Skip to main content
PLOS One logoLink to PLOS One
. 2023 Mar 10;18(3):e0280688. doi: 10.1371/journal.pone.0280688

Newcastle disease burden in Nepal and efficacy of Tablet I2 vaccine in commercial and backyard poultry production

Rajindra Napit 1,2,#, Ajit Poudel 1,2,#, Saman M Pradhan 1,2,#, Prajwol Manandhar 2, Sajani Ghaju 1, Ajay N Sharma 1,2, Jyotsna Joshi 1,2, Suprim Tha 1, Kavya Dhital 1, Udaya Rajbhandari 1, Amit Basnet 1, Jessica S Schwind 3, Rajesh M Rajbhandari 1,2, Dibesh B Karmacharya 1,2,4,*
Editor: Shawky M Aboelhadid5
PMCID: PMC10004539  PMID: 36897867

Abstract

Poultry (Gallus domesticus) farming plays an important role as an income generating enterprise in a developing country like Nepal, contributing more than 4% to the national Gross Domestic Product (GDP). Newcastle Disease (ND) is a major poultry disease affecting both commercial and backyard poultry production worldwide. There were more than 90 reported ND outbreaks in Nepal in 2018 with over 74,986 birds being affected. ND is responsible for over 7% of total poultry mortality in the country. Recent outbreaks of ND in 2021 affected many farms throughout Nepal and caused massive loss in poultry production. ND is caused by a single-stranded ribonucleic acid (RNA) virus that presents very similar clinical symptoms as Influenza A (commonly known as bird flu) adding much complexity to clinical disease identification and intervention. We conducted a nationwide ND and Influenza A (IA) prevalence study, collecting samples from representative commercial and backyard poultry farms from across the major poultry production hubs of Nepal. We used both serological and molecular assessments to determine disease exposure history and identification of strains of ND Virus (NDV). Of the 40 commercial farms tested, both NDV (n = 28, 70%) and IAV (n = 11, 27.5%) antibodies were detected in majority of the samples. In the backyard farms (n = 36), sero-prevalence of NDV and IAV were 17.5% (n = 7) and 7.5% (n = 3) respectively. Genotype II NDV was present in most of the commercial farms, which was likely due to live vaccine usage. We detected never reported Genotype I NDV in two backyard farm samples. Our investigation into 2021 ND outbreak implicated Genotype VII.2 NDV strain as the causative pathogen. Additionally, we developed a Tablet formulation of the thermostable I2-NDV vaccine (Ranigoldunga™) and assessed its efficacy on various (mixed) breeds of chicken (Gallus domesticus). Ranigoldunga™ demonstrated an overall efficacy >85% with a stability of 30 days at room temperature (25°C). The intraocularly administered vaccine was highly effective in preventing ND, including Genotype VII.2 NDV strain.

Background

Poultry (Gallus domesticus) farming is one of the major sources of protein and means of food security for growing population throughout the world [1]. Around 75 million broiler chickens are reared annually as a source of meat in Nepal, and the industry has rapidly grown in the recent years [2]. The present population of laying hens is more than 7 million, with more than 63 million eggs produced, and the meat produced from poultry exceeds over 17 thousand metric tons annually [3].

Newcastle Disease (ND) is one of the most devastating viral diseases of poultry globally [4]. In a developing country like Nepal, backyard poultry accounts for more than 45% of the total poultry production, and ND is one of the major diseases impacting this sector [5]. There were more than 90 reported ND outbreaks in Nepal in 2018 with over 74,986 birds being affected [6]. Overall ND is responsible for more than 7% of total poultry mortality in the country [7, 8].

ND is a highly infectious disease caused by a single-stranded RNA virus (avian orthoavula virus)- commonly known as Newcastle Disease Virus (NDV) [9]. The virus consists of an assembly of materials enclosed in a protein coat. This assembly is surrounded by an envelope, which is derived from the membranes of the host cell. Projecting from the envelope is a fringe of glycoprotein spikes. These are the haemagglutinin neuraminidase (HN) and fusion (F) glycoproteins that play important role in infection [10].

Although most avian species are susceptible to infection with NDV, chickens (Gallus domesticus) are most susceptible to the disease. ND is classified by the World Organization for Animal Health (WOAH) as a List ‘A’ disease of international concern. ND spreads rapidly, extends beyond national borders, and has serious socioeconomic consequences and major trade implications [11]. Depending on the NDV strain, infected birds can show a range of clinical signs. Age of bird, health and immune status of the host, presence of concurrent infections, and environmental conditions can influence the severity of the symptoms [12]. Some strains of ND cause no clinical signs, while others have high mortality rates [13]. Strains of NDV are divided into five groups or pathotypes based on clinical signs produced in experimentally-infected chickens [14].

The clinical representation caused by ND and Influenza A (IA) are often indiscernible [15]. And because some strains of Influenza A virus (IAV) (bird flu, e.g. H5N1) affect human health, early detection and intervention is crucial to discern between these two pathogens (NDV and IAV) for proper intervention strategies. NDV is limited to birds only whereas IAV has both human and animal health implications [16]. In chickens, clinical manifestations of ND include moderate to severe damage on the respiratory tract, often times leading to multi-organ failures. It can also decrease egg production, thereby severely impacting poultry farmers economically [17]. Outbreaks of ND or IA are often followed by embargoes and trading restrictions in affected areas [18].

Traditionally, disease diagnosis has relied on isolation and identification of the virus, which can take up to two weeks. Even with the advent of polymerase chain reaction (PCR) and real-time PCR (RT-PCR), sample collection and processing still take 1–2 days.

ND can be controlled and prevented using vaccines and by adapting a strict biosafety and biosecurity practiced [19]. Several ND vaccines are currently commercially available. Most of the ND vaccines deteriorate after one or two hours at room temperature, making them unsuitable for use in villages and on farms with limited cold chain facility. The I2-NDV vaccine was developed for local or regional production and used to control ND in places where cold chain is not reliable. The I2-NDV vaccine is a thermostable vaccine that remains effective for up to 30 days of storage at room temperature [20–22]. The high costs of maintaining cold chain for transportation and the use of other conventional vaccines makes ND vaccination impractical and unsustainable in most rural areas. Having access to a locally-produced thermostable ND vaccine has a tremendous impact on preventing ND in a low resource country like Nepal.

Poultry vaccine production in Nepal has increased significantly (10–50% annually) in recent years [23]. There are three registered vaccine production laboratories in Nepal. F1 and ND R2B-based immunization started in 1968 in Nepal, and I2- NDV vaccine was introduced in 2008 [23]. There is limited information on various kinds of ND vaccine in use in Nepal and their efficacies in commercial and backyard poultry production [24, 25]. In one study, I2- NDV vaccine used in backyard chickens of Nepal showed a high antibody titer response at 14–30 day period, giving protective immunity for at least 3 months [25]. Although vaccine schedules vary, in general, I2- NDV live vaccines provide significant protection against NDV when administered at day 7 in broilers (45 day production cycle), and additional booster shots every 2–3 months for egg-laying chickens (18 month production cycle) [26].

In this study, we conducted a nationwide NDV and IAV prevalence study (2018–19) by collecting samples from representative commercial and backyard poultry farms from the major poultry production hubs of Nepal (Fig 1). This research included both serological and molecular assessments, which provided disease exposure, prior vaccination history and detection of various strains of NDV. Additionally, we developed a thermostable I2- NDV vaccine in a tablet formulation called Ranigoldunga™, which was found to be highly effective against NDV, including on a virulent NDV strain (Genotype VII.2) that caused nationwide outbreak in Nepal in 2021.

Fig 1. Sampling strategy of chicken in a farm- an imaginary diagonal lines from where birds were randomly selected and sampled.

Fig 1

Methods

Our study followed ethical guidelines as prescribed by the Department of Livestock Services (DLS) Nepal for the nationwide survey. Sampling and survey were conducted after obtaining written consent from the owners of commercial and backyard farms. Biological samples were collected using proper biosecurity measures in the presence of the farm owner or caretaker.

For vaccine tests, all in vivo experiments, animals were monitored daily by trained technicians and observational data were collected. Clinical signs of ND like greenish diarrhea, respiratory distress, decreased appetite, occurrence of ruffled feathers, lack of physical activity, and stunted growth, were observed and recorded [27]. We planned to euthanize birds that showed early evidence of severe suffering or distress (neck and leg paralysis) [28].

Survey and sample collection of commercial and backyard poultry farms

In 2018 (June-December), we collected poultry samples from commercial (n = 40) and backyard (n = 36) farms from ten districts of Nepal. These districts are poultry production hubs that suffer from regular NDV and IAV outbreaks [29].

We collected samples (oral, cloacal and blood) from each commercial (n = 15 birds) and backyard farm (n = 3 birds) (Table 1). Birds were picked randomly for sample collection by walking along an imaginary diagonal line across the farm (Fig 1). Oral and cloacal swab samples were collected in viral transport media (VTM). Blood was collected in vaccutainer from the brachial vein, and serum was separated in cryovials by centrifuging blood (2000g for 10 minutes) by a licensed veterinarian. Samples were transported in liquid nitrogen tanks (-196°C) to the lab in Kathmandu for further laboratory analysis.

Table 1. Collected sample types from each commercial and backyard farm.

Total Number of Chickens Oropharyngeal Swabs Cloacal Swabs Blood Specimens
Commercial farm 15 15 15 15
Backyard farm 3 3 3 3

Biosecurity and biosafety risk assessment in poultry farms

Biosecurity and biosafety practices survey of all the farms were conducted using a standardized questionnaire. The statistical analysis was done using IBM SPSS 20.

Serological Assessment of NDV and IAV

Commercially available enzyme-linked immunosorbent assay (ELISA) kits (ID Screen® Influenza A Nucleoprotein and Newcastle Disease Nucleoprotein Indirect ELISA kits, France) were used for detecting and quantifying IAV and NDV antibodies (nucleoprotein) as per manufacturer’s instructions. Five microliters of serum from each sample were used in each ELISA test.

Molecular (PCR) assessment of NDV and IAV

Sample processing strategy

The oral, cloacal, and blood samples were collected from commercial (n = 40 farms, total birds = 600) and backyard (n = 36 farms, total birds = 108) poultry farms from across the major poultry production hubs of Nepal in 2018. Oropharyngeal swabs (n = 15 from each farm) and cloacal swabs (n = 15 from each farm) were pooled and collected in two separate single tubes. Altogether, 40 pooled oropharyngeal samples from commercial farms (n = 40) and 36 pooled oropharyngeal samples from backyard farms (n = 36) were collected.

Viral RNA extraction and cDNA synthesis

The pooled samples were vortexed for 2 minutes and spun down for 30 seconds. RNA from these samples containing VTM were extracted using Direct-zol RNA Miniprep Kits (Zymo Research, USA). 200ul of supernatant sample was added to 200ul of TRI Reagent® for lysis procedure. RNA extraction was done using the manufacturer’s instructions.

cDNA was synthesized using iScript™ cDNA Synthesis Kit (BIORAD, California, USA). The reaction mix had 5x iScript™ reaction Mix (4μl), nuclease free water (10 μl), RNA template (4μl), and iScript reverse transcriptase enzyme (1μl), which was incubated initially at 25°C for 5 mins, followed by 46°C for 20 min. The reaction was inactivated at 95°C for 1 min and eluted in a 50μl final volume.

Detecting NDV and IAV using multiplex PCR assay

A multiplex PCR assay was developed that can simultaneously detect both NDV and IAV in a single tube, thereby reducing screening cost and time. PCR primers were designed using reference sequence data from the NCBI database (S1 Table in S1 File). Sequence alignment was performed using MAFFT V. 7.0 [30] and Primer Blast [31].

Primers used for NDV are-

NDV ISO-F (GCTCAATGTCACTATTGATGTGG) and NDV ISO-R (TAGCAGGCTGTCCCACTGC)

Primers for IA are-

IAV ISO-F (CTTCTAACCGAGGTCGAAACG) and IAVM_ISO-R (GGTGACAGGATTGGTCTTGTC)

PCR conditions-

The reaction mixture consisted of nuclease free water (7μl), 2X Qiagen Master Mix (12.5μl), Taq Polymerase (1μl), 0.3 μM of primer and 3μl of cDNA. The samples were initially denatured at 95ºC for 10 minutes, followed by 45 cycles consisting of: 95ºC (denaturation) for 10 sec, 54ºC (annealing) for 15 sec, and 72ºC (extension) for 7 sec. The final extension was done at 72ºC for 5 minutes. The results were visualized in 1.5% Agarose gel.

Characterization (Genotyping) of strains of NDV

Amplification of Fusion (F) gene of NDV

A tiled (juxtaposed multi-fragment) PCR and next generation sequencing assay was developed to analyze genotype (strain) of detected NDV (Fig 2). The entire Fusion (F) gene of NDV was segmented into four fragments (1–4) and amplified using PCR primers listed in Table 2. These PCR amplicons were purified using Montage Gel Extraction Kit (Merck, USA) and further processed for DNA sequencing.

Fig 2. Targeted Fusion gene tiled PCR amplification on NDV genome using designed primers.

Fig 2

The image was created using Biorender web app [32].

Table 2. NDV Fusion (F) gene tiled fragments and designed PCR primers.
Primer Fragment Position Sequence (5’ to 3’) Amplicon(bp)
Primer mix NDVF_1561F Fragment 1 (95–546) TTGATGGCAGGCCTCTTGC 497
NDVF_IR2-2 CATCTTCCCAACTGCCACTG
NDVF_IF2 Fragment 2 (469–1007) AGCATTGCTGCAACCAATGAGGC 538
NDVF_IR1 GAGGTGTCAAGTTCTTCTATCAC
NDVF_IF1 Fragment 3 (882–1398) CCTAAATAATATGCGTGCCAC 518
NDVF_IR3 CTCAGTTGAKATATCRAGATTGCCTG
NDVF_IF3-3 Fragment 4 (1287–1655) AGACGGGATAACTCTGAGGCT 369
NDVF_1561R TTTGTAGTGGCTCTCATCTG

Multiplex amplicon sequencing using Next Generation Sequencing (NGS)

Library preparation, NGS and Bioinformatics data analysis

The library preparation was done using Nextera XT DNA Library Preparation kit (Illumina Inc., USA) and quantification with Qubit™ dsDNA HS Assay Kit in Qubit 3.0 Fluorimeter (Invitrogen, USA). Final library was sequenced using MiSeq Reagent Kit v2 (Illumina Inc., USA). The raw Fastq reads were checked for quality using FastQC [33] and quality trimmed using Trimmomatic V 0.32 [34].

The filtered reads were mapped against reference sequence of F gene of NDV (JSD0812) using bowtie2 [35]. The consensus sequences were generated using SAMtools V 1.9 [36] and seqtk V 1.3 [37]. The workflow was performed for each sample to retrieve a consensus sequence for all samples. NDV F gene reference sequence was taken from the NCBI GenBank representing various genotypes of NDV (S1 Table in S1 File). A phylogenetic tree was constructed using a maximum likelihood in IQ-Tree using 1000 bootstrap similar to ones conducted by using W-IQ-TREE, which is a fast online phylogenetic tool for maximum likelihood analysis [38]. The tree was viewed using FigTree V 1.4.4 [39].

ND Outbreak (2021) investigation

There were multiple sporadic nationwide outbreaks of ND in 2021 in Nepal as reported by the Nepal Government Central Veterinary Laboratory (CVL) [40]. We conducted an outbreak investigation in Goldhunga, one of the highly affected areas near Kathmandu city. Our field team collected oral and cloacal swabs from dead chickens (n = 2) from an affected farm. We tested these samples for NDV and IAV and analyzed variant of the NDV.

Developing thermostable I2- NDV vaccine (Ranigoldhunga™)

Based on the ND vaccine developed by the Australian Centre for International Agricultural Research (ACIAR, Australia) [41], we obtained the master seed (I2-NDV) from the University of Queensland and further developed the I2-NDV into a tablet formulation for greater efficacy and stability. We performed a thorough in-vitro (stability) and in-vivo (safety, clinical, and Genotype VII.2 challenge trial) tests to assess the efficacy of this new formulation (Ranigoldunga™). I2- NDV with Embryo Infectious Dose at 50% (EID50) = 107 or 108 viral copies/ul per dose, was mixed with the stabilizers [hydrolyzed gelatin, skimmed milk and SPG (sucrose phosphate glutamate)], cryo-protectants and binders and lyophilized (freeze dried) [42]. We also prepared a freeze-dried formulation containing only I2- NDV suspended in skim milk (4%).

Ranigoldunga™ vaccine stability assessment.

Both formulations (lyophilized and tablet) of Ranigoldunga™ vaccine was subjected to stability tests in a stability chamber. Vaccines were tested at 4°C, ambient temperature (20–25°C), and 37°C. EID50 were measured at various time intervals (4, 7, 10, 14, and 28) days, and subsequently once a month from 2 to 6 months, to assess efficacy and stability of the vaccines. The EID50 was measured in specific pathogen free (SPF) egg with the procedure described by WOAH guidelines [43].

Ranigoldunga™ vaccine- in-vivo trial.

In-vivo trials were conducted at the BIOVAC Nepal’s animal testing facility located in Banepa (Nepal). Day old chicks (mix breed of Gallus domesticus) (n = 18) were selected and screened for 6 major poultry diseases [Newcastle disease virus (NDV), Influenza A Virus (IAV), Infectious bronchitis virus (IBV), Infectious Bursal disease (IBD), Mycoplasma gallisepticum (Mg), and Mycoplasma synoviae (Ms)] prior to the trial using PCR tests. Blood serum was also collected and screened for NDV antibodies using ELISA test. With all birds determined to be free from all six pathogens and showing no presence of NDV antibodies, they were grouped as described in Table 3.

Table 3. In-vivo (safety) trial- group (chickens), vaccine administration mode and dose with EID50 values.
Group Number Chicken ID Vaccine Formulation Administered Vaccine administration route Vaccination dose EID50 Value
1 1–6 Negative Control Ocular 1 drop (40ul) NA
2 7–12 Tablet Formulation Ocular 1 drop (40ul) 107
3 13–18 Lyophilized Formulation Ocular 1 drop (40ul) 106.5

Each vaccine dose contained around 107−6.5 EID50/ml (Table 3) and 108 viral copies per ul (S2 Fig in S2 File). The viral copies were determined using a Real Time PCR test (S2 Fig in S2 File). Chickens were monitored daily for any visible clinical signs and symptoms. Serum was collected every week until week 7. An ELISA test was carried out every week to monitor antibody titers. Necropsy was carried out at the end of the trial to analyze post-vaccination anatomical effects on the bird.

Ranigoldunga™ vaccine- field trial.

Field trials were conducted at two sites (Goldhunga & Chaling) in the Kathmandu Valley. The Goldhunga farm was situated about 10 km south of the Kathmandu city. It has been in operation since 2018 and keeps around 3000 broiler chickens (Cobb500) per production batch in its 2500 sq. ft. facility. The Chaling farm came into operation in 2019 and was located about 18 km north of the Kathmandu city. In its 3000 sq. ft. facility, it keeps around 3000 broiler birds (Cobb500). Prior to the vaccination trial, 1% of the chickens were randomly selected, sampled, and screened for NDV and IAV, including some water and feed samples. We tested our two different formulations (tablet and lyopholized) of the vaccine, which were administered through i) drinking water and ii) ocular application (S5 Table in S1 File).

Fig 3 shows segregation of birds during the clinical trials. Out of the 2500 birds in each farm (Goldhunga & Chaling), 70% (n = 1750, Group 1) were vaccinated with the lyophilized formulation. Of which 7% (n = 175, Group 1a) was selected as a control (no vaccine) group and 63% (n = 1575, Group 1b) were vaccinated through drinking water. The tablet vaccine was administered through intra-ocular method and was not tested in drinking water. To ensure maximum live virus vaccine exposure to the birds, we withheld access to drinking water for two hours prior to vaccine administration. Adequate vaccine dose in water was calculated based on average water consumption per bird [44].

Fig 3. Field trial of Ranigoldunga™ vaccine in two farms of the Kathmandu Valley.

Fig 3

Out of total 2500 chickens vaccination, 7% (n = 175) was selected as control group and 63% (n = 1575) as test group in drinking water and 15%, (n = 375) as test group for ocular administration and 15% (n = 375) test group for tablet formulation and assessed for the vaccine efficacy.

Group 2 (30%, n = 750) were vaccinated ocularly with the lyophilized formulation (15%, n = 375, Group 2a) and the tablet formulation (15%, n = 375, Group 2b) using a dropper [one drop (40ul) of vaccine- EID50 (106.5 = Lyophilized, 107 = Tablet)].

Post vaccination assessment

Birds were screened for the presence of live I2- NDV (one week after vaccination) and antibody titer response (within 3 weeks after vaccination). The chickens were segregated into different sections within the farm (Fig 4). A section was randomly selected and one bird per section was picked for sample collection (oral, blood) for I2- NDV PCR and antibody titer response assessment. To assess NDV antibody titer, hemagglutination inhibition (HI) titer were measured by using four hemagglutination (HA) units with a two-fold serial dilution as recommended by the WOAH (2012) [43]. To consider adequate coverage of the vaccine, we benchmarked attaining HI antibody titer of ≥log 23 on more than 66% of the total vaccinated chickens. Total number of birds sampled from each section is shown in Table 4.

Fig 4. Physical segregation of chickens in a trial farm-water section (lyophilized, Group 1a and 1b), ocular section (Tablet & Lyophilized, Group 2a and 2b) and additional quarters.

Fig 4

The direction of sampling starts with a selection of a random section followed by sections in the direction as indicated by the grey arrows.

Table 4. Number of birds sampled (with CI 95%) for the post vaccination assessment of live I2- NDV and antibody titer response at the two trial farms (Goldhunga and Chaling).
Farm Group Method of delivery Total chickens
Goldhunga Tablet formulation Group 2b Ocular (combined) 255
Lyophilized formulation Group 2a
Lyophilized formulation Group 1b Drinking water 320
Unvaccinated Group 1a Control population 10
Chaling Tablet formulation Group 2b Ocular 191
Lyophilized formulation Group 2b Ocular 191
Lyophilized formulation Group 1b Drinking water 317
Unvaccinated Group 1a Control population 10

Ranigoldunga™ vaccine- challenge trial with Genotype VII.2.

The identified Genotype VII.2 NDV (2021 outbreak strain) was isolated, cultured in SPF egg, and harvested. The harvested fluid was tested for the lethal dose 50 (LD50) value per the WOAH guidelines [45]. Birds were vaccinated with the Ranigoldunga™ vaccine on day 7. A mixture of 27 and 29 day-old chickens were segregated into non-vaccinated or control group (n = 13) and vaccinated or test group (n = 14). Both groups were given the outbreak NDV strain (Genotype VII.2) intramuscularly (0.2 ml of virus containing 105.3 EID50) at the BIOVAC’s animal testing facility.

All chickens were screened for NDV using PCR in the first week of the trial. Daily body temperature and weight of the birds were recorded by a trained veterinarian. We classified fever in birds if their body temperature was above normal (105.8 °F to 106.7 ° F) [46]. We recorded clinical manifestations and mortality of the trial birds for 42 days.

Results

Biosecurity and biosafety assessment of commercial and backyard farms

Commercial farms

The top three chicken breeds found in the commercial farms were Cobb 500 (45%), Hyline brown (32.5%) and Lohmann brown (17.5%). 97.5% of the farms used at least one type of disinfectant to clean their farms, and 67.5% used at least one form of personal protective equipment (PPE) while working inside their farm. All surveyed farms vaccinated their chickens against ND, except two farms [Kailali district (n = 1) and Nawalparasi district (n = 1)] (Table 5).

Table 5. Biosecurity practices in commercial farms in ten districts of Nepal along with antibody ELISA results for NDV and IAV.

ELISA results provide an insight into any possible correlations between biosecurity measures and presence of diseases.

Districts (4 farms per district) Chicken Breed Biosecurity Measures Antibody ELISA
Broilers Layers Other At least one Disinfectant Used At least one PPE Used ND Vaccines ELISA_NDV ELISA_IAV
Cobb 500 H&N Brown Nick Hyline Brown Lohmann Brown Giriraj Yes No Yes No Used Not Used Positive Negative Positive Negative
Bhaktapur 2 0 1 1 0 4 0 4 0 4 0 1 3 3 1
Chitwan 2 0 1 1 0 4 0 3 1 4 0 3 1 2 2
Dang 1 1 1 1 0 4 0 2 2 4 0 4 0 0 4
Jhapa 0 0 4 0 0 4 0 3 1 4 0 4 0 0 4
Kailali 1 0 1 1 1 3 1 2 2 3 1 2 2 1 3
Kathmandu 3 0 1 0 0 4 0 2 2 4 0 3 1 3 1
Lalitpur 3 0 0 1 0 4 0 2 2 4 0 0 4 0 4
Morang 2 0 2 0 0 4 0 3 1 4 0 3 1 1 3
Nawalparasi 2 0 1 1 0 4 0 2 2 3 1 4 0 1 3
Sunsari 2 0 1 1 0 4 0 2 2 4 0 4 0 0 4
Percentage 45.0 2.5 32.5 17.5 2.5 97.5 2.5 67.5 35.0 95.0 5.0 70.0 30.0 27.5 72.5

Backyard farms

Giriraj (27.5%), Kuroiler (22.5%) and Sakhini and Pwakh Ulte (12.5% each) were the most common poultry breeds found in backyard farms. Only small numbers of farms used disinfectant (< 32.5%) and PPE (<15%) (Table 6). Only 2.5% of the farms vaccinated their chickens against ND. None of the backyard farms in Jhapa district consented to participate in the study and could not be included, bringing the total number of backyard farms sampled to 36.

Table 6. Biosecurity practices in backyard farms(n = 36) of Nepal along with antibody ELISA results for NDV and IAV.

ELISA results provide an insight into any possible correlations between biosecurity measures and presence of diseases.

Districts Chicken Breed Biosecurity Measures Antibody ELISA
(4 farms per district) Broilers Breeds At least one Disinfectant Used At least one PPE Used Vaccines Used ELISA_NDV ELISA_IAV
Cobb 500 Giriraj Kadaknath Kuroiler Sakhini Pwakh Ulte Yes No Yes No Yes No Positive Negative Positive Negative
Bhaktapur 1 2 0 1 0 0 0 4 0 4 0 4 1 3 0 4
Chitwan 0 1 0 1 1 1 1 3 1 3 0 4 0 4 0 4
Dang 0 3 1 0 0 0 2 2 1 3 0 4 2 2 0 4
Jhapa* NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA
Kailali 1 0 1 0 1 1 0 4 0 4 0 4 3 1 1 3
Kathmandu 1 3 0 0 0 0 2 2 0 4 0 4 0 4 0 4
Lalitpur 0 0 0 2 1 1 2 2 0 4 0 4 0 4 0 4
Morang 0 2 1 0 0 1 1 3 2 2 0 4 0 4 0 4
Nawalparasi 0 0 0 3 1 0 2 2 1 3 1 3 0 4 1 3
Sunsari 0 0 0 2 1 1 3 1 1 3 0 4 1 3 1 3
Percentage 7.5 27.5 7.5 22.5 12.5 12.5 32.5 57.5 15 75 2.5 87.5 17.5 72.5 7.5 82.5

*Farms in Jhapa did not consent to sampling and are thus listed as NA. Total farms questioned are n = 36.

We observed limited biosafety and biosecurity practices in the commercial farms (Table 7). Although all 40 commercial farms used disinfectant to clean and the majority of farms (n = 39) also followed proper hand washing practices after working with stock, only 32.5% of the farms (n = 13) used some kind of PPE when handling waste. Four farms (10%) used comprehensive biosafety measures in their farms. All 40 farms vaccinated their stock against at least one of the diseases. Ten farms reported their poultry flock interacted with wild birds, five farms obtained poultry from multiple sources, and only three stored multiple species of poultry in one enclosure.

Table 7. Biosafety (left) and Biosecurity (right) results of commercial farms (n = 40) sampled by BIOVAC.
Biosafety Results Biosecurity Results
Chosen variables N (%) Chosen variables N (%)
Disinfectant Used 40 (100) Veterinary care in the last one year 40 (100)
Hand washing practices after working with stock 39 (97.5) Private veterinary care 40 (100)
PPE Used 25 (67.5) Vaccines available on demand 40 (100)
Used only one type of biosafety measures (hand washing, showering, footbaths, PPE for visitors, fencing, etc.) 23 (57.5) Important to report suspicious deaths 37 (92.5)
PPE used when handling waste 13 (32.5) Vet visit frequency as needed 34 (85)
Knowledge among workers regarding zoonotic potential of some poultry diseases 11 (27.5) Quarantine facility for new birds 33 (82.5)
Used four types of biosafety measures (hand washing, showering, footbaths, PPE for visitors, fencing etc.) 4 (10) Enclosure cleaned as needed 31 (77.5)
Stock interacted with wild birds 10 (25)
Stock obtained from multiple sources 5 (12.5)
Multiple species stored in one enclosure 3 (7.5)
Farm inspection by government officials in the past year 2 (5)
Refrigerator present on site for vaccine storage 2 (5)

Most of the farmers (43%) thought IA (bird flu) was the main poultry disease, and only few (3%) thought ND caused disease in their birds. Most of the farmers (51%) were not aware of any other poultry disease (Fig 5).

Fig 5. Commercial poultry farmers’ perception to diseases that were responsible for outbreaks in their poultry farms.

Fig 5

Majority (43%) thought Bird flu was responsible for disease outbreaks, only few (3%) blamed ND for making their birds sick.

Serological screening for antibody against NDV and IAV

Of the 600 commercial chickens tested from 40 farms in 10 districts of Nepal for the presence of NDV and IAV antibodies in their serum, NDV antibody was detected in the majority of the samples (n = 381, 64%, 28 farms). Comparatively, IAV antibody was detected in fewer number of samples (n = 125, 21%, 11 farms). Similarly, in 108 backyard chicken tested from 36 farms of 9 districts of Nepal, NDV antibody was detected in 35% (n = 38, 7 farms), and IAV antibody was present in 16% (n = 17, 3 farms) of the birds (Table 5).

Molecular screening for presence of NDV and IAV

Pooled oral and cloacal samples were screened for NDV and IAV using the in-house designed NDV-ISO and IAV-ISO primers respectively. Out of the 40 commercial farms, 31(78%) and 15(38%) were PCR positive for NDV and IAV respectively. Similarly, out of the 36 backyard farms, 6 (17%) and 1 (3%) were PCR positive for NDV and IAV respectively.

Detected NDV genotypes (strain)

Samples with detectable NDV were selected and 4 fragments of F-gene were further amplified using PCR and sequenced. Not all 4 fragments were successfully amplified. Only fragment 2 was consistently amplified in most of the samples from commercial (11/31, 33%) and backyard (4/6, 67%) farms (S1 Fig in S2 File). These amplified fragments were extracted and cleaned for DNA sequencing in the next generation sequencing platform (MiSeq, Illumina, USA).

We constructed a phylogenetic tree (Fig 6) based on F-gene sequence from samples with detectable NDV (commercial farms = 5, backyard farms = 2) along with archived sequence data from the NCBI GenBank of all known NDV genotypes. Maximum likelihood phylogeny tree showed that the all-commercial farm (n = 5) NDV F-gene sequences clustered with non-virulent Genotype II. This genotype also consisted of vaccine strains- Lasota, B1 and F strain. Four of these commercial samples [BCCHT2_2018 (NCBI accession # MZ087886), NWLP4_2018 (NCBI accession # MZ087887), LTP3_2018 (NCBI accession # MZ087888) and BCDNG1_2018 (NCBI accession # MZ087890)] clustered together with the KU159667 (USA) and the MH996947 (Nigeria) NCBI references. The remaining sample [SNS4_2018 (NCBI accession # MZ087889)] was closely related to the JN942019 (Peru) NCBI reference. Meanwhile NDV from the backyard farms (n = 2) samples clustered with the MH996911 (Nigeria) NCBI reference in the Genotype I group. The outbreak strain, VCS1_F (MZ087884), from the Kathmandu Valley belonged to the Genotype VII clade.

Fig 6. Phylogenetic analysis of the nucleotide sequences from the amplified products of NDV fusion genes (521 bp) for commercial and backyard chickens.

Fig 6

A phylogenetic tree was constructed using a maximum likelihood in the IQTree with 1000 bootstrap replicates. The tree was viewed using Fig Tree V 1.4.4. NDV strains are represented in colors based on their detection source- commercial chickens (Blue), backyard chickens (green), vaccine strains (red) and the outbreak strain (brown).

Newcastle disease outbreak investigation (2021)

Our investigation in one of the diseased farms in Goldhunga (Kathmandu valley) in 2021 found NDV to be the cause of the outbreak. F-gene sequence analysis characterized the detected NDV as a Genotype VII.2 variant (NCBI accession # MZ087884.1) (Fig 7).

Fig 7. Phylogenetic analysis of the partial NDV Fusion gene (744 bp) of the 2021 outbreak strain (brown color, MZ087884.1) clustered it in the Genotype VII group.

Fig 7

Further phylogenetic analysis placed the outbreak strain (red) in the Genotype VII.2 group [47].

Ranigoldunga™ vaccine stability assessment

Our preliminary data showed that both the formulations (tablet & lyophilized) of the Ranigoldunga™ vaccine were stable for 30 days at ambient temperature (10–22°C), 8 days at 37°C, and an estimated 1 year at 4°C (Fig 8) with EID50 >106.

Fig 8. Ranigoldhunga™ vaccine stability tested at different temperature within a range of relative humidity (40–60%).

Fig 8

Ambient temperature (blue) ranging from 20–25°C, 4 °C (red) and 37 °C (green) were three different temperatures the vaccine was tested for. Recorded stability at EID50 is represented by the solid lines, and plotted stability (CL- 95%) derived from a mean value calculation is shown with the dotted lines.

Ranigoldunga™ vaccine- in-vivo trial

The antibody titer after the RanigoldungaTM vaccination peaked (titer peaking at 2000–4000) at week 4 and gradually subsided in subsequent weeks (Fig 9). The data showed the need for a booster dose after week 7 to revamp NDV antibody titers.

Fig 9. In-vivo measurement of NDV antibody titer after vaccination with the Ranigoldunga™.

Fig 9

The Tablet formulation elevated NDV antibody titer to 4000 based on ELISA assessment. The graphs highlight antibody titer in chickens vaccinated with thermostable (tablet) formulation, lyophilized formulation, and negative control (unvaccinated chickens) from week 0 to week 7.

Vaccine efficacy- field trial

We found the RanigoldungaTM vaccine to be very efficacious, with one of the farms (Goldhunga) showing over 88% efficacy (HI titer >Log 23) both when administered ocularly or used in drinking water. In the second trial farm (Chaling), although the efficacy was observed lower (69% for ocular; 79% for drinking water) compared to Goldhunga farm, it was still considered efficacious based on the WOAH guideline of attaining at least 66% or higher (HI titer >Log 23) (S7 Table in S1 File) [48].

We also recorded morbidity and mortality at these two farms (S8 Table in S1 File). Of all the vaccinated chicken (n = 2500) at the Goldhunga farm, 500 chickens (19%) died in a course of 9 weeks. During the first few weeks, salmonella infection was the major cause of mortality. In the subsequent weeks, chickens started wheezing, showed signs of labored breathing, lethargy and loss of appetite, symptoms associated with chronic respiratory disease (CRD). Swab collected from the post-vaccination chickens resulted in <2% of chickens developing signs of ND. Interestingly, a ND outbreak was ongoing in Kathmandu at the time of this trial [40]. Out of 2500 chickens at the Chaling farm, 197 chickens (8%) chickens died over the period of six weeks. Overcrowding and trampling caused early mortality as a sudden drop in temperature resulted in chickens brooding in tight spaces. Ascites and CRD were other main cause of morbidity and mortality in weeks leading to end of production cycle (45 days). Morbidity and mortality of both farms are shown in S8 & S9 Tables in S1 File.

Vaccine efficacy- challenge trial with genotype VII.2 strain

In the controlled group (non-vaccinated, challenged), we recorded fever (108°F) in birds after two days of challenge dose administration. In the test group (vaccinated, challenged), birds’ average body temperature remained within the normal range (106°F) (Fig 10). Other clinical symptoms atypical of ND were also observed in the controlled group.

Fig 10. Ranigoldhunga™ vaccine challenged trial in the test group (n = 14) and the Control group (n = 13).

Fig 10

Measurement of increase in temperature (left) and change in body weight (right) of the chickens that were challenged intramuscularly (0.2 ml) with a total dose of Ge Genotype VII.2 105.3 EID50.

We did not observe any severe symptoms of ND (neck and leg paralysis) in birds that required euthanasia. However, all the birds in the controlled group died within 3–5 days of receiving the challenge dose (Table 8). The necropsy of the birds showed visible signs of blood clots in the trachea, a swelling of the intestines, and nervous system damage. RanigoldungaTM vaccine was highly effective against Genotype VII.2 of NDV.

Table 8. Summary of challenge trial conducted to test vaccine efficary agaisnt Genotype VII.2.

Group Number of chickens Method of challenge Mortality survival percentage %
Control (Challenged, Non-vaccinated) 13 intramuscular 13/13 0
Test (Challenged, Vaccinated) 14 intramuscular 0/14 100

Post-vaccination assessment data is shown in S3 Table in S1 File.

Discussion

RNA viruses, like NDV, are highly mutable and pose a great threat due to their changing virulence [49]. The 2021 outbreak of ND in Nepal was particularly devastating with thousands of birds lost across Nepal. While commercial poultry farmers are aware of the need to vaccinate against ND, most of the backyard farmers either do not know or do not have access to the ND vaccine [50–52].

Outbreaks of ND and IA frequently occur in low resource countries like Nepal [53]. However, prior to this study, the disease burden and epidemiological dynamics in Nepal were never studied. We have conducted a nationwide ND and IA prevalence study by collecting samples from representative commercial and backyard poultry farms from across the major poultry production hubs of Nepal [29] using both serological and molecular assessments. Seroprevalence of NDV and IAV in commercial farms were 70% (n = 28) and 27.5% (n = 11) respectively, and 17.5% (NDV) and 7.5% (IAV) respectively in backyard farms. Out of the 40 commercial farms, we were able to detect live NDV in 31 farms (78%) and IAV in 15 farms (38%) (Fig 11) by using molecular techniques. Similarly, out of 36 backyard farms, NDV and IAV were detected in 3 each (8%) (Fig 12) Usage of live virus vaccines for ND and the detection of Genotype II NDV in commercial farms resulted in a high seroprevalence of NDV. However, the government of Nepal has banned usage of unverified and unlicensed vaccines against IA but still used by poultry farmers, and a 21% seroprevalence of IA probably means either there is a high, under-reported IAV infection and/or illegal use of IAV vaccines.

Fig 11. NDV and IAV screening PCR test in the commercial farms (n = 40)–a multiplex PCR test, NDV was detected with 300 bp and IAV with 152 bp amplicons.

Fig 11

Each district had three letter code and included four farms (numbered 1 to 4). Each sample represents pooled samples from a single farm. The gel was run with ladder in the first well; and negative and positive controls in the last wells (from left to right). (KTM = Kathmandu, LLT = Lalitpur, CHT = Chitwan, NWLP = Nawalparasi, DNG = Dang, KLI = Kailali, MRG = Morang, and SNS = Sunsari Districts).

Fig 12. NDV and IAV screening PCR test in the backyard farms (n = 36)–NDV and IAV were detected with 300 bp and 152 bp PCR amplicons respectively.

Fig 12

Each district were assigned with a three-letter code and had four farms (numbered 1 to 4). Each sample represents a farm pooled in a single tube and screened. The gel was run with ladder in the first well and negative and positive controls in the last wells (from left to right). KTM = Kathmandu, LLT = Lalitpur, CHT = Chitwan, NWLP = Nawalparasi, DNG = Dang, KLI = Kailali, MRG = Morang, and SNS = Sunsari Districts.

In backyard farms, we detected the Genotype I NDV strain, which has not been previously reported in Nepal, indicating potential identification of native, endemic strain of the virus. The NDV strains, if lentogenic, can be used as vaccine targets. Our 2021 ND outbreak investigation identified Genotype VII.2 as the causative strain (variant).

Understanding the disease burden, gathering information on viral strains, and administering effective vaccines can help mitigate and prevent frequently occurring ND outbreaks in poultry production in low resource settings [53]. Our survey indicated that farmers were not aware of ND (as much as IA) and hence were not using vaccines against ND. This finding was especially true for the backyard poultry farmers (Fig 5).

One of the most effective disease preventive practices in poultry production is to have adequate biosafety and biosecurity measures. Biosafety refers to the containment principles, technologies, and practices that are implemented to prevent unintentional exposure to pathogens and toxins, or their accidental release. Biosecurity refers to the institutional and personal security measures designed to prevent the loss, theft, misuse, diversion or intentional release of pathogens and toxins [54]. Although immunization in the commercial farms were high (98%), biosecurity measures were mostly inadequate, with only two-thirds (65%) of the farms using some form of PPE and only 10% having comprehensive biosafety protection (Tables 5 & 7). It was evident that poultry health was paramount to the commercial farms because of the high vaccination rates and veterinary care, but self-monitoring or other biosafety measures were not prioritized. Overall, poor biosafety and biosecurity practices were observed in the commercial farms (Table 7). All 40 farms vaccinated their stock against at least one of the poultry diseases. Ten farms reported their poultry flock interacted with wild birds which are known to carry various poultry diseases like IA, ND, and Infectious Bursal Disease [55–57]. This finding was also validated by the fact that a mere 27.5% of the farms reported having knowledge of zoonotic disease threats caused by poultry pathogens. Having little or no knowledge of impacts of zoonoses may explain the lapse in biosafety and biosecurity measures. Although all 40 farms used disinfectants to clean, and the majority of farms (n = 39) followed proper hand washing practices after working with stock, only a few of the farms (n = 13, 32.5%) used some kind of PPE when handling waste. Only 4 farms (10%) used a comprehensive biosafety measure in their farms. Five farms obtained chicken (day old chicks) from multiple sources, and only three stored multiple species of poultry in one enclosure. (Table 7).

Additionally, biosafety and biosecurity measures were very poorly practiced and implemented in the backyard farms due to lack of knowledge and experience in rearing poultry [58]. Less than a third of the farms (32.5%) used at least one type of disinfectant to clean chicken housings. Only 15% reported to ever vaccinate their stock, and only one farm out of the 36 (2.5%) reported using vaccines. Backyard poultry are more resilient to diseases [59], but their close proximity to commercial farms (sometimes within less than 100m of each other—as discovered during our field work) can lead to commercial poultry being affected by disease outbreaks that originate in backyard farms [44]. And lack of biosafety practices can lead to zoonotic spillover of possible highly pathogenic avian influenza (HPAI) into backyard poultry farmers, jeopardizing their health.

Animal health services, especially laboratory-based diagnostics, are not well developed in Nepal [60]. Poultry farms do not have reliable laboratories to have outbreaks investigated in a timely fashion. Although immune-chromatography (rapid)-based diagnostic kits are readily available, they are often not reliable [61]. Molecular-based detection methods (like PCR) are more accurate and sensitive to detect pathogens, such as NDV and IAV [62]. Clinical symptoms caused by NDV and IAV are very similar and hence extremely difficult to differentiate by clinical symptoms alone. IAV, especially HPAI, often get lot of attention from public health officials with active Avian Influenza surveillance programs implemented throughout the country. With a challenging differential diagnosis between IAV and NDV, the implication to the farmer is tremendous—if erroneously diagnosed, as highly infectious strains of IAV like HPAIs lead to culling of all poultry within 5 km radius of an infected farm. Having relatively cheap NDV and IAV molecular diagnostic and characterization tools is going to help address this challenge. With many PCR labs now set up during SARS-CoV-2 pandemic period [63], such tests can easily be run (with proper adaptation) in molecular labs located across the country, increasing greater access to diagnosis for early and effective interventions.

Thermostable I2-ND vaccine (Ranigoldunga™) in tablet formulation is highly effective against NDV, including a virulent strain of Genotype VII.2 that devastated the majority of Kathmandu poultry farms in 2021 [63]. In-vivo trials with both the Ranigoldunga™ formulations (tablet and lyophilized) performed very well with a relatively high protective titer response (>3000) against NDV (Fig 8). A single dose of Ranigoldunga™ at day 7 will be enough to protect short cycle broiler breed such as Cobb 500 that have turnovers in 45 days. Currently, general practice is to give three different doses of ND vaccine(s) at day 7, 18, and 22 [6], considerably increasing the cost of immunization. Differences in vaccine efficacies observed between the two field trial sites could be due to inefficiencies in vaccine delivery (such as eye dropper inaccuracies) and/or immune-compromised chickens with morbidity caused by other infections (S9 Table in S1 File).

The live ND vaccines are also mostly of lentogenic and mesogenic strains that require cold chain transportation, and currently only one I-2 strain based vaccine produced by the National Vaccine Production Lab (NVPL) is used for the vaccinating backyard poultry [6]. We believe vaccines like Ranigoldunga™ can be used for commercial and backyard poultry and increase the accessibility of immunization against NDV in places where maintaining cold chain for transportation and storage is a challenge. This would reduce the economic burden on poultry farmers and help to significantly boost production in one of the major, self-sustaining industry of Nepal.

Supporting information

S1 File

(DOCX)

S2 File

(DOCX)

S3 File

(PDF)

Acknowledgments

We would like to thank our collaborators from the University of Queensland (Australia), Pirbright Institute (UK) and Universidad de Castilla La Muncha (Spain) for their valuable technical support. We would also like to thank previous and current Ambassadors of Australia to Nepal (HE Glen White, Peter Budd, Felicity Volk) for facilitating technical support and encouraging us. This work would have been impossible without ACIAR providing us with NDV I2 master seed- we express our gratitude. Special thanks goes to Professor Joanne Meers of the University of Queensland for helping us with the vaccine seed, and providing us with valuable technical assistance. Various components of our effort were supported by PSI (the Netherlands) and InnovationXchange grant from DFAT (Australia), we would like to acknowledge and thank them. Thank you, Dr David Bunn of the University of California-Davis, for giving us the idea of setting up the Animal vaccine facility (BIOVAC Nepal Pvt. Ltd.) in Nepal. We would like to thank Dr. Rupendra Chaulagain, Dr. Prakash Adhikari, Dr. Sonu Adhikari, Arjun Bhujel, Deepesh Oli, Samita Raut, and Dhiraj Puri for their invaluable contribution in the field work and sample collection. We would like to thank everyone at the Center for Molecular Dynamics Nepal and Intrepid Nepal for all their help. And finally, we would like to show our appreciation to the local and central government agencies of Nepal for all their assistance and encouragement.

Data Availability

All relevant data are within the paper and its Supporting information files.

Funding Statement

Yes- Various components of our effort were supported by PSI (the Netherlands) and InnovationXchange grant from DFAT 60530159 (Australia)

References

  • 1.Mottet A, Tempio G. Global poultry production: current state and future outlook and challenges. Worlds Poult Sci J. 2017;73: 245–256. [Google Scholar]
  • 2.Karki S, Lupiani B, Budke CM, Karki N, Rushton J, Ivanek R. Cost-benefit analysis of avian influenza control in Nepal. Rev Sci Tech. 2015; 813–827. [PubMed] [Google Scholar]
  • 3.Sapkota MM, Pandey KR. Prevelance and associated risk factor of escherichia coli from the cases of Poultry at Regional Veterinary Laboratory (RVL) Surkhet, Nepal. 2019. [Google Scholar]
  • 4.Mayers J, Mansfield KL, Brown IH. The role of vaccination in risk mitigation and control of Newcastle disease in poultry. Vaccine. 2017;35: 5974–5980. doi: 10.1016/j.vaccine.2017.09.008 [DOI] [PubMed] [Google Scholar]
  • 5.Sharma B. Poultry production, management and bio-security measures. J Agric Environ. 2010;11: 120–125. [Google Scholar]
  • 6.Poudel U, Dahal U. Vaccination: A key way to prevent Newcastle disease in poultry of Nepal. 2020. [Google Scholar]
  • 7.Gompo TR, Pokhrel U, Shah BR, Bhatta DD. Epidemiology of important poultry diseases in Nepal. Nepal Vet J. 2019;36: 8–14. [Google Scholar]
  • 8.Shrestha S, Dhawan M, Donadeu M, Dungu B. Efficacy of vaccination with La Sota strain vaccine to control Newcastle disease in village chickens in Nepal. Trop Anim Health Prod. 2017;49: 439–444. doi: 10.1007/s11250-016-1205-4 [DOI] [PubMed] [Google Scholar]
  • 9.Rabalski L, Smietanka K, Minta Z, Szewczyk B. Detection of Newcastle disease virus minor genetic variants by modified single-stranded conformational polymorphism analysis. Biomed Res Int. 2014;2014. doi: 10.1155/2014/632347 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Ganar K, Das M, Sinha S, Kumar S. Newcastle disease virus: current status and our understanding. Virus Res. 2014;184: 71–81. doi: 10.1016/j.virusres.2014.02.016 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Senne DJADA. Newcastle disease. Dis poultry, 12th ed Saif Y M Fadly A M Glisson J R McDougald L R Nolanand L K Swayne D E eds Iowa State Univ Press; Ames, IA. 2008; 75–100. [Google Scholar]
  • 12.Sharif A, Ahmad T, Umer M, Rehman A, Hussain Z. Prevention and control of Newcastle disease. Int J Agric Innov Res. 2014;3: 454–460. [Google Scholar]
  • 13.Heiden S, Grund C, Röder A, Granzow H, Kühnel D, Mettenleiter TC, et al. Different regions of the newcastle disease virus fusion protein modulate pathogenicity. PLoS One. 2014;9: e113344. doi: 10.1371/journal.pone.0113344 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Desingu PA, Singh SD, Dhama K, Vinodhkumar OR, Nagarajan K, Singh R, et al. Pathotyping of Newcastle disease virus: A novel single BsaHI digestion method of detection and differentiation of avirulent strains (lentogenic and mesogenic vaccine strains) from virulent virus. Microbiol Spectr. 2021;9: e00989–21. doi: 10.1128/spectrum.00989-21 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Nidzworski D, Wasilewska E, Smietanka K, Szewczyk B, Minta Z. Detection and differentiation of Newcastle disease virus and influenza virus by using duplex real-time PCR. Acta Biochim Pol. 2013;60. [PubMed] [Google Scholar]
  • 16.Wang L-C, Pan C-H, Severinghaus LL, Liu L-Y, Chen C-T, Pu C-E, et al. Simultaneous detection and differentiation of Newcastle disease and avian influenza viruses using oligonucleotide microarrays. Vet Microbiol. 2008;127: 217–226. doi: 10.1016/j.vetmic.2007.08.019 [DOI] [PubMed] [Google Scholar]
  • 17.Swayne D, King D. Zoonosis update: avian influenza and Newcastle disease. J Am Vet Med Assoc. 2003;222: 1534–1540. [DOI] [PubMed] [Google Scholar]
  • 18.Alexander DJ. The epidemiology and control of avian influenza and Newcastle disease. J Comp Pathol. 1995;112: 105–126. doi: 10.1016/s0021-9975(05)80054-4 [DOI] [PubMed] [Google Scholar]
  • 19.Dimitrov KM, Afonso CL, Yu Q, Miller PJ. Newcastle disease vaccines—A solved problem or a continuous challenge? Vet Microbiol. 2017;206: 126–136. doi: 10.1016/j.vetmic.2016.12.019 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Bensink Z, Spradbrow P. Newcastle disease virus strain I2–a prospective thermostable vaccine for use in developing countries. Vet Microbiol. 1999;68: 131–139. doi: 10.1016/s0378-1135(99)00069-3 [DOI] [PubMed] [Google Scholar]
  • 21.Illango J, Olaho-Mukani W, Mukiibi-Muka G, Abila PP, Etoori A. Immunogenicity of a locally produced Newcastle disease I-2 thermostable vaccine in chickens in Uganda. Trop Anim Health Prod. 2005;37: 25–31. doi: 10.1023/b:trop.0000047933.52512.c5 [DOI] [PubMed] [Google Scholar]
  • 22.Mahmood MS, Siddique F, Hussain I, Ahmad SI, Rafique A. Thermostable vaccines for Newcastle disease: a review. Worlds Poult Sci J. 2014;70: 829–838. [Google Scholar]
  • 23.Poudel U, Dahal U, Upadhyaya N, Chaudhari S, Dhakal S. Livestock and poultry production in Nepal and current status of vaccine development. Vaccines. 2020;8: 322. doi: 10.3390/vaccines8020322 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Acharya MP, Adhikari SK, Awasthi H, Jha A, Singh UM. Field Verification Trial of ND I-2 Vaccine in Nepal. Nepal Vet J. 2019;36: 15–22. [Google Scholar]
  • 25.Nyaupane S, Pokhrel BB, Acharya MP. A Study to Estimate Longivity of Thermostable Newcastle Disease Vaccine (Strain I-2) in Village Chicken of Nepal. Adv Life Sci. 2016;6: 45–48. [Google Scholar]
  • 26.Mebrahtu K, Teshale S, Esatu W, Habte T, Gelaye E. Evaluation of spray and oral delivery of Newcastle disease I2 vaccine in chicken reared by smallholder farmers in central Ethiopia. BMC Vet Res. 2018;14: 1–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Abdisa T, Tagesu T. Review on Newcastle disease of poultry and its public health importance. J Vet Sci Technol. 2017;8: 441. [Google Scholar]
  • 28.ARRIVE. The Arrive Guidelines 2.0. 2022. https://arriveguidelines.org/arrive-guidelines
  • 29.FAO. Poultry Sector of Nepal. Rome; 2014. [Google Scholar]
  • 30.Do CB, Mahabhashyam MSP, Brudno M, Batzoglou S. ProbCons: Probabilistic consistency-based multiple sequence alignment. Genome Res. 2005;15: 330–340. doi: 10.1101/gr.2821705 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Deng Y, Jiang Y-H, Yang Y, He Z, Luo F, Zhou J. Molecular ecological network analyses. BMC Bioinformatics. 2012;13: 1–20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.BioRender. BioRender App. 2021. https://app.biorender.com
  • 33.GitHub. FastQC. 2022. https://github.com/s-andrews/FastQC
  • 34.Bolger AM, Lohse M, Usadel B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics. 2014/04/04. 2014;30: 2114–2120. doi: 10.1093/bioinformatics/btu170 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Langmead B, Wilks C, Antonescu V, Charles R. Scaling read aligners to hundreds of threads on general-purpose processors. Bioinformatics. 2018/07/19. 2019;35: 421–432. doi: 10.1093/bioinformatics/bty648 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, et al. The Sequence Alignment/Map format and SAMtools. Bioinformatics. 2009/06/10. 2009;25: 2078–2079. doi: 10.1093/bioinformatics/btp352 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.GitHub. seqtk. 2022. https://github.com/lh3/seqtk
  • 38.Trifinopoulos J, Nguyen L-T, von Haeseler A, Minh BQ. W-IQ-TREE: a fast online phylogenetic tool for maximum likelihood analysis. Nucleic Acids Res. 2016;44: W232–W235. doi: 10.1093/nar/gkw256 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Rambaut A. FigTree v1.4.4. Edinburgh: Institute of Evolutionary Biology, University of Edinburgh; 2010. https://www.scirp.org/(S(lz5mqp453edsnp55rrgjct55))/reference/ReferencesPapers.aspx?ReferenceID=1661474
  • 40.Age NB. Poultry Farmers Downcast by Outbreak of Newcastle Disease. 2021. https://www.newbusinessage.com/Articles/view/13439
  • 41.Young MP, Alders RG, Grimes S, Spradbrow PB, Dias PT, da Silva AB, et al. Controlling Newcastle Disease in Village Chickens—A Laboratory Manual. 2002. [Google Scholar]
  • 42.Lal M, Zhu C, McClurkan C, Koelle DM, Miller P, Afonso C, et al. Development of a low-dose fast-dissolving tablet formulation of Newcastle disease vaccine for low-cost backyard poultry immunisation. Vet Rec. 2014;174: 504. doi: 10.1136/vr.101926 [DOI] [PubMed] [Google Scholar]
  • 43.Health WO for A. AI Guidelines. WOAH; 2022. https://www.woah.org/
  • 44.Site TP. Broiler Water Consumption. 2021. https://www.thepoultrysite.com/articles/broiler-water-consumption
  • 45.Miller P. Newcastle Disease in Poultry. 2020. https://www.msdvetmanual.com/poultry/neoplasms/neoplasms-of-unknown-etiology-in-poultry
  • 46.Aengwanich W. Effects of high environmental temperature on the body temperature of Thai indigenous, Thai indigenous crossbred and broiler chickens. Asian J Poult Sci. 2007;2: 48–52. [DOI] [PubMed] [Google Scholar]
  • 47.Dimitrov KM, Abolnik C, Afonso CL, Albina E, Bahl J, Berg M, et al. Updated unified phylogenetic classification system and revised nomenclature for Newcastle disease virus. Infect Genet Evol. 2019;74: 103917. doi: 10.1016/j.meegid.2019.103917 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Plan AVE. Disease Strategy Newcastle disease. 2010. [Google Scholar]
  • 49.Kang Y, Xiang B, Yuan R, Zhao X, Feng M, Gao P, et al. Phylogenetic and pathotypic characterization of Newcastle disease viruses circulating in South China and transmission in different birds. Front Microbiol. 2016;7: 119. doi: 10.3389/fmicb.2016.00119 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Campbell ZA, Otieno L, Shirima GM, Marsh TL, Palmer GH. Drivers of vaccination preferences to protect a low-value livestock resource: Willingness to pay for Newcastle disease vaccines by smallholder households. Vaccine. 2019;37: 11–18. doi: 10.1016/j.vaccine.2018.11.058 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Campbell ZA, Thumbi SM, Marsh TL, Quinlan MB, Shirima GM, Palmer GH. Why isn’t everyone using the thermotolerant vaccine? Preferences for Newcastle disease vaccines by chicken-owning households in Tanzania. PLoS One. 2019;14: e0220963. doi: 10.1371/journal.pone.0220963 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Chaka H, Goutard F, Bisschop SPR, Thompson PN. Seroprevalence of Newcastle disease and other infectious diseases in backyard chickens at markets in Eastern Shewa zone, Ethiopia. Poult Sci. 2012;91: 862–869. doi: 10.3382/ps.2011-01906 [DOI] [PubMed] [Google Scholar]
  • 53.Hussein MS, Fahmy HA, Abd El Tawab AA. Fluoroquinolones resistance pattern of escherichia coli from apparently healthy broiler chickens in egypt. Adv Anim Vet Sci. 2022;10: 472–479. [Google Scholar]
  • 54.Beeckman DSA, Rüdelsheim P. Biosafety and biosecurity in containment: a regulatory overview. Front Bioeng Biotechnol. 2020;8: 650. doi: 10.3389/fbioe.2020.00650 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Brown VR, Bevins SN. A review of virulent Newcastle disease viruses in the United States and the role of wild birds in viral persistence and spread. Vet Res. 2017;48: 1–15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Greening SS, Rawdon TG, Mulqueen K, French NP, Gates MC. Using multiple data sources to explore disease transmission risk between commercial poultry, backyard poultry, and wild birds in New Zealand. Prev Vet Med. 2021;190: 105327. doi: 10.1016/j.prevetmed.2021.105327 [DOI] [PubMed] [Google Scholar]
  • 57.Rehan M, Aslam A, Khan MR, Abid M, Hussain S, Amber J, et al. Potential economic impact of Newcastle disease virus isolated from wild birds on commercial poultry industry of Pakistan: A review. Hosts viruses. 2019;6: 1–15. [Google Scholar]
  • 58.Ahmed T, Ameer HA, Javed S. Pakistan’s backyard poultry farming initiative: impact analysis from a public health perspective. Trop Anim Health Prod. 2021;53: 1–12. doi: 10.1007/s11250-021-02659-6 [DOI] [PubMed] [Google Scholar]
  • 59.Kumar M, Dahiya SP, Ratwan P. Backyard poultry farming in India: A tool for nutritional security and women empowerment. Biol Rhythm Res. 2021;52: 1476–1491. [Google Scholar]
  • 60.Rai SK, Uga S, Ono K, Rai G, Matsumura T. Contamination of soil with helminth parasite eggs in Nepal. Southeast Asian J Trop Med Public Health. 2000;31: 388–393. [PubMed] [Google Scholar]
  • 61.Acharya P, Yadav R. A REVIEW ON POULTRY POPULATION, PRODUCTION (Egg and meat) AND DISTRIBUTION IN NEPAL. Food Agribus Manag. 2020;2: 14–16. [Google Scholar]
  • 62.Le TB, Kim HK, Na W, Le VP, Song M-S, Song D, et al. Development of a multiplex RT-qPCR for the detection of different clades of avian influenza in poultry. Viruses. 2020;12: 100. doi: 10.3390/v12010100 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Basnet BB, Satyal D, Pandit R, Basnet TB, Khattri S, Mishra SK. Knowledge, practice and psychological symptoms among medical laboratory staff during COVID-19 pandemic in Nepal: An online based survey. Inq J Heal Care Organ Provision, Financ. 2022;59: 00469580221082783. doi: 10.1177/00469580221082783 [DOI] [PMC free article] [PubMed] [Google Scholar]

Decision Letter 0

Shawky M Aboelhadid

19 Sep 2022

PONE-D-22-18860Newcastle disease burden in Nepal and efficacy of Tablet I2 vaccine in commercial and backyard poultry productionPLOS ONE

Dear Dr. Karmacharya, 

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Nov 03 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Shawky M Aboelhadid, PhD

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at 

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and 

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. In your Methods section, please provide additional information regarding the permits you obtained for the work. Please ensure you have included the full name of the authority that approved the field site access and, if no permits were required, a brief statement explaining why.

3. We note that the grant information you provided in the ‘Funding Information’ and ‘Financial Disclosure’ sections do not match. 

When you resubmit, please ensure that you provide the correct grant numbers for the awards you received for your study in the ‘Funding Information’ section.

4. Thank you for stating the following financial disclosure: 

 "Yes- Various components of our effort were supported by PSI (the Netherlands) and InnovationXchange grant from DFAT (Australia)" 

Please state what role the funders took in the study.  If the funders had no role, please state: "The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript." 

If this statement is not correct you must amend it as needed. 

Please include this amended Role of Funder statement in your cover letter; we will change the online submission form on your behalf.

5. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels. 

  

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

6. Please amend either the abstract on the online submission form (via Edit Submission) or the abstract in the manuscript so that they are identical.

7. Please ensure that you refer to Figure 2 in your text as, if accepted, production will need this reference to link the reader to the figure.

8. We note that Figure 1 in your submission contain [map/satellite] images which may be copyrighted. All PLOS content is published under the Creative Commons Attribution License (CC BY 4.0), which means that the manuscript, images, and Supporting Information files will be freely available online, and any third party is permitted to access, download, copy, distribute, and use these materials in any way, even commercially, with proper attribution. For these reasons, we cannot publish previously copyrighted maps or satellite images created using proprietary data, such as Google software (Google Maps, Street View, and Earth). For more information, see our copyright guidelines: http://journals.plos.org/plosone/s/licenses-and-copyright.

We require you to either (a) present written permission from the copyright holder to publish these figures specifically under the CC BY 4.0 license, or (b) remove the figures from your submission:

a. You may seek permission from the original copyright holder of Figure 1 to publish the content specifically under the CC BY 4.0 license.  

We recommend that you contact the original copyright holder with the Content Permission Form (http://journals.plos.org/plosone/s/file?id=7c09/content-permission-form.pdf) and the following text:

“I request permission for the open-access journal PLOS ONE to publish XXX under the Creative Commons Attribution License (CCAL) CC BY 4.0 (http://creativecommons.org/licenses/by/4.0/). Please be aware that this license allows unrestricted use and distribution, even commercially, by third parties. Please reply and provide explicit written permission to publish XXX under a CC BY license and complete the attached form.”

Please upload the completed Content Permission Form or other proof of granted permissions as an "Other" file with your submission.

In the figure caption of the copyrighted figure, please include the following text: “Reprinted from [ref] under a CC BY license, with permission from [name of publisher], original copyright [original copyright year].”

b. If you are unable to obtain permission from the original copyright holder to publish these figures under the CC BY 4.0 license or if the copyright holder’s requirements are incompatible with the CC BY 4.0 license, please either i) remove the figure or ii) supply a replacement figure that complies with the CC BY 4.0 license. Please check copyright information on all replacement figures and update the figure caption with source information. If applicable, please specify in the figure caption text when a figure is similar but not identical to the original image and is therefore for illustrative purposes only.

The following resources for replacing copyrighted map figures may be helpful:

USGS National Map Viewer (public domain): http://viewer.nationalmap.gov/viewer/

The Gateway to Astronaut Photography of Earth (public domain): http://eol.jsc.nasa.gov/sseop/clickmap/

Maps at the CIA (public domain): https://www.cia.gov/library/publications/the-world-factbook/index.html and https://www.cia.gov/library/publications/cia-maps-publications/index.html

NASA Earth Observatory (public domain): http://earthobservatory.nasa.gov/

Landsat: http://landsat.visibleearth.nasa.gov/

USGS EROS (Earth Resources Observatory and Science (EROS) Center) (public domain): http://eros.usgs.gov/#

Natural Earth (public domain): http://www.naturalearthdata.com/

9. We note you have included a table to which you do not refer in the text of your manuscript. Please ensure that you refer to Table 6 and 8 in your text; if accepted, production will need this reference to link the reader to the Table.

Additional Editor Comments:

The manuscript needs English language editing before re-submission. The authors should be care in the revision according to the reviewers comments. 

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: N/A

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: No

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: In this study, serological and molecular surveillance for NDV and IAV among commercial and backyard chickens in Nepal was conducted, Also, vaccine preparation from I-2 NDV strain in two forms was performed and their efficacy was investigated in vivo and in the field study. In addition to these, genetic characterization of NDV GVIIc obtained from sick chicken in Nepal was performed. The work is interesting and huge but some points need to fix before publishing.

Major points:-

1- It is extremely important that this manuscript be reviewed for the English language before it gets resubmitted to correct grammar errors, repetition, and typos.

2- The manuscript needs to reconstruct especially abstract, intoduction, and discussion sections

3- Studies carried out in Nepal to characterize genetically NDV strains and to evaluate vaccine efficacy should be added

4- References list must be revised carefully which references are related and which one should delete.

5- Quality and resolution of figures should be improved

6- Authors should follow the Journal instruction for authors during the preparation of the revised version.

7-The authors should briefly describe in the introduction, the current classification of NDV

Specific points:-

Abstract should be reconstructed and

- line 40: Are these flocks vaccinated? History of vaccination? Is ELISA differentiated between vaccinated and non-vaccinated flocks?

-line 41:The big difference between antibody seroprevalence in commercial and backyard account for which reasons?

-line 41: Genotyped equals strain?

-lne 42: Genotype II or class II

-line 43: Genotype I. Which category is virulent or avirulent? Backyards did not receive a live vaccine?

-lines 43-44:Previous studies did not identify NDV in Nepal until 2021? So, how can conclude the endemicity of NDV?

-line 45: Genotype VIIc belongs to which VII.1.1, VII1.2 or VII.2?

-lne 48: Did you investigate vaccines from this genotype?

Introduction (Background)

-Line 64-65: Cited references (7, 8) does not support this hypothesis?

-Lines 66-71: the NDV classification should be shown according to the updated ICTV classification?

- line 97: studies on papular NDV vaccines in Nepal should be shown.

- lines 101-102: Classification of the vaccine strains virulence including I-2 should be shown. Also, there are studies on the thermo-stability of NDV vaccines and factors that affect vaccine efficacy including I-2 strain and the variability among the different vaccine lots of the same strain. These should be reported here.

- Reference 23 line 109 is an inappropriate reference?

- Lines 110-111: Did you compare the efficiency of these F1 and R2B based vaccines to the current prepared I-2?

- line 113: References took on I-2 only? are there other works on various kinds of NDV vaccines in Nepal? If yes, please highlight it and show its cons.

- Lines 118-123: these look as steps of work not the aim of the study. Please reconstruct to show the main aim of the current study. The authors should clearly state the main objective of the work at the end of the introduction.

Methodology

-Line 129: "the presence of farm personnel" What do you mean by this?

-Line 171: Type of statistic method, program, P value calculation should be described.

-Line 174: "ID screen ELISA for AIV and NDV kits" Could differentiate vaccine strains from virulent strains?

-line 180: "pool of 15 swabs" Is not too much? Too diluted

-lines 235 - 236: " oral and cloacal swabs from two dead chickens" usually swabs collected from alive birds? also, (n=3 ) this stands for what?

-lines 240-241: Could you describe in the detail the preparation process to obtain a tablet and lyophilized forms of live vaccine and references according to which methodology did you do it?

-line 282: "drinking water" why is this route used only for lyophilized formulation only? although in table 3 I can see tablet formulation can be dissolved.

-Lines 288-289: No tablet formulation administrated via drinking water. Why?

-Lines 300 - 305: unclear how did you segregate the birds and how many chickens were sampled?

Results

-Line 347: " All but one farm in ....." as in table 5 one farm in Kailali and one farm in Nawalparasi districts did not receive NDV vaccine.

-Lines 363-364: "All 40 farms vaccinated their stock against at least one of the disease ....." in table 6 only 38 farms not all 40 farms received vaccines, is it right?

-Lines 409 - 410 indicated fragment 2 was amplified for most strains (partial F gene sequences). How long the F gene sequences were obtained to use in Tree drawing? Also, Are there a mutation in amino acids in this region?

-Line 414: How long has the F gene sequence in these 7 NDV (commercial farms=5 and backyard farms=2)? Are there any mutated amino acids observed?

-Line 415: Why the authors did not add the sequences of NDVs from Nepal (as example published in 2000) and I-2 used for vaccine preparation to see a clear picture for the phylogenetic tree?

-Lines 430 - 432: plural used, however, I can see only one sample belongs to Genotype VIIc which is virulent. Figure 10 showed red box that surrounded several NDV strains, what are these and which of them the is target isolate? I can see in the previous publication velogenic strains of NDV from Nepal why the authors did not include here in their analysis to see the virus evolution or genotype variation. Also, the figure is poor quality and resolution and needs to improve.

-Lines 455 - 457: Are the vaccine efficacy differences s 20% and 9% in both ocular and drinking water administration between the two farms in field trials? why?

-Line 460 and line 466: chickens used for field trials are n=2500 in both farms. From where these n=2592 and n=2552 number differences come?

-lines 463-464: is this mortality related to I-2 strain or others?

Discussion

-Discussion section should be one unit without headings or subheadings. Please read the instructions for authors of PlosOne.

-lines 493-495: the meaning is unclear, please reconstruct.

-lines 502-503: please add the number of positive to the total examined beside the percentage.

-Lines 509-510: why the authors did not confirm the pathotypes of NDV, where they sequenced F gene from commercial and backyard samples.

-line 531: authors refer to contact of wild birds with chickens, is this significant?

References

-Several references did not cite well where there is no source for the data as no 3,6, 28, 43, 45 .....etc. Please revise well according to Journal style.

-Several references not related to the research as no 50, 52, 53,57 ...... etc. Please carefully revise your reference list and did not add references just to make a list.

Tables

-Table 1: Total number of farms and samples should be shown. Also, samples from sick birds should be added.

-Table 2: Could you add the fragment position (nt) in the NDV genome and the word fragment in the title row?

-Table 2: the first column means All primers in a single reaction?

-Table 3: Why in vivo trial performed by ocular administration only?

-Table 4: I do not understand this table. Is these birds' separation different than that in figure 4?. Also, you mentioned that a bird is picked up from each section with a total of 12 birds, right? Here too many sampled birds are shown. Could you explain, what is right? In Goldhunga farm, why did not you specify the bird number vaccinated via Ocular in both Tablet and Lyophilized vaccine formulation?

Figures

-Figure 3: please add the nucleotide position for each fragment of the F gene based on NDV genome.

-In Figure 4 legend 70% of chickens received vaccine in DW while in line 290 only 63% of chickens received vaccine in DW. What is the right number?

-Figure 5: I got confused with this figure, what is the significance of sections and quarters? could you simplify your vision by adding group and sub-group numbers to each section and quarter?

-Fig. 9 poor quality can not see, please improve the figure resolution legend please indicate what color (blue, red, and green) mean. How long are the nucleotide sequences

-Figure 12 legend is not descriptive. it should describe the data shown for all groups not only what the authors want to say. in my opinion, both vaccine formulation is similar, is not it? Did you have a significant difference between them?

Reviewer #2: Authors have conducted ND and IAV prevalence study during 2018-19 by collecting samples from 40 commercial and 36 backyard poultry farms from the 10 districts of Nepal. An outbreak was also investigated. Biosamples such as Oral, cloacal and blood samples were pooled and tested for serological and molecular assessment of NDV and IAV. NDV and IAV were detected using multiplex PCR assay. Commercially available ELISA kits were used to detect and quantify ND and Influenza A Nucleoprotein. Three Genotypes I, II and VII c were identified. A thermostable I2 ND vaccine (Ranigoldunga) was developed taking master seed from the University of Queensland, Australia and its Tablet and Lyophilized formulations administered in drinking water and ocular application were evaluated in chicken (Gallus domesticus).

48 (Abstract): The I2 Tablet ND vaccine showed more than 85% efficacy when administered either ocularly or in water, and has stability 50 of 30 days in room temperature.

Tablet form ND vaccine in water is missing in the trial?

141: We collected additional samples from suspected unhealthy or sick birds from commercial (<5 birds) and backyard (< 2 birds) farms prior to our regular random sampling.

Analysis results may be incorporated.

170: Questionnaire used for Biosecurity and biosafety risk assessment in poultry farms is missing?

181: Mention about cloacal swabs in sample processing strategy.

347/358: Description on ELISA as appeared in table 5/6 may be placed in appropriate site.

401: Commercial farms (n= 36) ? Needs correction

503: Justification for variation may be incorporated with reference.

533 & 534: Restructure the sentence to make more meaningful.

561: Replace boiler to broiler

562: More information is required about the vaccine already in use.

General : Additional information on AIV genotyping and Phylogenetic analysis would have added been more informative. Prior to vaccination trial, 1% of the chickens were randomly selected, sampled and screened for NDV and IAV, including some water and feed samples. Results of water and feed samples are missing?

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: Yes: Niranjana Sahoo

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

Attachment

Submitted filename: 82303.pdf

Attachment

Submitted filename: 10.1.1.469.3015.pdf

Attachment

Submitted filename: Sequence_analysis_of_the_cleavage_site-encoding_re.pdf

Attachment

Submitted filename: VaccinationAkeywaytopreventNewcastleDiseaseInPoultryofNepal.pdf

Attachment

Submitted filename: comment.docx

PLoS One. 2023 Mar 10;18(3):e0280688. doi: 10.1371/journal.pone.0280688.r002

Author response to Decision Letter 0


9 Dec 2022

Authors have conducted ND and IAV prevalence study during 2018-19 by collecting samples from 40 commercial and 36 backyard poultry farms from the 10 districts of Nepal. An outbreak was also investigated. Biosamples such as Oral, cloacal and blood samples were pooled and tested for serological and molecular assessment of NDV and IAV. NDV and IAV were detected using multiplex PCR assay. Commercially available ELISA kits were used to detect and quantify ND and Influenza A Nucleoprotein. Three Genotypes I, II and VII c were identified. A thermostable I2 ND vaccine (Ranigoldunga) was developed taking master seed from the University of Queensland, Australia and its Tablet and Lyophilized formulations administered in drinking water and ocular application were evaluated in chicken (Gallus domesticus).

48 (Abstract): The I2 Tablet ND vaccine showed more than 85% efficacy when administered either ocularly or in water, and has stability of 30 days in room temperature. [lines 45-46]

Tablet form ND vaccine in water is missing in the trial?

Response: The method of tablet vaccine delivery is intraocular method thus; it was not tested in drinking water. Administration route of the vaccine has been edited.

141: We collected additional samples from suspected unhealthy or sick birds from commercial (<5 birds) and backyard (< 2 birds) farms prior to our regular random sampling.

Analysis results may be incorporated.

Response: This has been removed

170: Questionnaire used for Biosecurity and biosafety risk assessment in poultry farms is missing?

Response: Questionnaire has been added to supplementary data.

181: Mention about cloacal swabs in sample processing strategy.

Response: Cloacal swab sampling procedure explained in method section (159-162). Cloacal swabs were initially collected as back up samples. But upon literature search and optimization processing, oral swabs seemed most effective and only those were processed. This strategy was followed due to resource constraints.

347/358: Description on ELISA as appeared in table 5/6 may be placed in appropriate site.

Response: Table caption has been edited. ELISA is included in the table to show its correlation with biosecurity measures in the farms. (Table 5/6)

401: Commercial farms (n= 36)? Needs correction

Response: Corrected to Backyard farms (n=36) (373)

503: Justification for variation may be incorporated with reference.

Response: Justification and citation have been added (518-519)

533 & 534: Restructure the sentence to make more meaningful.

Response: Has been edited and justified by the subsequent sentence in line 547 and 549.

561: Replace boiler to broiler

Response: Boiler has been replaced with broiler (543)

562: More information is required about the vaccine already in use.

Response: Corrected and citation has been added (550-552)

General : Additional information on AIV genotyping and Phylogenetic analysis would have added been more informative. Prior to vaccination trial, 1% of the chickens were randomly selected, sampled and screened for NDV and IAV, including some water and feed samples. Results of water and feed samples are missing?

Please use the space provided to explain your Responsewers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: In this study, serological and molecular surveillance for NDV and IAV among commercial and backyard chickens in Nepal was conducted, Also, vaccine preparation from I-2 NDV strain in two forms was performed and their efficacy was investigated in vivo and in the field study. In addition to these, genetic characterization of NDV GVIIc obtained from sick chicken in Nepal was performed. The work is interesting and huge but some points need to fix before publishing.

Major points:-

1- It is extremely important that this manuscript be reviewed for the English language before it gets resubmitted to correct grammar errors, repetition, and typos.

Response – typos have been removed, language and other grammatical errors have been fixed

2- The manuscript needs to reconstruct especially abstract, introduction, and discussion sections

Response – Fixed in manuscript

3- Studies carried out in Nepal to characterize genetically NDV strains and to evaluate vaccine efficacy should be added

Response – studies with molecular characterization of NDV strains have not been published yet, one regarding vaccine efficacy for I-2 has been included [reference #20]

4- References list must be revised carefully which references are related and which one should delete.

Response – Fixed in manuscript

5- Quality and resolution of figures should be improved

Response – fixed in manuscript new figures has been prepared and uploaded.

6- Authors should follow the Journal instruction for authors during the preparation of the revised version.

Response: Those issues has been fixed.

7-The authors should briefly describe in the introduction, the current classification of NDV

Specific points: - Addressed in manuscript

ND is capable of infecting more than 200 species of birds, however, the intensity depends on the host and virus strain. According to Diel et al., NDV is classified into two classes: I and II on the basis of F gene sequence. Class I consists of only one genotype which is avirulent and class II comprises of 15 genotypes (I, II, III, IV, V, VI, VII, VII, IX, X, XI, XII, XIII, XIV and XV). [Genetic diversity of avian paramyxovirus type 1: Proposal for a unified nomenclature and classification system of Newcastle disease virus genotypes https://www.sciencedirect.com/science/article/abs/pii/S1567134812002456?via%3Dihub ] Later, genotypes XVI, XVII, XVIII, XIX, XX and XXI were added to class II which can be found in the latest nomenclature classification system that is used in our study.[Updated unified phylogenetic classification system and revised nomenclature for Newcastle disease virus https://pubmed.ncbi.nlm.nih.gov/31200111/ ] Based on the clinical symptoms, there are five ND virulent pathotype. Class II genotype III NDV were found in Asia, South America, Africa, and Europe. The viruses belonging to this genotype have been identified as velogenic strains. Class II genotype IV NDV were reported in poultry from Africa, Russia, and Europe and in pigeons from Asia. These viruses have been recognized as virulent NDV. Class II genotype V NDVs could be mesogenic or virulent. As per the NDV pandemics, Genotype II, III and IV were responsible for the initial outbreak [Newcastle Disease Viruses Causing Recent Outbreaks Worldwide Show Unexpectedly High Genetic Similarity to Historical Virulent Isolates from the 1940s https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4844730/ ] while the most recent outbreak of NDV was caused by Genotype VII that affected Asia, Africa, Europe and South America. [Insights into Genomic Epidemiology, Evolution, and Transmission Dynamics of Genotype VII of Class II Newcastle Disease Virus in China https://www.mdpi.com/2076-0817/9/10/837 ]

Abstract should be reconstructed and

- line 40: Are these flocks vaccinated? History of vaccination? Is ELISA differentiated between vaccinated and non-vaccinated flocks?

Response: Vaccination information has been addressed in Table 5 and Table 6 for commercial and backyard farms respectively.

-line 41: The big difference between antibody seroprevalence in commercial and backyard account for which reasons?

Response: This is addressed in discussion (lines 475-476) – lack of awareness or access to vaccines among backyard poultry farmers can have direct impact on antibody seroprevalence

-line 41: Genotyped equals strain?

Response: The detected NDV was genotyped using sequencing-based approach (F-gene) to be of genotype II in most of the commercial farms. Genotype I was detected in some backyard farms. Fixed in manuscript

-lne 42: Genotype II or class II

Response: Genotype II, fixed in abstract

-line 43: Genotype I. Which category is virulent or avirulent? Backyards did not receive a live vaccine?

Response: Genotype I is usually avirulent strain distributed globally. Backyard chickens in Nepal usually do not receive vaccines, which was the evident from our questionnaire as well [Table 6]

-lines 43-44: Previous studies did not identify NDV in Nepal until 2021? So, how can conclude the endemicity of NDV?

Response: Our study did not conclusively establish endemicity of NDV but suggested a possibility. Further studies are needed to verify the statement.

-line 45: Genotype VIIc belongs to which VII.1.1, VII1.2 or VII.2?

Response: Genotype VIIc is a sub-genotype of genotype VII.2 as per citation #47

-line 48: Did you investigate vaccines from this genotype?

Response: Vaccine targeting VII.2 specifically is not available in Nepal. Thus, we could not investigate.

Introduction (Background)

-Line 64-65: Cited references (7, 8) does not support this hypothesis?

Response: Fixed (line 61)

-Lines 66-71: the NDV classification should be shown according to the updated ICTV classification?

Response: Fixed. Corrected in the manuscript (62-63)

- line 97: studies on popular NDV vaccines in Nepal should be shown.

Response: These have been mentioned in the manuscript (line 98-106)

- lines 101-102: Classification of the vaccine strains virulence including I-2 should be shown. Also, there are studies on the thermo-stability of NDV vaccines and factors that affect vaccine efficacy including I-2 strain and the variability among the different vaccine lots of the same strain. These should be reported here.

Response: Fixed in manuscript (102-106)

- Reference 23 line 109 is an inappropriate reference?

Response: This is the correct reference – the statement is supported by Table 5 in the paper (line 98)

- Lines 110-111: Did you compare the efficiency of these F1 and R2B based vaccines to the current prepared I-2?

Response: We did not compare the strains as studies have already been published with such comparisons. Also, comparing efficiency of the vaccines strains was no the objective of the study. It was to compare the efficiency of our vaccines with endemic strains of NDV.

- line 113: References took on I-2 only? are there other works on various kinds of NDV vaccines in Nepal? If yes, please highlight it and show its cons.

Response: Information on efficacy of other vaccines is limited as mentioned in references 24 and 25 line (100-102). We compared I-2 strains only as it is the thermostable version of the NDV vaccine. Other strains were not thermostable and thus, were mentioned but not the focus of analysis for this study.

- Lines 118-123: these look as steps of work not the aim of the study. Please reconstruct to show the main aim of the current study. The authors should clearly state the main objective of the work at the end of the introduction.

Response: Fixed in manuscript. (107-113)

Methodology-

-Line 129: "the presence of farm personnel" What do you mean by this?

Response: One of the farm staff was present in sampling site when the sampling procedure was carried out for assisting and supervising. (118)

Response: has been fixed to ‘farm owner or caretaker’ (119)

-Line 171: Type of statistic method, program, P value calculation should be described.

Response: Statistical program has been mentioned in manuscript (line 149)

We did statistical analysis using P-value calculation but these were not significant, hence descriptive analyses were used to provide statistical summary

-Line 174: "ID screen ELISA for AIV and NDV kits" Could differentiate vaccine strains from virulent strains?

Response: These kit alone cannot detect the natural infection from vaccinated ones. The NDVNP kit (BIOVAC used kit) used along with NDV Indirect kit would be able to differentiate natural infection in chickens vaccinated with rHVT-F vaccines only. Similarly, ID Screen® Influenza A Nucleoprotein Indirect used in combination with ID Screen® Influenza H5 Indirect ELISA to detect natural infection in animals vaccinated with recombinant vaccines only (rHVT-H5, RNAm-H5 types).

-line 180: "pool of 15 swabs" Is not too much? Too diluted

Response: Pools of 15 swabs represent a single sample from the same farms. In order to minimize the chance of false negative results, the sample collection technique was very thorough collecting the swabs in 500 ul of VTM and vortexing the swabs thoroughly so that all the virus are mixed properly with the VTM and the cold chain was maintained as per lab standards. Normally 1 VTM tubes contains 3 ml for a single sample but we divided this VTM in a sterile environment for 6 samples. So, 15 swabs from a farm is like collecting 5 samples in a 3ml VTM tube. So, it is not as diluted as it may seem (line 159-160)

-lines 235 - 236: " oral and cloacal swabs from two dead chickens" usually swabs collected from alive birds? also, (n=3 ) this stands for what?

Response: The number of samples collected has been fixed. Collection of swab samples varies depending on the type of investigation (can be alive or dead). In this case, recently dead chickens were sampled. Also 2 dead chickens were sampled (n=2) – which has been fixed in manuscript (220)

-lines 240-241: Could you describe in the detail the preparation process to obtain a tablet and lyophilized forms of live vaccine and references according to which methodology did you do it?

Response: Master seed for I2 strain of NDV was obtained from University of Queensland. The lyophilized and tablet vaccines were developed by BIOVAC as mentioned in lines (223-230).

-line 282: "drinking water" why is this route used only for lyophilized formulation only? although in table 3 I can see tablet formulation can be dissolved.

Response: The method of tablet vaccine delivery will be used as intraocular thus; it was not tested in drinking water. (line 272)

-Lines 288-289: No tablet formulation administrated via drinking water. Why?

Response: Fixed in manuscript (lines 270-272)

-Lines 300 - 305: unclear how did you segregate the birds and how many chickens were sampled?

Response: Segregation of birds and chickens sampled are shown and described in Figure 3 & 4 (new)

Results

-Line 347: " All but one farm in ....." as in table 5 one farm in Kailali and one farm in Nawalparasi districts did not receive NDV vaccine.

Response: Nawalparasi included in the manuscript (line 315).

-Lines 363-364: "All 40 farms vaccinated their stock against at least one of the disease ....." in table 6 only 38 farms not all 40 farms received vaccines, is it right?

Response: The lines (335-336) has been edited in the manuscript.

-Lines 409 - 410 indicated fragment 2 was amplified for most strains (partial F gene sequences). How long the F gene sequences were obtained to use in Tree drawing? Also, Are there a mutation in amino acids in this region?

Response: The F gene sequence obtained to build the phylogenetic tree were 521 bp long partial F gene. F0 cleavage sites is present between 110 -117 amino acid positions whereas the sequenced partial F gene was from 160 amino acid positions onward. (lines 381-385)

-Line 414: How long has the F gene sequence in these 7 NDV (commercial farms=5 and backyard farms=2)? Are there any mutated amino acids observed?

Response: The F gene sequence is around 521 bp long. The BCCHT2_2018 (NCBI accession # MZ087886), NWLP4_2018 (NCBI accession # MZ087887), LTP3_2018 (NCBI accession # MZ087888) and BCDNG1_2018 (NCBI accession # MZ087890)], [SNS4_2018 (NCBI accession # MZ087889)] commercial found sequence had mutation on the 176th position Serine (S) into Alanine (A), 192nd Aspargine (N) to Lysine (K), 201st Threonine(T) into Alanine (A). Same as above comments. (lines 392-397)

-Line 415: Why the authors did not add the sequences of NDVs from Nepal (as example published in 2000) and I-2 used for vaccine preparation to see a clear picture for the phylogenetic tree?

Response: There is a phylogenetic tree showing the relation between vaccine strain (I-2) Figure 8 (New) and observed strain in the field.

-Lines 430 - 432: plural used;; however, I can see only one sample belongs to Genotype VII.2 which is virulent. Figure 10 showed red box that surrounded several NDV strains, what are these and which of them the is target isolate? I can see in the previous publication velogenic strains of NDV from Nepal why the authors did not include here in their analysis to see the virus evolution or genotype variation. Also, the figure is poor quality and resolution and needs to improve.

Response: During the 2021 NDV outbreak we sampled dead chicken whose cause of death was due to NDV and further sequencing the virus led to Genotype VII.2. Two samples were taken but the sequence of only one sample was sequenced. The plural is changed to singular. (407-409)

In the other target isolate obtained from positive NDV screening no virulence cleavage site were sequenced due to which there is no comparison between the target isolates from figure 8(new) which is from screening of chickens all over Nepal.

New figures 8 & 9 are submitted with high resolution and detailed figure description. (400-404)

-Lines 455 - 457: Are the vaccine efficacy differences 20% and 9% in both ocular and drinking water administration between the two farms in field trials? why?

Response: Yes, vaccine efficacy differences 20% and 9% in both ocular and drinking water administration between the two farms in field trials respectively. (448-453). The reason has been included in manuscript

-Line 460 and line 466: chickens used for field trials are n=2500 in both farms. From where these n=2592 and n=2552 number differences come?

Response: This has been fixed. The correct number of chickens used are 2500 in both farms. (444-449)

-lines 463-464: is this mortality related to I-2 strain or others?

Response: This question has been addressed and corresponding data is available in Supplementary tables S8 and S9.

Discussion

-Discussion section should be one unit without headings or subheadings. Please read the instructions for authors of PlosOne.

Response: Fixed in manuscript

-lines 493-495: the meaning is unclear, please reconstruct.

Response: The section has been removed.

-lines 502-503: please add the number of positive to the total examined beside the percentage.

Response: The actual numbers have been added. (480-483)

-Lines 509-510: why the authors did not confirm the pathotypes of NDV, where they sequenced F gene from commercial and backyard samples.

Response: The sequenced F gene failed to recover F1 fragment completely (F0 cleavage site) so we could not decide the respective pathotype except for outbreak investigation Genotype VII.2. To maintain uniformity, we opted for phylogeny-based analysis (genotyping) and did not perform sequence analysis (mutation analysis).

-line 531: authors refer to contact of wild birds with chickens, is this significant?

Response: Wild birds are known to be involved in transmission and spread of poultry diseases – which has been mentioned in discussion along with relevant citation. (507-510)

References

-Several references did not cite well where there is no source for the data as no 3,6, 28, 43, 45 .....etc. Please revise well according to Journal style.

-Several references not related to the research as no 50, 52, 53,57 ...... etc. Please carefully revise your reference list and did not add references just to make a list.

Response: Citations has been reformatted to Plos one format.

Tables

-Table 1: Total number of farms and samples should be shown. Also, samples from sick birds should be added.

Response: This has been removed as they weren’t used in this study.

-Table 2: Could you add the fragment position (nt) in the NDV genome and the word fragment in the title row?

Response: It has been added on table 2.

-Table 2: the first column meResponse All primers in a single reaction?

Response: The first column doesn’t mean primer in a single reaction. Four different reactions were set for fragment 1, 2, 3 & 4 respectively.

-Table 3: Why in vivo trial performed by ocular administration only?

Response: In vivo trial was performed by ocular administration only as per FAO guidelines for testing vaccines in controlled setting to test the vaccine effectiveness so guidelines were followed strictly. Which was a very early state of the vaccine development, administration via water was later tested in field

-Table 4: I do not understand this table. Is these birds' separation different than that in figure 4?. Also, you mentioned that a bird is picked up from each section with a total of 12 birds, right? Here too many sampled birds are shown. Could you explain, what is right? In Goldhunga farm, why did not you specify the bird number vaccinated via Ocular in both Tablet and Lyophilized vaccine formulation?

Response: figure 3(new) shows the segregation of birds in the farm before vaccination and Table 4 shows the breakdown of birds collected for assessment post-vaccination.

Figures

-Figure 3: please add the nucleotide position for each fragment of the F gene based on NDV genome.

Response: It has been added. The number has changed in the revision it is now figure 2 (new).

-In Figure 4 legend 70% of chickens received vaccine in DW while in line 290 only 63% of chickens received vaccine in DW. What is the right number?

Response: The figure depicts 70% were separated for drinking water which was subdivided into two groups one 63% that was actually vaccinated. It is 63% of chickens that received vaccine DW (7% was kept as control: non-vaccinated). It has been mentioned in the figure description.

-Figure 5: I got confused with this figure, what is the significance of sections and quarters? could you simplify your vision by adding group and sub-group numbers to each section and quarter?

Response: The quarters are added to ensure that all chickens have equal chances of getting selected – to minimize selection bias. When collecting chickens, they tend to move around and ones already sampled can get mixed into unsampled group as well. In order to ensure that chicken that has been sampled/vaccinated does not get selected again, the farm was segregated into quarters.

-Fig. 9 poor quality cannot see, please improve the figure resolution legend please indicate what color (blue, red, and green) mean. How long are the nucleotide sequences

Response: This has been fixed in the manuscript.

-Figure 11 legend is not descriptive. it should describe the data shown for all groups not only what the authors want to say. in my opinion, both vaccine formulation is similar, is not it? Did you have a significant difference between them?

Response: The legend has been updated in the figure 10 (new) We did not look for significant differences between the groups or controls as we used antibody titre cut-off as sero-positive and sero-negative. Controls clearly were seronegative (less than 800).

Reviewer #2: Authors have conducted ND and IAV prevalence study during 2018-19 by collecting samples from 40 commercial and 36 backyard poultry farms from the 10 districts of Nepal. An outbreak was also investigated. Biosamples such as Oral, cloacal and blood samples were pooled and tested for serological and molecular assessment of NDV and IAV. NDV and IAV were detected using multiplex PCR assay. Commercially available ELISA kits were used to detect and quantify ND and Influenza A Nucleoprotein. Three Genotypes I, II and VII c were identified. A thermostable I2 ND vaccine (Ranigoldunga) was developed taking master seed from the University of Queensland, Australia and its Tablet and Lyophilized formulations administered in drinking water and ocular application were evaluated in chicken (Gallus domesticus).

48 (Abstract): The I2 Tablet ND vaccine showed more than 85% efficacy when administered either ocularly or in water, and has stability 50 of 30 days in room temperature.

Tablet form ND vaccine in water is missing in the trial?

Response: We did not test tablet vaccine on water, as it is intended to be used via ocular route in backyard chickens.

141: We collected additional samples from suspected unhealthy or sick birds from commercial (<5 birds) and backyard (< 2 birds) farms prior to our regular random sampling.

Analysis results may be incorporated.

Response:

170: Questionnaire used for Biosecurity and biosafety risk assessment in poultry farms is missing?

Response: The questionnaire has been added as supplementary information in separate PDF files.

181: Mention about cloacal swabs in sample processing strategy.

Response: Cloacal swabs were collected but not processed due to budget constraints and also oropharyngeal sample had better sensitivity for detection of NDV and IAV.

347/358: Description on ELISA as appeared in table 5/6 may be placed in appropriate site.

401: Commercial farms (n= 36) ? Needs correction

Response: It has been corrected.

503: Justification for variation may be incorporated with reference.

Response: It has been incorporated.

533 & 534: Restructure the sentence to make more meaningful.

Response: It has been restructured.

561: Replace boiler to broiler

Response: It has been replaced.

562: More information is required about the vaccine already in use.

Response: It has been addressed in background section line 108-116

General: Additional information on AIV genotyping and Phylogenetic analysis would have added been more informative. Prior to vaccination trial, 1% of the chickens were randomly selected, sampled and screened for NDV and IAV, including some water and feed samples. Results of water and feed samples are missing?

________________________________________

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: Yes: Niranjana Sahoo

 

:

Attachment

Submitted filename: rebutal_letter_final_23Nov2022.docx

Decision Letter 1

Shawky M Aboelhadid

26 Dec 2022

PONE-D-22-18860R1Newcastle disease burden in Nepal and efficacy of Tablet I2 vaccine in commercial and backyard poultry productionPLOS ONE

Dear Dr. Dibesh Karmacharya, 

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

==============================

ACADEMIC EDITOR: The manuscript needs minor revision depending on reviewers comments. 

==============================

Please submit your revised manuscript by Feb 09 2023 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Shawky M Aboelhadid, PhD

Academic Editor

PLOS ONE

Journal Requirements:

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: (No Response)

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: (No Response)

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: (No Response)

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: Thank you for your responses although I still have some specific points as following

- Concerning your samples' pooling strategy you mention in response, please include it in text to allow research and readership know how it done.

- Concerning your response for using tablet formulation intraocular only, please insert your guide reference support that.

- Although I can find submitted sequences concerning NDV in Nepal before 2021 I did not agree with you that you study is the first report, please revise that.

- These NDV strains in Nepal are interesting, so categorizing them as velogenic or lentogenic is of great important. i recommend you to try F gene cleavage site sequences or MDT as alternative method to sequence to know their virulence, so your trial will be worth.

- Since you use the primers as separated. Please remove the column "Primer mix" in Table 2

- Quality and resolution of figures themselves still need improvements.

Reviewer #2: Authors have responded well to the reviewer's comments.

Authors may continue this study in the same area to unveil endemic nature of the pathogen among the susceptible hosts including wild fauna.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.<quillbot-extension-portal></quillbot-extension-portal>

PLoS One. 2023 Mar 10;18(3):e0280688. doi: 10.1371/journal.pone.0280688.r004

Author response to Decision Letter 1


2 Jan 2023

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: Thank you for your responses although I still have some specific points as following

- Concerning your samples' pooling strategy you mention in response, please include it in text to allow research and readership know how it done.

Response: Fixed in manuscript (lines 156-164)

- Concerning your response for using tablet formulation intraocular only, please insert your guide reference support that.

Response: The guide reference has been added as a supplementary material

- Although I can find submitted sequences concerning NDV in Nepal before 2021 I did not agree with you that you study is the first report, please revise that.

Response: Fixed in manuscript (line 490)

- These NDV strains in Nepal are interesting, so categorizing them as velogenic or lentogenic is of great important. i recommend you to try F gene cleavage site sequences or MDT as alternative method to sequence to know their virulence, so your trial will be worth.

Response: We have shifted to full length F gene cleavage site-based sequencing. The outbreak investigation of NDV (found to be genotype VII) was carried out with F gene sequencing having cleavage site and is a velogenic strain. However, the old study (nationwide) wide had already been carried out by the time of outbreak and we could not recover full length F gene.

- Since you use the primers as separated. Please remove the column "Primer mix" in Table 2

Response: Fixed in manuscript (line 197)

- Quality and resolution of figures themselves still need improvements.

Reviewer #2: Authors have responded well to the reviewer's comments.

Authors may continue this study in the same area to unveil endemic nature of the pathogen among the susceptible hosts including wild fauna.

________________________________________

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Attachment

Submitted filename: rebutal_letter_final_23Nov2022.docx

Decision Letter 2

Shawky M Aboelhadid

6 Jan 2023

Newcastle disease burden in Nepal and efficacy of Tablet I2 vaccine in commercial and backyard poultry production

PONE-D-22-18860R2

Dear Dr. Karmacharya, 

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Shawky M Aboelhadid, PhD

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

<quillbot-extension-portal></quillbot-extension-portal>

Acceptance letter

Shawky M Aboelhadid

11 Jan 2023

PONE-D-22-18860R2

Newcastle disease burden in Nepal and efficacy of Tablet I2 vaccine in commercial and backyard poultry production

Dear Dr. Karmacharya:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Professor Shawky M Aboelhadid

Academic Editor

PLOS ONE

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    S1 File

    (DOCX)

    S2 File

    (DOCX)

    S3 File

    (PDF)

    Attachment

    Submitted filename: 82303.pdf

    Attachment

    Submitted filename: 10.1.1.469.3015.pdf

    Attachment

    Submitted filename: Sequence_analysis_of_the_cleavage_site-encoding_re.pdf

    Attachment

    Submitted filename: VaccinationAkeywaytopreventNewcastleDiseaseInPoultryofNepal.pdf

    Attachment

    Submitted filename: comment.docx

    Attachment

    Submitted filename: rebutal_letter_final_23Nov2022.docx

    Attachment

    Submitted filename: rebutal_letter_final_23Nov2022.docx

    Data Availability Statement

    All relevant data are within the paper and its Supporting information files.


    Articles from PLOS ONE are provided here courtesy of PLOS

    RESOURCES