle are known to be source of contamination of ground and surface waters, resulting in waterborne outbreak in humans [49–52]. Therefore, continuous monitoring in cattle is needed to prevent and control G. duodenalis infections in public health significance.
The phylogenetic analysis of G. duodenalis based on each gene revealed the presence of two distinct assemblages, A and E. The results of the present study demonstrated that tpi is a highly heterogenic genetic marker and can be used to differentiate G. duodenalis at the subtype level [53]. Moreover, a higher genetic diversity of G. duodenalis was observed within assemblage E. However, subtyping designation of assemblage E is not clearly supported by phylogenetic analyses. The difficulty in the classification of subtypes may be due to high inter- and intra-sequence variabilities in assemblage E [40, 54, 55]. In contrast to assemblage E, assemblage A showed low genetic diversity. Phylogenetic trees constructed herein provided data on grouping and genetic relationship but did not present accurate information on subtypes, particularly within assemblage E. These results suggest that multilocus sequencing is more useful for subtyping of assemblage E.
In this study, we report mixed infections for the first time. Assemblage-specific PCRs are used to detect mixed infections; however, these assays are less sensitivity, particularly in detecting genetic variations, compared with genotyping based on single or multiple gene targets [56, 57]. Although next generation sequencing has been applied to accurately identify mixed infections, this method is extremely expensive. Mixed infections have been reported in Belgium [58], the UK [59], Germany [49], China [14], and the USA [46]. Compared with the findings in these countries, we discovered that mixed infections in calves were less common in the ROK. At this point, we are uncertain whether the mixed infections in this study were due to genetically different cysts or different alleles in the nuclei of a single cyst [60]. Furthermore, we did not evaluate the clinical signs of calves with mixed infections or the amount of cysts they shed into feces compared with those with either assemblage E or A infection. Mixed infections are of interest because infected calves may harbor the potentially zoonotic assemblage A and should therefore be appropriately diagnosed. Further investigations are required to determine the occurrence and pathogenicity of mixed infections.
The MLG approach is a reliable method to analyze the genetic diversity of G. duodenalis assemblages [61]. In this study, only two samples yielded amplicons of all three loci. Despite the small sample size, we detected genetic variations within assemblage E, implying that the level of subtype diversity found in this study was higher than that found in our previous study [27]. It is possible that the genetic heterogeneity within assemblage E is due to frequent intra-assemblage genetic recombination [29, 40, 54, 55]. The MLG shown in this study confirmed the presence of mixed assemblages in samples due to inconsistent assemblage designation at different genetic loci. This is evident as only two samples assigned as assemblage E at the bg locus were genotyped as sub-assemblage AI at the tpi locus. Therefore, MLG is a suitable method for detecting mixed infections and identifying potentially zoonotic assemblages in cattle and other hosts [14, 20, 62–64].
Conclusions
In this study, the prevalence of G. duodenalis in pre-weaned calves with diarrhea was low. G. duodenalis infection was significantly associated with age of calves, with a relatively high prevalence in calves aged 11–30 days. Pre-weaned calves were at a higher risk of G. duodenalis infection than neonatal calves. Our findings indicate that G. duodenalis should be considered as a primary causative agent of diarrhea in pre-weaned calves. Both assemblages A and E were identified in calves, with assemblage E being the most prevalent. To the best of our knowledge, this is the first report describing mixed infections with assemblage A and E in calves in the ROK. These results suggest that calves are an important zoonotic reservoir and pose a potential risk for humans. Additional epidemiological studies are warranted to better understand the transmission and public health significance of G. duodenalis in the ROK.
Acknowledgments
We thank Jeong-Byoung Chae, DVM for collecting feces.
Data Availability
All relevant data are within the paper.
Funding Statement
The study was supported by the National Research Foundation (KR) NRF-2021R1A2C1011579. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1.Lalle M, Pozio E, Capelli G, Bruschi F, Crotti D, Cacciò SM. Genetic heterogeneity at the beta-giardin locus among human and animal isolates of Giardia duodenalis and identification of potentially zoonotic subgenotypes. Int J Parasitol. 2005;35(2):207–213. doi: 10.1016/j.ijpara.2004.10.022 [DOI] [PubMed] [Google Scholar]
- 2.Vivancos V, González-Alvarez I, Bermejo M, Gonzalez-Alvarez M. Giardiasis: characteristics, pathogenesis and new insights about treatment. Curr Top Med Chem. 2018;18(15):1287–1303. doi: 10.2174/1568026618666181002095314 [DOI] [PubMed] [Google Scholar]
- 3.Feng Y, Xiao L. Zoonotic potential and molecular epidemiology of Giardia species and giardiasis. Clin Microbiol Rev. 2011;24(1):110–140. doi: 10.1128/CMR.00033-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Adam RD. Biology of Giardia lamblia. Clin Microbiol Rev. 2001;14(3):447–475. doi: 10.1128/CMR.14.3.447-475.2001 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Monis PT, Andrews RH, Mayrhofer G, Ey PL. Genetic diversity within the morphological species Giardia intestinalis and its relationship to host origin. Infect Genet Evol. 2003;3(1):29–38. doi: 10.1016/s1567-1348(02)00149-1 [DOI] [PubMed] [Google Scholar]
- 6.Fantinatti M, Bello AR, Fernandes O, Da-Cruz AM. Identification of Giardia lamblia assemblage E in humans points to a new anthropozoonotic cycle. J Infect Dis. 2016;214(8):1256–1259. doi: 10.1093/infdis/jiw361 [DOI] [PubMed] [Google Scholar]
- 7.Zahedi A, Field D, Ryan U. Molecular typing of Giardia duodenalis in humans in Queensland—first report of assemblage E. Parasitol. 2017;144(9):1154–1161. doi: 10.1017/S0031182017000439 [DOI] [PubMed] [Google Scholar]
- 8.Abdel-Moein KA, Saeed H. The zoonotic potential of Giardia intestinalis assemblage E in rural settings. Parasitol Res. 2016;115(8):3197–3202. doi: 10.1007/s00436-016-5081-7 [DOI] [PubMed] [Google Scholar]
- 9.Abeywardena H, Jex AR, Nolan MJ, Haydon SR, Stevens MA, McAnulty RW, et al. Genetic characterisation of Cryptosporidium and Giardia from dairy calves: discovery of species/genotypes consistent with those found in humans. Infect Genet Evol. 2012;12(8):1984–1993. doi: 10.1016/j.meegid.2012.08.004 [DOI] [PubMed] [Google Scholar]
- 10.Dan J, Zhang X, Ren Z, Wang L, Cao S, Shen L, et al. Occurrence and multilocus genotyping of Giardia duodenalis from post-weaned dairy calves in Sichuan province, China. PLoS One. 2019;14(11):e0224627. doi: 10.1371/journal.pone.0224627 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Geurden T, Vercruysse J, Claerebout E. Is Giardia a significant pathogen in production animals? Exp Parasitol. 2010;124(1):98–106. doi: 10.1016/j.exppara.2009.03.001 [DOI] [PubMed] [Google Scholar]
- 12.Ryan U, Caccio SM. Zoonotic potential of Giardia. Int J Parasitol. 2013;43(12–13):943–956. doi: 10.1016/j.ijpara.2013.06.001 [DOI] [PubMed] [Google Scholar]
- 13.Taghipour A, Sharbatkhori M, Tohidi F, Ghanbari MR, Karanis P, Olfatifar M, et al. Global prevalence of Giardia duodenalis in cattle: a systematic review and meta-analysis. Prev Vet Med. 2022;203:105632. doi: 10.1016/j.prevetmed.2022.105632 [DOI] [PubMed] [Google Scholar]
- 14.Wang H, Zhao G, Chen G, Jian F, Zhang S, Feng C, et al. Multilocus genotyping of Giardia duodenalis in dairy cattle in Henan, China. PLoS One. 2014;9(6):e100453. doi: 10.1371/journal.pone.0100453 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Zhang X, Dan J, Wang L, Liu H, Zhou Z, Ma X, et al. High genetic diversity of Giardia duodenalis assemblage E in Chinese dairy cattle. Infect Genet Evol. 2021;92:104912. doi: 10.1016/j.meegid.2021.104912 [DOI] [PubMed] [Google Scholar]
- 16.Cai W, Ryan U, Xiao L, Feng Y. Zoonotic giardiasis: an update. Parasitol Res. 2021;120(12):4199–4218. doi: 10.1007/s00436-021-07325-2 [DOI] [PubMed] [Google Scholar]
- 17.Sprong H, Cacciò SM, van der Giessen JW, ZOOPNET network and partners. Identification of zoonotic genotypes of Giardia duodenalis. PLoS Negl Trop Dis. 2009;3(12):e558. doi: 10.1371/journal.pntd.0000558 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Peng JJ, Zou Y, Li ZX, Liang QL, Song HY, Li TS, et al. Prevalence and multilocus genotyping of Giardia duodenalis in Tan sheep (Ovis aries) in northwestern China. Parasitol Int. 2020;77:102126. doi: 10.1016/j.parint.2020.102126 [DOI] [PubMed] [Google Scholar]
- 19.Jin Y, Fei J, Cai J, Wang X, Li N, Guo Y, et al. Multilocus genotyping of Giardia duodenalis in Tibetan sheep and yaks in Qinghai, China. Vet Parasitol. 2017;247:70–76. doi: 10.1016/j.vetpar.2017.09.021 [DOI] [PubMed] [Google Scholar]
- 20.Wang X, Cai M, Jiang W, Wang Y, Jin Y, Li N, et al. High genetic diversity of Giardia duodenalis assemblage E in pre-weaned dairy calves in Shanghai, China, revealed by multilocus genotyping. Parasitol Res. 2017;116(8):2101–2110. doi: 10.1007/s00436-017-5509-8 [DOI] [PubMed] [Google Scholar]
- 21.Cao L, Han K, Wang L, Hasi S, Yu F, Cui Z, et al. Genetic characteristics of Giardia duodenalis from sheep in Inner Mongolia, China. Parasite. 2020;27:60. doi: 10.1051/parasite/2020060 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Chen D, Zou Y, Li Z, Wang SS, Xie SC, Shi LQ, et al. Occurrence and multilocus genotyping of Giardia duodenalis in black-boned sheep and goats in southwestern China. Parasit Vectors. 2019;12(1):102. doi: 10.1186/s13071-019-3367-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Xie SC, Zou Y, Chen D, Jiang MM, Yuan XD, Li Z, et al. Occurrence and multilocus genotyping of Giardia duodenalis in Yunnan black goats in China. Biomed Res Int. 2018;2018:4601737. doi: 10.1155/2018/4601737 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Lebbad M, Mattsson JG, Christensson B, Ljungström B, Backhans A, Andersson JO, et al. From mouse to moose: multilocus genotyping of Giardia isolates from various animal species. Vet Parasitol. 2010;168(3–4):231–239. doi: 10.1016/j.vetpar.2009.11.003 [DOI] [PubMed] [Google Scholar]
- 25.Lee SH, VanBik D, Kim HY, Cho A, Kim JW, Byun JW, et al. Prevalence and molecular characterisation of Giardia duodenalis in calves with diarrhoea. Vet Rec. 2016;178(25):633. doi: 10.1136/vr.103534 [DOI] [PubMed] [Google Scholar]
- 26.Lee YJ, Han DG, Ryu JH, Chae JB, Chae JS, Yu DH, et al. Identification of zoonotic Giardia duodenalis in Korean native calves with normal feces. Parasitol Res. 2018;117(6):1969–1973. doi: 10.1007/s00436-018-5863-1 [DOI] [PubMed] [Google Scholar]
- 27.Lee YJ, Ryu JH, Shin SU, Choi KS. Prevalence and molecular characterization of Cryptosporidium and Giardia in pre-weaned native calves in the Republic of Korea. Parasitol Res. 2019;118(12):3509–3517. doi: 10.1007/s00436-019-06482-9 [DOI] [PubMed] [Google Scholar]
- 28.Oh SI, Jung SH, Lee HK, Choe C, Hur TY, So KM. Multilocus genotyping of Giardia duodenalis occurring in Korean native calves. Vet Sci. 2021;8(7):118. doi: 10.3390/vetsci8070118 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Feng Y, Gong X, Zhu K, Li N, Yu Z, Guo Y, et al. Prevalence and genotypic identification of Cryptosporidium spp., Giardia duodenalis and Enterocytozoon bieneusi in pre-weaned dairy calves in Guangdong, China. Parasit Vectors. 2019;12(1):41. doi: 10.1186/s13071-019-3310-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Kim HY, Lee H, Lee SH, Seo MG, Yi S, Kim JW, et al. Multilocus genotyping and risk factor analysis of Giardia duodenalis in dogs in Korea. Acta Trop. 2019;199:105113. doi: 10.1016/j.actatropica.2019.105113 [DOI] [PubMed] [Google Scholar]
- 31.Kumari P, Eo KY, Lee WS, Kimura J, Yamamoto N. DNA-based detection of Leptospira wolffii, Giardia intestinalis and Toxoplasma gondii in environmental feces of wild animals in Korea. J Vet Med Sci. 2021;83(5):850–854. doi: 10.1292/jvms.20-0596 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Lee H, Jung B, Lim JS, Seo MG, Lee SH, Choi KH, et al. Multilocus genotyping of Giardia duodenalis from pigs in Korea. Parasitol Int. 2020;78:102154. doi: 10.1016/j.parint.2020.102154 [DOI] [PubMed] [Google Scholar]
- 33.Olson ME, Guselle NJ, O’Handley RM, Swift ML, McAllister TA, Jelinski MD, et al. Giardia and Cryptosporidium in dairy calves in British Columbia. Can Vet J. 1997;38(11):703–706. [PMC free article] [PubMed] [Google Scholar]
- 34.O’Handley RM, Olson ME, Fraser D, Adams P, Thompson RC. Prevalence and genotypic characterisation of Giardia in dairy calves from western Australia and western Canada. Vet Parasitol. 2000;90(3):193–200. doi: 10.1016/s0304-4017(00)00235-1 [DOI] [PubMed] [Google Scholar]
- 35.Helmy YA, Klotz C, Wilking H, Krucken J, Nockler K, Von Samson-Himmelstjerna G, et al. Epidemiology of Giardia duodenalis infection in ruminant livestock and children in the Ismailia province of Egypt: insights by genetic characterization. Parasit Vectors. 2014;7:321. doi: 10.1186/1756-3305-7-321 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Muller J, Braga S, Heller M, Muller N. Resistance formation to nitro drugs in Giardia lamblia: no common markers identified by comparative proteomics. Int J Parasitol Drugs Drug Resist. 2019;9:112–119. doi: 10.1016/j.ijpddr.2019.03.002 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Alum A, Absar IM, Asaad H, Rubino JR, Ijaz MK. Impact of environmental conditions on the survival of Cryptosporidium and Giardia on environmental surfaces. Interdiscip Perspect Infect Dis. 2014;2014:210385. doi: 10.1155/2014/210385 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Ortega YR, Adam RD. Giardia: overview and update. Clin Infect Dis. 1997;25(3):545–549. doi: 10.1086/513745 [DOI] [PubMed] [Google Scholar]
- 39.Olson ME, Goh J, Phillips M, Guselle N, McAllister TA. Giardia cyst and Cryptosporidium oocyst survival in water, soil, and cattle feces. J Environ Qual. 1999;28(6):1991–1996. 10.2134/jeq1999.00472425002800060040x [DOI] [Google Scholar]
- 40.Naguib D, El-Gohary AH, Roellig D, Mohamed AA, Arafat N, Wang Y, et al. Molecular characterization of Cryptosporidium spp. and Giardia duodenalis in children in Egypt. Parasit Vectors. 2018;11(1):403. doi: 10.1186/s13071-018-2981-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Trout JM, Santin M, Greiner E, Fayer R. Prevalence and genotypes of Giardia duodenalis in post-weaned dairy calves. Vet Parasitol. 2005;130(3–4):177–183. doi: 10.1016/j.vetpar.2005.03.032 [DOI] [PubMed] [Google Scholar]
- 42.O’Handley RM, Olson ME. Giardiasis and cryptosporidiosis in ruminants. Vet Clin North Am Food Anim Pract. 2006;22(3):623–643. doi: 10.1016/j.cvfa.2006.07.002 [DOI] [PubMed] [Google Scholar]
- 43.Santin M, Trout JM, Fayer R. A longitudinal study of Giardia duodenalis genotypes in dairy cows from birth to 2 years of age. Vet Parasitol. 2009;162(1–2):40–45. doi: 10.1016/j.vetpar.2009.02.008 [DOI] [PubMed] [Google Scholar]
- 44.Lam HYP, Chen TT, Tseng YC, Chang KC, Yang TH, Peng SY. Detection and genotyping of Giardia duodenalis from cattle and pigs in Hualien country, eastern Taiwan. J Microbiol Immunol Infect. 2021;54(4):718–727. doi: 10.1016/j.jmii.2020.05.009 [DOI] [PubMed] [Google Scholar]
- 45.Kiani-Salmi N, Fattahi-Bafghi A, Astani A, Sazmand A, Zahedi A, Firoozi Z, et al. Molecular typing of Giardia duodenalis in cattle, sheep and goats in an arid area of central Iran. Infect Genet Evol. 2019;75:104021. doi: 10.1016/j.meegid.2019.104021 [DOI] [PubMed] [Google Scholar]
- 46.Hublin JSY, Maloney JG, George NS, Molokin A, Lombard JE, Urie NJ, et al. Enhanced detection of Giardia duodenalis mixed assemblage infections in pre-weaned dairy calves using next generation sequencing. Vet Parasitol. 2022;304:109702. doi: 10.1016/j.vetpar.2022.109702 [DOI] [PubMed] [Google Scholar]
- 47.Fan Y, Wang T, Koehler AV, Hu M, Gasser RB. Molecular investigation of Cryptosporidium and Giardia in pre- and post-weaned calves in Hubei Province, China. Parasit Vectors. 2017;10(1):519. doi: 10.1186/s13071-017-2463-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Ehsan AM, Geurden T, Casaert S, Parvin SM, Islam TM, Ahmed UM, et al. Assessment of zoonotic transmission of Giardia and Cryptosporidium between cattle and humans in rural villages in Bangladesh. PLoS One. 2015;10(2):e0118239. doi: 10.1371/journal.pone.0118239 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Gillhuber J, Pallant L, Ash A, Thompson RC, Pfister K, Scheuerle MC. Molecular identification of zoonotic and livestock-specific Giardia-species in faecal samples of calves in southern Germany. Parasit Vectors. 2013;6(1):346 doi: 10.1186/1756-3305-6-346 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Hatam-Nahavandi K, Mohebali M, Mahvi AH, Keshavarz H, Mirjalali H, Rezaei S, et al. Subtype analysis of Giardia duodenalis isolates from municipal and domestic raw wastewaters in Iran. Environ Sci Pollut Res Int. 2017;24(14):12740–12747. doi: 10.1007/s11356-016-6316-y [DOI] [PubMed] [Google Scholar]
- 51.Heyworth MF. Giardia duodenalis genetic assemblages and hosts. Parasite. 2016;23:13. doi: 10.1051/parasite/2016013 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Ma L, Sotiriadou I, Cai Q, Karanis G, Wang G, Wang G, et al. Detection of Cryptosporidium and Giardia in agricultural and area of China by IFT and PCR. Parasitol Res. 2014;113(9):3177–3184. doi: 10.1007/s00436-014-3979-5 [DOI] [PubMed] [Google Scholar]
- 53.Feng Y, Ortega Y, Cama V, Terrel J, Xiao L. High intragenotypic diversity of Giardia duodenalis in dairy cattle on three farms. Parasitol Res. 2008;103(1):87–92. doi: 10.1007/s00436-008-0932-5 [DOI] [PubMed] [Google Scholar]
- 54.Aguiar JM, Silva SO, Santos VA, Taniwaki SA, Oliveira TM, Ferreira HL, et al. Evidence of heterozygosity and recombinant alleles in single cysts of Giardia duodenalis. Rev Bras Parasitol Vet. 2016;25(2):187–195. doi: 10.1590/S1984-29612016031 [DOI] [PubMed] [Google Scholar]
- 55.Caccio SM, Sprong H. Giardia duodenalis: genetic recombination and its implications for taxonomy and molecular epidemiology. Exp Parasitol. 2010;124(1):107–112. doi: 10.1016/j.exppara.2009.02.007 [DOI] [PubMed] [Google Scholar]
- 56.Belkessa S, Ait-Salem E, Laatamna A, Houali K, Sonksen UW, Hakem A, et al. Prevalence and clinical manifestations of Giardia intestinalis and other intestinal parasites in children and adults in Algeria. Am J Trop Med Hyg. 2021;104(3):910–916. doi: 10.4269/ajtmh.20-0187 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Van Lith L, Soba B, Vizcaino VV, Svard S, Sprong H, Tosini F, et al. A real-time assemblage-specific PCR assay for the detection of Giardia duodenalis assemblages A, B and E in fecal samples. Vet Parasitol. 2015;211(1–2):28–34. doi: 10.1016/j.vetpar.2015.04.017 [DOI] [PubMed] [Google Scholar]
- 58.Geurden T, Geldhof P, Levecke B, Martens C, Berkvens D, Casaert S, et al. Mixed Giardia duodenalis assemblage A and E infections in calves. Int J Parasitol. 2008;38(2):259–264. doi: 10.1016/j.ijpara.2007.07.016 [DOI] [PubMed] [Google Scholar]
- 59.Minetti C, Taweenan W, Hogg R, Featherstone C, Randle N, Latham SM, et al. Occurrence and diversity of Giardia duodenalis assemblages in livestock in the UK. Transbound Emerg Dis. 2014;61(6):e60–67. doi: 10.1111/tbed.12075 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Sulaiman IM, Fayer R, Bern C, Gilman RH, Trout JM, Schantz PM, et al. Triosephosphate isomerase gene characterization and potential zoonotic transmission of Giardia duodenalis. Emerg Infect Dis. 2003;9(11):1444–1452. doi: 10.3201/eid0911.030084 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Caccio SM, Ryan U. Molecular epidemiology of giardiasis. Mol Biochem Parasitol. 2008;160(2):75–80. doi: 10.1016/j.molbiopara.2008.04.006 [DOI] [PubMed] [Google Scholar]
- 62.Liu A, Yang F, Shen Y, Zhang W, Wang R, Zhao W, et al. Genetic analysis of the gdh and bg genes of animal-derived Giardia duodenalis isolates in northeastern China and evaluation of zoonotic transmission potential. PLoS One. 2014;9(4):e95291. doi: 10.1371/journal.pone.0095291 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63.Yin YL, Zhang HJ, Yuan YJ, Tang H, Chen D, Jing S, et al. Prevalence and multi-locus genotyping of Giardia duodenalis from goats in Shaanxi province, northwestern China. Acta Trop. 2018;182:202–206. doi: 10.1016/j.actatropica.2018.03.013 [DOI] [PubMed] [Google Scholar]
- 64.Qi M, Xi J, Li J, Wang H, Ning C, Zhang L. Prevalence of zoonotic Giardia duodenalis assemblage B and first identification of assemblage E in rabbit fecal samples isolates from central China. J Eukaryot Microbiol. 2015;62(6):810–814. doi: 10.1111/jeu.12239 [DOI] [PubMed] [Google Scholar]