Cytokine profiling of samples positive for Chlamydia trachomatis and Human papillomavirus

Larissa Zatorre Almeida Lugo; Marco Antonio Moreira Puga; Camila Mareti Bonin Jacob; Cacilda Tezelli Junqueira Padovani; Mariana Calarge Nocetti; Maisa Souza Tupiná; Ana Flávia Silva Pina; Jennifer Naed Martins de Freitas; Alda Maria Teixeira Ferreira; Carlos Eurico dos Santos Fernandes; Adriane Cristina Bovo; Júlio César Possati Resende; Inês Aparecida Tozetti

doi:10.1371/journal.pone.0279390

. 2023 Mar 10;18(3):e0279390. doi: 10.1371/journal.pone.0279390

Cytokine profiling of samples positive for Chlamydia trachomatis and Human papillomavirus

Larissa Zatorre Almeida Lugo ¹, Marco Antonio Moreira Puga ^1,^*, Camila Mareti Bonin Jacob ², Cacilda Tezelli Junqueira Padovani ², Mariana Calarge Nocetti ³, Maisa Souza Tupiná ⁴, Ana Flávia Silva Pina ⁴, Jennifer Naed Martins de Freitas ¹, Alda Maria Teixeira Ferreira ², Carlos Eurico dos Santos Fernandes ², Adriane Cristina Bovo ⁵, Júlio César Possati Resende ⁶, Inês Aparecida Tozetti ^1,²

Editor: Thomas Forsthuber⁷

¹Postgraduate Program of Infectious and Parasitary Diseases from Medicine School, Federal University of Mato Grosso do Sul, Campo Grande, Mato Grosso do Sul, Brazil

²Bioscience Institute from the Federal University of Mato Grosso do Sul, Campo Grande, Mato Grosso do Sul, Brazil

³Faculdade de Ciências Farmacêuticas, Nutrição e Alimentos, UFMS, Campo Grande, Mato Grosso do Sul, Brazil

⁴Medicine School, Federal University of Mato Grosso do Sul, Campo Grande, Mato Grosso do Sul, Brazil

⁵Department of Cancer Prevention, Barretos Cancer Hospital, Campo Grande, MS, Brazil

⁶Department of Cancer Prevention, Barretos Cancer Hospital, Barretos, São Paulo, Brazil

⁷University of Texas at San Antonio, UNITED STATES

Competing Interests: The authors have declared that no competing interests exist.

^✉

* E-mail: marco.m.puga@gmail.com

Roles

Larissa Zatorre Almeida Lugo: Conceptualization, Data curation, Methodology, Writing – original draft, Writing – review & editing

Marco Antonio Moreira Puga: Data curation, Investigation, Methodology, Supervision, Writing – original draft, Writing – review & editing

Camila Mareti Bonin Jacob: Data curation, Formal analysis, Investigation, Methodology, Visualization, Writing – original draft, Writing – review & editing

Cacilda Tezelli Junqueira Padovani: Conceptualization, Data curation, Investigation, Methodology, Writing – original draft, Writing – review & editing

Mariana Calarge Nocetti: Investigation, Methodology, Writing – original draft, Writing – review & editing

Maisa Souza Tupiná: Investigation, Methodology, Writing – original draft, Writing – review & editing

Ana Flávia Silva Pina: Investigation, Methodology, Writing – original draft, Writing – review & editing

Jennifer Naed Martins de Freitas: Investigation, Methodology, Writing – original draft, Writing – review & editing

Alda Maria Teixeira Ferreira: Conceptualization, Data curation, Investigation, Methodology, Project administration, Supervision, Writing – original draft, Writing – review & editing

Carlos Eurico dos Santos Fernandes: Conceptualization, Data curation, Formal analysis, Supervision, Writing – original draft, Writing – review & editing

Adriane Cristina Bovo: Data curation, Investigation, Methodology, Writing – original draft, Writing – review & editing

Júlio César Possati Resende: Data curation, Investigation, Methodology, Writing – original draft, Writing – review & editing

Inês Aparecida Tozetti: Conceptualization, Data curation, Funding acquisition, Investigation, Methodology, Project administration, Resources, Supervision, Validation, Visualization, Writing – original draft, Writing – review & editing

Thomas Forsthuber: Editor

PMCID: PMC10004564 PMID: 36897879

Abstract

Persistent human papillomavirus (HPV) infection is closely associated with cervical carcinoma. Co-infection in the endocervical environment with other microorganisms, such as Chlamydia trachomatis, may increase the risk of HPV infection and neoplastic progression. While in some individuals, Chlamydia trachomatis infection is resolved with the activation of Th1/IFN-γ-mediated immune response, others develop a chronic infection marked by Th2-mediated immune response, resulting in intracellular persistence of the bacterium and increasing the risk of HPV infection. This work aimed to quantify cytokines of the Th1/Th2/Th17 profile in exfoliated cervix cells (ECC) and peripheral blood (PB) of patients positive for Chlamydia trachomatis DNA, patients positive for Papillomavirus DNA, and healthy patients. Cytokine levels were quantified by flow cytometry in ECC and PB samples from patients positive for C. trachomatis DNA (n = 18), patients positive for HPV DNA (n = 30), and healthy patients (n = 17) treated at the Hospital de Amor, Campo Grande-MS. After analysis, a higher concentration of IL-17, IL-6, and IL-4 (p <0.05) in ECC; INF-γ and IL-10 (p <0.05) in PB was found in samples from patients positive for C. trachomatis DNA compared to samples from healthy patients. When comparing samples from patients positive for HPV DNA, there was a higher concentration of cytokines IL-17, IL-10, IL-6, and IL-4 (p <0.05) in ECC and IL-4 and IL-2 (p <0.05) in PB of patients positive for C. trachomatis DNA. These results suggest that induction of Th2- and Th17 mediated immune response occurs in patients positive for C. trachomatis DNA, indicating chronic infection. Our results also demonstrate a high concentration of pro-inflammatory cytokines in ECC of patients positive for C. trachomatis DNA.

Introduction

Maintaining a healthy vaginal microbiota is crucial for protection against Sexually Transmitted Infections (STIs), such as those caused by Chlamydia trachomatis (C. trachomatis) and Human Papillomavirus (HPV) [1]. HPV infection is closely associated with the development of cervical cancer by co-infection with C. trachomatis, which induces a deviation of the immune response to the Th2 profile, favoring the viral infection [2, 3].

Bacterial infection by C. trachomatis is the most common STI in the world, surpassing gonococcal and treponemal infection [4], and poses a major public health concern. Every year, approximately 131 million new cases of genital infection caused by C. trachomatis are diagnosed worldwide, of which 70% are asymptomatic [5]. In individuals who acquire bacterial infection before the age of twenty, recurrence and persistence of the bacterium are observed, and the immunity developed is partially protective, especially against the different serotypes. Successive episodes of infection increase the risk of sequelae and susceptibility to co-infection [6–8].

C. trachomatis shows tropism for cervical columnar epithelium, and although infection usually begins in the endocervix, the bacterium can be found at other sites, such as the vaginal canal and fallopian tube [6, 9]. The development cycle is biphasic, with the coexistence of two distinct morphological forms, the elementary body (EB) and the reticulate body (RB) [6].

After infection, antigen-presenting cells (APC) recognize the bacteria at the site of infection and initiate the release of pro-inflammatory cytokines, such as IFN-γ and IL-12. These cytokines, in turn, activate Natural Killer (NK) cells and induce the activation of CD8+ and CD4+ T-cells. The CD4+ effector T-lymphocytes, through the production of cytokines, help activate different immune response profiles. The expected immune response profile to C. trachomatis is mediated by Th1 lymphocytes, responsible for activating B lymphocytes and their subsequent differentiation into plasma cells, secreting specific antibodies against C. trachomatis. However, in some cases, due to the biphasic bacterial cycle, deviation in the immunological response towards the Th2 profile (increased levels of IL-4 and IL-6), which correlates to a poor infection prognosis, may occur [7].

A co-infection with other microorganisms, such as HPV, can facilitate the deviation to Th2-type immune response, which may result in the potentiation of a viral and bacterial infection or even an HPV-dependent progression to carcinogenesis. Co-infection with C. trachomatis and HPV may lead to increased expression of Ki-67 (a marker for cell proliferation) and E6 and E7 proteins (HPV oncoproteins), in addition to immune modulation by inhibiting apoptosis [8]. In relation to HPV infection, a predominance of Th1 polarization is expected, with the production of IFN-γ which is important for viral elimination and control of neoplastic progression [10, 11]. Polarization of the immune response towards Th2-type (IL-4, IL-5, IL-10, and IL-13) favors viral persistence and in cases of co-infection, bacterial elimination is compromised [12, 13].

During the last few years, the role of the Th17 response profile in the resolution of HPV infections and C. trachomatis has been investigated [14–16]. Studies show that mice infected with C. trachomatis that do not produce IL-17 generate an immunological response predominated by the Th1/ IFN-γ pathway. However, those deficient in the production of IFN-γ and infected by this same bacterium display higher levels of IL-17 [17]. Given that the change in cytokine profile may be associated with the prevalence of bacterial infection and a poorer prognosis, the present study aimed to quantify the levels of cytokines IL-2, IL-4, IL-6, IL-10, IL-17A, INF- γ, and TNF in peripheral blood and exfoliated cervical cell (ECCs) of patients positive for C. trachomatis DNA and compare them with patients positive and negative for HPV DNA. In this way, we will be able to understand more about the interaction between the immune response and these two microorganisms, if the cervical or systemic microenvironment can somehow influence viral persistence and if the presence of C. Trachomatis can modulate this environment.

Materials and methods

Study population and sample collection

A case-control, cross-sectional study was carried out. The samples used in the study were obtained from 493 female patients, aged over 18 years, who reported at the Hospital de Amor (Fundação PIO XII), Campo Grande unit—MS, for cytological examination in July 2016. All patients who agreed to participate in this study signed a written Informed Consent Form. The study was approved by the Research Ethics Committee of the Federal University of Mato Grosso do Sul and the Fundação PIO XII under protocol no. 1468457 and 1635895, respectively.

The case-control study groups comprised samples of exfoliated cervix cells (ECC) and peripheral blood (PB) from eighteen patients positive for Chlamydia trachomatis DNA, thirty HPV DNA-positive patients, and eighteen healthy patients (Chlamydia trachomatis and HPV DNA-negative) selected within the universe of 493 samples. The mean ages were 46.2 years for C. trachomatis DNA-positive patients, 44.7 years for those positive for HPV DNA, and 43.5 years for the healthy group (control group). All groups were negative for anti-HIV and anti-Treponema pallidum antibodies and hepatitis B surface circulating antigen (HBsAg) to exclude systemic and cervical co-infections that could influence cytokine levels.

ECC and PB samples were selected in a non-probabilistic manner for convenience. The collection of ECC samples was performed before the collection of the cytology material, according to the literature [18, 19]. Samples were obtained and processed according to Bonin et al. (2019) [20].

Serum samples for cytokine evaluation and identification of anti-HIV anti-Treponema pallidum antibodies and HBsAg were collected by venous puncture. These samples were processed to obtain the serum, then divided into aliquots and stored at -80°C until further processing.

All 493 samples were submitted to the following sequence of tests.

Detection of human papillomavirus and β-globin

PCR was performed using the samples to detect HPV DNA with primers PGMY 09/11 [21] and β-globin with primers PC04/GH20 [22]. HPV-positive samples were subjected to viral genotyping by the type-specific PCR (TS-PCR) technique to determine high-risk HPV (HR-HPV) types i.e. HPV-16, 18, 31, 33, and 45, and low-risk HPV (LR-HPV) types i.e. HPV-6 and 11. Samples that could not have their viral type determined by TS-PCR were subjected to Restriction Fragment Length Polymorphism (RFLP) with enzymes DdeI, HaeIII, RsaI, and PstI. The restriction fragments were visualized in 1.5% and 3.0% agarose gel with ethidium bromide staining to visualize DNA under ultraviolet light. Molecular weights were determined by comparing with a 100 bp DNA ladder. Finally, Sanger sequencing was carried out for samples that could not be genotyped by other techniques, using the equipment ABI-Prism 3500 Genetic Analyzer (Applied Biosystems, Foster City, California, USA), with the entire protocol following Bonin et al. (2019) [20].

Detection of Chlamydia trachomatis

For identification of C. trachomatis, all samples positive for amplification of the β-globin gene were subjected to PCR amplification of the 241 bp region of the bacterial genome. Following the methodology of Santos et al. (2003) [23], the primers KL1-5’ TCCGGAGCGAGTTACGAAGA 3’ and KL2-5’ AATCAATGCCCGGGATTGGT 3’ were used.

To 45 μL of PCR solution prepared from each sample, 5 μL of 50 ng/μL DNA was added. The reaction was processed in a thermocycler programmed for 94°C for 5 minutes for denaturation and then for 25 cycles of 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 30 seconds. After 25 cycles, a final extension at 72°C was carried out for 7 minutes. The PCR products were visualized in 1.5% and 3.0% agarose gel with ethidium bromide staining to visualize DNA under ultraviolet light. Molecular weights were determined by comparing with a 100 bp DNA ladder.

Detection of anti-HIV1 and 2, anti-Treponema pallidum and HBsAg antibodies

The determination of infections caused by human immunodeficiency virus (HIV), hepatitis B (HBV), and Treponema pallidum, the causative agent of syphilis, was carried out by the following rapid tests: HIV Test Bioeasy (Standard Diagnostics, Inc., South Korea), Vikia® HBsAg (Biomerieux, France), and TR DPP Sífilis DUO Bio Manguinhos (Oswaldo Cruz Foundation, Brazil), respectively. All three tests are qualitative, based on immunochromatographic techniques, and approved by the National Health Surveillance Agency (ANVISA) responsible for regulating, controlling, and supervising products and services involving risks to public health in Brazil.

Composition of groups for the case-control study

The groups were divided in ECC (n = 18) and PB samples (n = 16) from C. trachomatis DNA-positive patients (n = 18), HPV DNA-positive patients (n = 30), and healthy patients (n = 17) (Chlamydia trachomatis and HPV-DNA negative). All samples were negative for anti-HIV1 and 2, anti-Treponema pallidum, and HBsAg.

Cytokine determination

Cytokine levels were measured in PB and ECC samples of the three groups analyzed: C. trachomatis-positive, HPV-positive, and healthy patients. The cytokines IL-2, IL-4, IL-10, IL-17A, INF-γ, and TNF were quantified using the human Cytokine Bead Array (CBA) Th1/Th2/Th17 (BD Biosciences, San Jose, CA, USA). The preparation of standards, beads, samples, and protocols for configuring the flow cytometer and data acquisition were performed according to the manufacturer’s instructions. The samples were acquired using a FACS Canto II flow cytometer (BD Biosciences, San Jose, CA, USA) and analyzed using the FCAP Array V. 3.0 software (Becton Dickinson, Franklin Lakes, NJ, USA). The results were based on standard concentration curves and expressed in pg/mL.

Statistical analysis

The participants were grouped into positive for C. trachomatis, positive for HPV, and healthy patients. The cytokine levels were expressed as Mean ± standard error (SEM). The Mann-Whitney U test was used to analyze the differences between the HPV group vs. C. trachomatis group and C. trachomatis group vs. healthy patients. Analysis of variance and T test were used between the groups. The results were considered significant when p <0.05. The figures were prepared using the GraphPad Prism 5.0 program (Graph-Pad Software, San Diego, CA, USA).

Results

Socioepidemiological characteristics

The socioepidemiological characterization of the participants in this study is shown in Table 1. Due to the low number of co-infection samples, it was impossible to include the HPV x Chlamydia trachomatis co-infection in analyses (3/25) (S1 Table).

Table 1. Socioepidemiological characteristics of patients treated at the Hospital de Amor, Campo Grande, MS, Brazil.

Chlamydia trachomatis DNA-positive patients (n = 18), HPV DNA positive patients (n = 30), and healthy patients (n = 17).

Variables	C. trachomatis		HPV		No infections
Variables	No.	(%)	No.	(%)	No.	(%)
Number of patients	18		30		17
Average age (range)	43.2 (26–62)		44.7 (26–64)		43.9 (26–64)
Average First sexual intercourse	16.9		17.9		18.9
Condom use
Yes	3	(16.7)	8	(26.6)	3	(14.6)
No	15	(83.3)	22	(73.4)	14	(82.3)
Preventive
More than once a year	2	(11.1)	2	(6.7)	3	(17.6)
Once a year	14	(77.8)	20	(66.7)	9	(52.9)
Less than once a year	2	(11.1)	5	(16.7)	5	(29.5)
Missing	-	-	3	(10.0)	-	-

Open in a new tab

Viral genotyping

Among the HPV-positive samples, the most frequent genotypes were HPV 6/11 (35.5%), HPV 59 (28.8%), and HPV 45 (17.7%); 42.2% of the samples had multiple infections (more than one type of HPV). Fig 1 shows the genotyped HPV and infection by more than one viral type in 40.0% (12/30) samples (Fig 1B). In this figure the viral types are classified as high oncogenic risk (HR-HPV), low oncogenic risk (LR-HPV), and possible high oncogenic risk (found in high and low-risk lesions) [24].

Fig 1 — (a.) Viral HPV types detected in samples with multiple or simple infections (n = 30) and (b.) Frequency of simple and multiple HPV infection (n = 30).

Comparison of cytokine levels in samples positive for C. trachomatis DNA with those in HPV DNA-positive samples

The levels of cytokines INF-γ, TNF, IL-17A, IL-10, IL-6, IL-4, and IL-2 (pg/mL) were measured in PB and ECC samples of 18 C. trachomatis DNA-positive patients. One serum sample was insufficient for analysis, leaving 17 serum samples (mean age 46.2 years). The levels of the same cytokines were measured in PB and ECC of 18 healthy patients (mean age 43.6 years).

Levels of INF-γ (p = 0.004), IL-10 (p = 0.025), and IL-2 (p = 0.009) in PB samples of C. trachomatis DNA-positive patients were higher (n = 16) as compared to that in PB samples from healthy patients (n = 18). As for the cytokines detected in EECs, there was a higher level of IL-17 (p = 0.048), IL-6 (p = 0.019), and IL-4 (p = 0.008) in the C. trachomatis DNA-positive samples (n = 18) as compared to healthy patient samples (n = 18) (Table 2).

Table 2. Cytokine levels in the exfoliated cervical cell (ECC) and peripheral blood (PB) of patients with Chlamydia trachomatis infections and group control (no infections).

Sample	Cytokines	C. tracomatis positive	Healthy patients	Value of p
		(Serum n = 17 ECC n = 18)	(n = 18)
		Mean [pg/mL] ± SEM	Mean [pg/mL] ± SEM
PB	IFN-γ	4.60±0.21	3.7±0.21	0.006
	TNF	5.34±0.44	4.54±0.45	0.205
	IL-17	33.45±4.45	24.45±4.78	0.186
	IL-10	4.73±0.07	4.50±0.07	0.030
	IL-6	3.77±0.39	3.59±0.40	0.752
	IL-4	10.57±3.78	5.06±3.89	0.318
	IL-2	23.23±9.77	2.60±10.05	0.151
ECC	IFN-γ	3.94±0.12	3.75±0.12	0.287
	TNF	5.79±0.88	4.57±0.88	0.334
	IL-17	30.00±3.27	20.49±3.27	0.048
	IL-10	5.51±0.43	4.58±0.42	0.129
	IL-6	200.16±42.88	51.39±42.88	0.019
	IL-4	5.61±0.17	4.93±0.17	0.008
	IL-2	2.60±0.06	2.76±0.06	0.078

Open in a new tab

Note: The results are expressed as mean ± SEM

Mann-Whitney U-test was performed and p <0.05 was considered statistically significant

ECC—exfoliated cervical cells.

Cytokine levels in samples positive for C. trachomatis DNA and in HPV DNA-positive samples

Levels of cytokines INF-γ, TNF, IL-17A, IL-10, IL-6, IL-4e, and IL-2 (pg/mL) were measured in PB and ECC samples of 18 C. trachomatis DNA-positive patients (mean age 43.6 years) and 30 HPV DNA-positive patients (mean age 44.7 years). In the ECC samples, there was a significant increase in the concentrations of IL-17 (p = 0.011), IL-10 (p = 0.027), IL-6 (p = 0.000), and IL-4 (p = 0.002) among C. trachomatis DNA-positive samples when compared to those positive for HPV DNA. However, there was no significant difference in the levels of IFN-γ, TNF, and IL-2 (p> 0.05) between the two groups (Fig 2).

When PB samples were assessed, higher levels of IL-4 (p = 0.020) and IL-2 (p = 0.001) were observed among C. trachomatis DNA-positive samples as compared to HPV DNA-positive samples. There was no significant difference in the levels of the other cytokines (p> 0.05) (Table 3).

Table 3. Cytokine levels in the peripheral blood (PB) samples of patients with Chlamydia trachomatis infections and HPV infection.

Sample	Cytokines	C. trachomatis positive	HPV positive	Value of p
		(n = 17)	(n = 30)
		Mean [pg/mL] ± SEM	Mean [pg/mL] ± SEM
PB	IFN-γ	4.66±0.32	4.23±0.23	0.292
	TNF	5.23±0.46	4.72±0.33	0.378
	IL-17	35.28±7.17	43.39±5.07	0.361
	IL-10	4.69±0.12	4.78±0.08	0.555
	IL-6	3.95±1.76	5.43±1.24	0.498
	IL-4	5.36±0.12	4.98±0.08	0.010
	IL-2	9.00±1.46	2.64±1.03	0.001

Open in a new tab

Note: The results are expressed as mean ± SEM

Mann-Whitney U-test was performed and p <0.05 was considered statistically significant.

Discussion

Persistence of certain infectious microbes such as C. trachomatis in the endocervical epithelium may be associated with neoplastic lesions and infertility [4]. The constant recurrence of C. trachomatis infection is due to change in modulation of the immune response, compromising the response mediated by CD8+ T cells. Any bacterial infection initially elicits an inflammatory response in the host with subsequent activation of the innate immune response, and this response is self-limiting. However, the absence of adequate immune modulation results in chronic inflammation which causes large-scale tissue damage resulting in a site conducive for the entry of new pathogens [7].

HPV is one such pathogen that benefits from lesions in the epithelium and the microenvironment produced during infection by C. trachomatis. The association between HPV and C. trachomatis infection enhances neoplastic transformation, and this may be largely based on the modulation of the immune response. Studies show that infection by C. trachomatis stimulates a Th1-type cellular immune response, which facilitates infection clearance. However, a humoral response (Th2-type) is also observed in a few cases of C. trachomatis infection, which is associated with persistent infection by this bacterium. This modulation of the immune response also favors HPV infection and persistence [17, 25–28]. Additionally, it is also noteworthy that HPV infection modulates the immunological response towards a predominance of Th2-type response (IL-4, IL-5, IL-10, and IL-13), which favors persistence of bacterial infection [12, 29].

Presence of the bacterium C. trachomatis in the cervical microenvironment simultaneously with HPV may aggravate the overall infection. It has been reported that the induction of an inflammatory environment in response to the bacterial infection aggravates HPV infection and increases the chances of neoplastic alteration [25, 28]. Although there are reports indicating that co-infections may increase the chances of progression of HPV infection, there is no way to know which microorganism was the first to infect the epithelium.

The ideal immune response profile for bacterial elimination would be marked by a predominance of Th1 cytokines (IL-12 / IFN-γ) which are responsible for the activation of cellular immunity for elimination of infected cells through the activation of phagocytic cells [33]. However, the presence of pro-inflammatory cytokines, such as IL-6, is related to a higher risk of complications from this infection. Studies show that host cells infected with C. trachomatis release this pro-inflammatory cytokine throughout the growth cycle of C. trachomatis which, along with the release of TNF and IL-10, leads to a poorer prognosis of the infection [30].

In the present study, there was a predominance of Th2 and Th17 response profiles in the samples from patients positive for C. trachomatis DNA. In the ECC samples from patients positive for C. trachomatis DNA, it was possible to observe predominance of the pro-inflammatory cytokines IL-6 and IL-17 in addition to cytokines predominant in the Th2 response (IL-10 and IL-4) (Fig 2). Studies show that IL-10 plays an important role in regulating immune response to infectious agents by suppressing the secretion of pro-inflammatory cytokines and thereby impairing the elimination of pathogens, leading to persistence and worsening of the infection [31]. Monocytes (CD14+ cells) were found to be the main source of IL-10 in individuals with C. trachomatis compared to samples from uninfected, healthy individuals [32]. The mechanisms that regulate IL-10 secretion in C. trachomatis are not completely understood. However, it has been reported that exogenous IL-10 can inhibit the secretion of IL-6, IL-8, and TNF- α in cell line [33]. In the present study, this suppression or alteration in the response profile could have been ineffective since there was a predominance of pro-inflammatory cytokines, such as IL-6, in the infection-induced microenvironment.

The predominance of IL-4 and IL-2 was also observed in the ECC and PB samples from patients positive for C. trachomatis DNA, and these cytokines are predominant in the Th2 response. These results corroborate those found by Vicetti et al. (2013) [34], who demonstrated that peripheral blood mononuclear cells (PBMC) of women infected with C. trachomatis were polarized towards a Th2 response characterized by the production of IL-4 and IL-2.

For bacterial infection caused by C. trachomatis, in addition to the Th1 response, Th17 cells are also associated with reinfection and epithelial injury [16]. In the present study, the concentration of IL-17 was found to be higher in the samples from patients positive for C. trachomatis DNA as compared to samples from healthy patients and HPV DNA-positive patients. The presence of Th17 cells has been associated with some autoimmune diseases and diseases caused by extracellular pathogens, and this response is known to cause potential tissue damage [27]. Studies show an increase in IL-17 levels in the genital tract of women infected with C. trachomatis and gonococci, suggesting that IL-17 production may be induced in response to these pathogens. Some studies also demonstrated that Th17 cells are necessary for host defense against infection by these bacterium [35–38].

Th17 cells are considered potent inducers of autoimmunity by promoting tissue inflammation and activation of the innate immune system [37, 39, 40]. However, in case of HPV co-infection or a worsening of bacterial infection, these inflammatory mediators secreted by Th17 cells may contribute to neoplastic progression by positive regulation of immune suppressive cells of the adaptive and innate immune system as well as the induction of the inflammatory reaction at the site of infection [16, 39].

Differentiation of CD4+ T cells into Th17 subtype is dependent on the expression of the transcription factor RORγt, which is induced by IL-6 and IL-23 cytokines. Thus, the presence of pro-inflammatory IL-6 at the site of infection helps in the differentiation of Th17 cells. This cytokine also induces tissue damage and may facilitate infection by other pathogens due to micro lesions development [40, 41]. The expression level of IL-6 shows a positive correlation with the proportion of Th-17 cells [15]. In the present study, IL-6 levels were also higher in ECC samples from patients positive for C. trachomatis DNA compared to samples from healthy and HPV DNA-positive patients.

IL-6 production is required for an optimal initial host immune response against the bacterium, but a sustained elevated level induces local tissue damage [15, 42]. IL-6 has also been found to be elevated in patients with adverse obstetric outcomes, such as recurrent abortion. There is compelling evidence indicating that altered systemic trans-signaling of IL-6 occurs in women prone to recurrent abortion, with excessive bioavailability of IL-6 potentially inhibiting CD4+ T-regulatory cell generation [15, 41].

Increase in the production of pro-inflammatory cytokines such as IL-6 and IL-17 induced by C. trachomatis infection has shown that chronic inflammatory environment facilitates neoplastic progression by stimulating cell proliferation and secretion of pro-angiogenic and immunosuppressive factors, and thereby contributing both to the onset of HPV infection as well neoplastic progression [25, 28, 41–43].

Pro-inflammatory cytokines can act in conjunction with interferon-γ (IFN-γ), aiding in the activation of phagocytic cells to limit infection. IFN-γ is produced when the elementary bodies (EBs) infect host cells resulting in activation of the immune response which leads to growth inhibition and replication blockage of reticulate bodies (RBs). When C. trachomatis is exposed to IFN-γ, the bacteria stop replicating and remain in latent form, and when the production of IFN-γ decreases, the RBs begin to replicate again, continuing the cycle and reactivating the infection [7, 41].

In the present study, there was no predominance of IFN-γ at the site of infection indicating bacterial replication. However, upon considering the systemic response, there was a predominance of IL-10 and IFN-γ among the PB samples from patients positive for C. trachomatis DNA compared to those from healthy patients. This can be justified by a period of development of the infection or by the presence of other pathogens not identified systemically since IFN-γ, an important participant of the Th1 response, plays a crucial role in host defense against intracellular infection by stimulating cellular immunity to eliminate bacteria and infected cells.

IL-10 was also predominant in serum of C. trachomatis DNA-positive patients. Studies show that this cytokine can act as a protective factor at the systemic level. As reported in other studies, IL-10 was produced at high concentrations in PBMCs of women with normal pregnancy compared to women with a history of unexplained recurrent abortion [44, 45]. Therefore, IL-10 has emerged as an important Th2 cytokine since it is directly involved in regulating Th1 activity, thus playing an essential immunoregulatory role.

Regarding the immune response to C. trachomatis, a predominance of Th1 profile responsible for the activation of phagocytic cells is expected. However, the presence of pro-inflammatory cytokines, such as IL-6, is associated with an increased risk of complications from this infection. Studies show that host cells infected with C. trachomatis release pro-inflammatory cytokines throughout their growth cycle, which together with IL-1b, TNF, and IL-10, are associated with poorer prognosis of the infection [46, 47].

This study is not definitive or conclusive on the subject. Still, it contributes to understanding more about the interaction between the immune response and these two microorganisms, if the cervical or systemic microenvironment can somehow influence viral persistence and if the presence of C. trachomatis can modulate this environment. The work aimed to consider the cytokines produced by the different groups with samples collected from the cervix and blood. However, studies by our group associated immunophenotyping with cytokine dosage to characterize better the patterns obtained. One of these studies is already published [48].

In the present study, we chose to compare the cytokines involved in the immune response to HPV and C. trachomatis, demonstrating the possible potentiating effect that cytokines involved in the Th2 and Th17 response could have on co-infections. However, due to the limited sample size and not being a cohort study, it was not possible to assess the cytokine profile in HPV and Chlamydia trachomatis co-infection and the evolution of the cytokine profile during the infectious process.

Conclusion

There was a predominance of pro-inflammatory cytokines in the samples from patients positive for C. trachomatis DNA, as well as a predominance of Th2 and Th17 cytokine profiles, which could be correlated to poorer prognosis of the bacterial infection. It is emphasized that the local inflammatory processes can cause damage to the epithelium and facilitate entry of other pathogens, for example, infection by HPV, viral persistence, and subsequent neoplastic progression.

Supporting information

S1 Table. Cytokines concentrations from coinfected individuals HPV/Chlamydia.

(PDF)

Click here for additional data file.^{(68.6KB, pdf)}

Acknowledgments

Federal University of Mato Grosso do Sul (UFMS), Ministry of Education and Science (MEC), and the Hospital de Amor, Campo Grande-MS unit.

Data Availability

All relevant data are within the manuscript.

Funding Statement

This work was supported by the Federal University of Mato Grosso do Sul Foundation - UFMS/MEC - Brazil, the National Council for Scientific and Technological Development (CNPq) (Grant number: 406148/2016-3) and the Coordination for the Improvement of Higher Education Personnel (CAPES). This study was financed in part by the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior - Brasil (CAPES) - Finance Code 001. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

1.BROTMAN RM, KLEBANOFF MA, NANSEL TR, et et al. Bacterial vaginosis assessed by gram stain and diminished colonization resistance to incident gonococcal, chlamydial, and trichomonal genitalinfection. J Infect Dis. 2010; 202:1907–1915. [PubMed: doi: 10.1086/657320 ]. [DOI] [PMC free article] [PubMed] [Google Scholar]
2.International Agency for Research on Cancer (IARC). IARC Working Group on the Evaluation of Carcinogenic Risk to Humans. Biological Agents. Lyon (FR): International Agency for Research on Cancer; 2012. (IARC Monographs on the Evaluation of Carcinogenic Risks to Humans, No. 100B.) Human Papillomaviruses. Available from: https://www.ncbi.nlm.nih.gov/books/NBK304347/ [Google Scholar]
3.RODRIGUEZ-CERDEIRA C.; SANCHEZ-BLANCO E.; ALBA A. Evaluation of Association between vaginal infections and high-risk human papillomavirus types in female sex workers in Spain.Obstetrics & Gynecology, ID 240190, 2012. doi: 10.5402/2012/240190 [DOI] [PMC free article] [PubMed] [Google Scholar]
4.SALFA MC, LATINO MA, REGINE V, DE MARIA D, DE INTINIS G, CAMONI L, et al. Prevalence and determinants of Chlamydia trachomatis infection among sexually active women in Turin, Italy. IJPH. 2011;8(3):295–301 [Google Scholar]
5.NEWMAN L, ROWLEY J, VANDER HOORN S, et al. Global estimates of the prevalence and incidence of four curable sexually transmitted infections in 2012 based on systematic review and global reporting. PLoS One 2015;10:e0143304. doi: 10.1371/journal.pone.0143304 [DOI] [PMC free article] [PubMed] [Google Scholar]
6.Hammerschlag MR. The intracellular life of chlamydiae. Seminars in Pediatric Infectious Diseases. 2002;13(4):239–248. doi: 10.1053/spid.2002.127201 [DOI] [PubMed] [Google Scholar]
7.Redgrove K A., McLaughlin E A. The Role of the Immune Response in Chlamydia trachomatis Infection of the Male Genital Tract: A DoubleEdged Sword. Front Immunol [Internet]. 2014;5(October):1–22. Available from: http://journal.frontiersin.org/article/10.3389/fimmu.2014.00534/abstract. doi: 10.3389/fimmu.2014.00534 [DOI] [PMC free article] [PubMed] [Google Scholar]
8.Robial R, Longatto-Filho A, Roteli-Martins CM, Silveira MF, Stauffert D, Ribeiro GG, et al. (2017) Frequency of Chlamydia trachomatis infection in cervical intraepithelial lesions and the status of cytological p16/Ki-67 dual-staining. Infect Agent Cancer 12:3. doi: 10.1186/s13027-016-0111-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
9.Bébéar C., and de Barbeyrac B. Genital Chlamydia trachomatis infections. Clin Microbiol Infect. 2009;15:4–10. doi: 10.1111/j.1469-0691.2008.02647.x [DOI] [PubMed] [Google Scholar]
10.STELLATO G.; NIEMINEN P.; AHO M.; LEHTINEN T.; LEHTINEN M.; PAAVONEN J. Type 1 cytokine response and treatment outcome of genital HPV lesions.Genitourinary Medicine, v. 73, n.5, p. 387–390, Oct.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
11.SCOTT M.; NAKAGAWA M.; MOSCICKI A. B. Cell-mediated immune response to human papillomavirus infection.Clinical and Diagnostic Laboratory Immunology, v. 8, n. 2, p. 209–20, Mar. 2001. doi: 10.1128/CDLI.8.2.209-220.2001 [DOI] [PMC free article] [PubMed] [Google Scholar]
12.Silva J., Cerqueira F. & Medeiros R. Chlamydia trachomatis infection: implications for HPV status and cervical cancer. Arch Gynecol Obstet 289, 715–723 (2014) doi: 10.1007/s00404-013-3122-3 [DOI] [PubMed] [Google Scholar]
13.Vriend HJ, Bogaards JA, van Bergen JEAM., Brink AATP., van den Broek IVF, Hoebe CJPA., et al. (2015) Incidence and persistence of carcinogenic genital human papillomavirus infections in young women with or without Chlamydia trachomatis co-infection. Cancer Med 4:1589. doi: 10.1002/cam4.496 [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Frazer IH, Thomas R, Zhou J, Leggatt GR, Dunn L, McMillan N, et al. Potential strategies utilized by papillomavirus to evade host immunity. Immunol Rev. 1999. Apr; 168: 131–42.–1598. 10.1002/cam4.496. [DOI] [PubMed] [Google Scholar]
15.Prasad P, Singh N, Das B, Raisuddin S, Dudeja M, Rastogi S. Differential expression of circulating Th1/ Th2/ Th17 cytokines in serum of Chlamydia trachomatis-infected women undergoing incomplete spontaneous abortion. Microbial Pathogenesis, Volume 110, September 2017, Pages 152–158Crossref doi: 10.1016/j.micpath.2017.06.031 [DOI] [PubMed] [Google Scholar]
16.Xue J, Wang Y, Chen C, Zhu X, Zhu H, Hu Y. Effects of Th17 cells and IL-17 in the progression of cervical carcinogenesis with high-risk human papillomavirus infection. Cancer Med 2018; 7:297–306: doi: 10.1002/cam4.1279 [DOI] [PMC free article] [PubMed] [Google Scholar]
17.Scurlock Amy M., Frazer Lauren C., Andrews Charles W. Jr., O’Connell Catherine M., Foote Isaac P., Bailey Sarabeth L., et al. Interleukin-17 Contributes to Generation of Th1 Immunity and Neutrophil Recruitment during Chlamydia muridarum Genital Tract Infection but Is Not Required for Macrophage Influx or Normal Resolution of Infection. Infection and Immunity Feb 2011, 79 (3) 1349–1362; doi: 10.1128/IAI.00984-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
18.Tavares-Murta BM, De Resende AD, Cunha FQ, Murta EF. Local profile of cytokines and nitric oxide in patients with bacterial vaginosis and cervical intraepithelial neoplasia.Eur J Obstet Gynecol Reprod Biol 2008;138:93–9. 38. doi: 10.1016/j.ejogrb.2007.06.015 [DOI] [PubMed] [Google Scholar]
19.Marks MA, Viscidi RP, Chang K, Silver M, Burke A, Howard R, et al. Differences in the concentration and correlation of cervical immune markers among HPV positive and negative perimenopausal women. Cytokine 2011; 56:798–803. 39. doi: 10.1016/j.cyto.2011.09.012 [DOI] [PMC free article] [PubMed] [Google Scholar]
20.Bonin CM, Almeida-Lugo LZ, Rodrigues AS, Tezelli CJ, Silva AFP, Teixeira AMF, et al. Interleukin-17 expression in the serum and exfoliated cervical cells of patients infected with high-risk oncogenic human papillomavirus. CYTOKINE 2019; 120:92–98. doi: 10.1016/j.cyto.2019.04.008 [DOI] [PubMed] [Google Scholar]
21.Gravitt PE, Peyton CI, Alessi TQ, Wheeler CM, Coutle´e F, Hildsheim A, et al. Improved amplification of genital human papillomaviruses. J Clin Microbiol 2000; 38:357–361. doi: 10.1128/JCM.38.1.357-361.2000 [DOI] [PMC free article] [PubMed] [Google Scholar]
22.Bauer HM, Ting Y, Greer CE, Chambers JC, Tashiro CJ, Chimera J, et al. Genital human papillomavirus infection in female university students as determined by a PCR based method. JAMA 1991; 265:472–477. [PubMed] [Google Scholar]
23.Santos C, Teixeira F, Vicente A, Astolfi-Filho S. Detection of Chlamydia trachomatis in endocervical smears of sexually active women in Manaus-AM, Brazil, by PCR. Braz J Infect Dis 2003; 7: 91–5. doi: 10.1590/s1413-86702003000200001 [DOI] [PubMed] [Google Scholar]
24.Doorbar J, Egawa N, Griffin H, Kranjec C, Murakami I. Human papillomavirus molecular biology and disease association. Rev Med Virol. 2015. Mar;25 Suppl 1(Suppl 1):2–23. doi: 10.1002/rmv.1822 ; PMCID: PMC5024016. [DOI] [PMC free article] [PubMed] [Google Scholar]
25.MADELEINE M. M.; ANTTILA T.; SCHWART S. M.; SAIKK P.; LEINONE M.; CART J. J., et al. Risk of cervical cancer associated with Chlamydia Trachomatis antibodies by histology, HPV type and HPV cofactors. International Journal of Cancer, v.120, n.3, p.650–655, Feb. 2007. doi: 10.1002/ijc.22325 [DOI] [PMC free article] [PubMed] [Google Scholar]
26.Simonetti AC, Melo JH, de Souza PR, Bruneska D, de Lima Filho JL. (2009) Immunological’s host profile for HPV and Chlamydia trachomatis, a cervical cancer cofactor. Microbes Infect 11(4):435–442. doi: 10.1016/j.micinf.2009.01.004 [DOI] [PubMed] [Google Scholar]
27.Gillet E, Meys JF, Verstraelen H, Verhelst R, De Sutter P, Temmerman M, et al. (2012) Association between bacterial vaginosis and cervical intraepithelial neoplasia: systematic review and meta-analysis. PLoS One 7(10):e45201. doi: 10.1371/journal.pone.0045201 [DOI] [PMC free article] [PubMed] [Google Scholar]
28.SANTO, I.; AZEVEDO, J.; BORREGO, M. J.; GOMES, J. P.; VERDASCA, N.; PISTA, A. Chlamydia trachomatis infection in patients selected for HPV detection. In: International Papillomavirus Conference and Clinical Workshop, 27. 2011, Berlim.Anais Berlim: The Internationales Congress Centrum Berlin, 2011.
29.Gopalkrishna V; Aggarwal N., Malhotra V.L., Koranne R.V., Mohan V.P., Mittal A., et al. Chlamydia trachomatis and human papillomavirus infection in Indian women with sexually transmitted diseases and cervical precancerous and cancerous lesions. Clinical Microbiology and Infection, Volume 6, Issue 2, 2000, Pages 88–93, ISSN 1198-743X, doi: 10.1046/j.1469-0691.2000.00024.x [DOI] [PubMed] [Google Scholar]
30.Buchholz KR; Stephens RS. The Extracellular Signal-Regulated Kinase/Mitogen-Activated Protein Kinase Pathway Induces the Inflammatory Factor Interleukin-8 following Chlamydia trachomatis Infection. Infection and Immunity Nov 2007, 75 (12) 5924–5929. doi: 10.1128/IAI.01029-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
31.Iyer SS, Cheng G. Role of interleukin 10 transcriptional regulation in inflammation and autoimmune disease. Crit Rev Immunol 2012; 32:23–63. doi: 10.1615/critrevimmunol.v32.i1.30 [DOI] [PMC free article] [PubMed] [Google Scholar]
32.Ohman H, Tiitinen A, Halttunen M, Lehtinen M, Paavonen J, et al. Cytokine polymorphisms and severity of tubal damage in women with Chlamydia-associated infertility. J Infect Dis 2009;199:1353–1359. doi: 10.1086/597620 [DOI] [PubMed] [Google Scholar]
33.Yilma AN, Singh SR, Fairley SJ, Taha MA, Dennis VA. The antiinflammatory cytokine, interleukin-10, inhibits inflammatory mediators in human epithelial cells and mouse macrophages exposed to live and UV-inactivated Chlamydia trachomatis. Mediators Inflamm 2012;2012:1–10. doi: 10.1155/2012/520174 [DOI] [PMC free article] [PubMed] [Google Scholar]
34.Vicetti Miguel RD, Harvey SA, LaFramboise WA, Reighard SD, Matthews DB, Cherpes TL. Human female genital tract infection by the obligate intracellular bacterium Chlamydia trachomatis elicits robust Type 2 immunity. PLoS One. 2013;8(3):e58565. doi: 10.1371/journal.pone.0058565 [DOI] [PMC free article] [PubMed] [Google Scholar]
35.Li Y, Wei C, Xu H, Jia J, Wei Z, Guo R, et al. The Immunoregulation of Th17 in Host against Intracellular Bacterial Infection. Mediators Inflamm. 2018. Mar 19;2018:6587296. doi: 10.1155/2018/6587296 eCollection 2018. [DOI] [PMC free article] [PubMed] [Google Scholar]
36.Harrington L. E., Hatton R. D., Mangan P. R., et al. “Interleukin 17–producing CD4+ effector T cells develop via a lineage distinct from the T helper type 1 and 2 lineages,” Nature Immunology, vol. 6, no. 11, pp. 1123–1132, 2005. doi: 10.1038/ni1254 [DOI] [PubMed] [Google Scholar]
37.Frazer L. C., Scurlock A. M., Zurenski M. A., et al. “IL-23 induces IL-22 and IL-17 production in response to Chlamydia muridarum genital tract infection, but the absence of these cytokines does not influence disease pathogenesis,” American Journal of Reproductive Immunology, vol. 70, no. 6, pp. 472–484, 2013. doi: 10.1111/aji.12171 [DOI] [PMC free article] [PubMed] [Google Scholar]
38.Hou W., Jin Y. H., Kang H. S., and Kim B. S. “Interleukin-6 (IL-6) and IL-17 synergistically promote viral persistence by inhibiting cellular apoptosis and cytotoxic T cell function,” Journal of Virology, vol. 88, no. 15, pp. 8479–8489, 2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
39.Muranski P1, Restifo NP. Adoptive immunotherapy of cancer using CD4(+) T cells. Curr Opin Immunol. 2009. Apr;21(2):200–8. doi: 10.1016/j.coi.2009.02.004 Epub 2009 Mar 13. [DOI] [PMC free article] [PubMed] [Google Scholar]
40.Li W, Murthy AK, Guentzel MN, et al. Antigen-specific CD4+ T cells produce sufficient IFN-gamma to mediate robust protective immunity against genital Chlamydia muridarum infection. J Immunol 2008; 180:3375–82 doi: 10.4049/jimmunol.180.5.3375 [DOI] [PubMed] [Google Scholar]
41.Poston TB, Lee DE, Darville T, Zhong W, Dong L, O’Connell CM, et al. Cervical Cytokines Associated With Chlamydia trachomatis Susceptibility and Protection. J Infect Dis. 2019. Jun 19;220(2):330–339. doi: 10.1093/infdis/jiz087 [DOI] [PMC free article] [PubMed] [Google Scholar]
42.Skwor TA, Atik B, Kandel RP, Adhikari HK, Sharma B, et al. Role of secreted conjunctival mucosal cytokine and chemokine proteins in different stages of trachomatous disease. PLoS Negl Trop Dis 2008;2:e264 doi: 10.1371/journal.pntd.0000264 [DOI] [PMC free article] [PubMed] [Google Scholar]
43.SMITH JS, BOSETTI C, MUNOZ N, HERRERO R, BOSCH FX, ELUF-NETO J, et al. Chamydia tachomatis and invasive cervical câncer: a pooled analysis of the IARC multicentric case-control study. Int j câncer. 2004; 111(3): 431–9. [DOI] [PubMed] [Google Scholar]
44.Ohman H, Tiitinen A, Halttunen M, Birkelund S, Christiansen G, et al. IL-10 polymorphism and cell-mediated immune response to Chlamydia trachomatis. Genes Immun 2006;7:243–249. doi: 10.1038/sj.gene.6364293 [DOI] [PubMed] [Google Scholar]
45.Du K, Zhou M, Li Q, Liu XZ. Chlamydia trachomatis inhibits the production of pro-inflammatory cytokines in human PBMCs through induction of IL-10. J Med Microbiol. 2018. Feb;67(2):240–248. doi: 10.1099/jmm.0.000672 [DOI] [PubMed] [Google Scholar]
46.Rodolfo D. Vicetti Miguel, Stephen A. K. Harvey, William A. LaFramboise, Seth D. Reighard, Dean B. Matthews, and Thomas L. Cherpes. Human Female Genital Tract Infection by the Obligate Intracellular Bacterium Chlamydia trachomatis Elicits Robust Type 2 Immunity. PLoS One. 2013;8(3):e58565. doi: 10.1371/journal.pone.0058565 Epub 2013 Mar 13. [DOI] [PMC free article] [PubMed] [Google Scholar]
47.Rasmussen SJ, Eckmann L, Quayle AJ, Shen L, Zhang YX, Anderson DJ, et al. Secretion of pro-inflammatory cytokines by epithelial cells in response to Chlamydia infection suggests a central role for epithelial cells in chlamydial pathogenesis. J Clin Invest. 1997. Jan 1;99(1):77–87. doi: 10.1172/JCI119136 [DOI] [PMC free article] [PubMed] [Google Scholar]
48.BONIN-JACOB CM, ALMEIDA-LUGO LZ, PUGA MAM, MACHADO AP, PADOVANI CTJ, NOCETI MC, et al. IL-6 and IL-10 in the serum and exfoliated cervical cells of patients infected with high-risk human papillomavirus. PloS One. 2021. Mar 22;16(3):e0248639. doi: 10.1371/journal.pone.0248639 [DOI] [PMC free article] [PubMed] [Google Scholar]

PLoS One. doi: 10.1371/journal.pone.0279390.r001

Decision Letter 0

Thomas Forsthuber

26 Jul 2022

PONE-D-22-04538

Cytokine profiling of samples positive for Chlamydia trachomatis and Human papillomavirus

PLOS ONE

Dear Dr. Puga,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Sep 03 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Thomas Forsthuber

Academic Editor

PLOS ONE

Journal requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf.

2. Please amend your current ethics statement to address the following concerns:

a) Did participants provide their written or verbal informed consent to participate in this study?

b) If consent was verbal, please explain i) why written consent was not obtained, ii) how you documented participant consent, and iii) whether the ethics committees/IRB approved this consent procedure.

3. We note that the grant information you provided in the ‘Funding Information’ and ‘Financial Disclosure’ sections do not match. When you resubmit, please ensure that you provide the correct grant numbers for the awards you received for your study in the ‘Funding Information’ section.

4. Thank you for stating in your Funding Statement:

“This work was supported by the Federal University of Mato Grosso do Sul Foundation - UFMS/MEC - Brazil, the National Council for Scientific and Technological Development (CNPq) (Grant number: 406148/2016-3) and the Coordination for the Improvement of Higher Education Personnel (CAPES). This study was financed in part by the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior - Brasil (CAPES) - Finance Code 001”

Please provide an amended statement that declares *all* the funding or sources of support (whether external or internal to your organization) received during this study, as detailed online in our guide for authors at http://journals.plos.org/plosone/s/submit-now. Please also include the statement “There was no additional external funding received for this study.” in your updated Funding Statement.

Please include your amended Funding Statement within your cover letter. We will change the online submission form on your behalf.

5. Thank you for stating the following in the Acknowledgments Section of your manuscript:

“Federal University of Mato Grosso do Sul (UFMS), Ministry of Education and Science (MEC), and the Hospital de Amor, Campo Grande-MS unit.”

We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.

Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:

Please include your amended statements within your cover letter; we will change the online submission form on your behalf.

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

Reviewer #2: No

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: No

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: In this manuscript, the authors described the quantification of profile of Th1/Th2/Th17 cytokine in exfoliated cervix cells (ECC) and in peripheral blood (PB) of patients positive for Chlamydia trachomatis (Ct) DNA, patients positive for Papillomavirus DNA, and healthy patients. The results replicate other previous published works with some new data to the field. The paper has provided useful information on immune response to important STI pathogens, Ct and HPV. However, a reduced number of samples, the lack of details in patient and sample detections, and the limited interpretations on the results make it hard to draw the strong conclusions. In addition, some reference were displaced or improper. Some comments to improve the quality of this study are as below.

Major Concerns：

Methods:

1. Patients: What is the age range of the individuals?

2. What is the rationale behind the PCR testing HPV together with the human β-globin gene?

3. Lines 166 and 538: a wrong reference (23) for Ct primers and detection.

Results:

1. If could be nice to include the cytokine levels from the individuals that had co-infection of Ct and HPV.

2. Lines 267-268: the tittle was unclear here. Perhaps it should be “comparison of cytokine levels in samples positive for C. trachomatis DNA with those in HPV DNA-positive samples”.

3. Table 2: column 4 “C. tracomatis negative” should be healthy control or no infections?

4. If could be interesting to compare whether the cytokine levels with the individuals that had HPV DNA were different from the healthy controls.

5. Figures 1 and 2 were blurred.

Minor：

1. Lines 77-78: “the elementary body (EB) that is extracellular, metabolically inactive…” this is not true. Recent evidence suggest that EB has low metabolic ability. Omsland A, Sixt BS, Horn M, Hackstadt T.FEMS Microbiol Rev. 2014 Jul;38(4):779-801. doi: 10.1111/1574-6976.12059. Epub 2014 Feb 24.

2. Line 92: use a reference with women study is better.

Reviewer #2: Lugo et al, in the manuscript "Cytokine profiling of samples positive for Chlamydia trachomatis and Human

papillomavirus" profile clinical samples from cohorts of about 500 patients attending an outpatient department in a hospital in Campo Grande, Brazil. Following standard detections and identification, the authors are able to identify cohorts of Chlamydia and HPV positive cohorts of less than 20 cases. Next, using standard immune profiling assays, the authors are able to perform comparative assays. I have a few comments on the study

1. The authors do not provide any innovative reasoning behind the study design and its purpose. Previous studies on similar approaches have been published. While the authors claim that "Co-infection in the endocervical environment with other microorganisms such as Chlamydia trachomatis may increased risk of HPV infection and neoplastic progression.", the study fails to provide any conclusive evidence to this end? The authors need to state the hypothesis and the innovation involved

2. Chlamydial infections are highly prevalent in the young adolescents and sexually active age group whereas the data presented here is from women in a higher age range? The data hence may not be relatable to high incidence age cohorts and the effects of coinfections demonstrated in this study may not be reflective and of clinical significance.

3. Infections have been detected using PCR- how many of these cases had active v previous infection? immune presentation significantly changes in accordance with the status of infection? This data is required.

4. What are the cell types involved in cytokine signatures. Immune cell profiling data is required to be added to make better sense of the source of key cytokines.

5. While statistically significant, certain cytokine levels are marginally higher- how are these differences physiologically relevant? Additional corroborative evidence for the same is required to be added.

6. Minor- figure quality is very poor and needs to be enhanced.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Li Shen

Reviewer #2: Yes: Rishein Gupta

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

Attachment

Submitted filename: In this manuscript 3-21-22.docx

Click here for additional data file.^{(15.3KB, docx)}

PLoS One. 2023 Mar 10;18(3):e0279390. doi: 10.1371/journal.pone.0279390.r002

Author response to Decision Letter 0

16 Sep 2022

Response to Review’s Comments

(Manuscript Number: PONE-D-22-04538

"Cytokine profiling of samples positive for Chlamydia trachomatis and Human papillomavirus" (Original Article)

Dear Editor,

We appreciated all suggestions from reviewers about our manuscript. Please find below the answers to their specific comments/suggestions/queries.

Response to Journal requirements

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf.

Response: The manuscript was reviewed.

2. Please amend your current ethics statement to address the following concerns:

a) Did participants provide their written or verbal informed consent to participate in this study?

Response: We rewrite to stay more clear. “All patients who agreed to participate in this study signed a written Informed Consent Form. The study was approved by the Research Ethics Committee of the Federal University of Mato Grosso do Sul and the Fundação PIO XII under protocol no. 1468457 and 1635895, respectively.” (lines 129-133)

Response: The ‘Funding Information’ is correct. We remove the financial support in the manuscript.

4. Thank you for stating in your Funding Statement:

Please include your amended Funding Statement within your cover letter. We will change the online submission form on your behalf.

Response: We added the information suggested.

5. Thank you for stating the following in the Acknowledgments Section of your manuscript:

“Federal University of Mato Grosso do Sul (UFMS), Ministry of Education and Science (MEC), and the Hospital de Amor, Campo Grande-MS unit.”

Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:

Please include your amended statements within your cover letter; we will change the online submission form on your behalf.

Response: The ‘Funding Information’ is correct. We remove the financial support in the manuscript.

Response to Reviewer #1 Comments

Major Concerns：

Methods:

1. Patients: What is the age range of the individuals?

Response: The range of age is similar in all groups. The range of age was included in table 1 (Line 239).

2. What is the rationale behind the PCR testing HPV together with the human β-globin gene?

Response: Studies have widely used the Multiplex PCR with co-amplification of PGMY09/11 primers to detect HPV DNA and GH20/PCO4 for B-globin (as an internal reaction control) (listed below). This approach allows, in a single step, to carry out amplification of HPV DNA and verification of the quality of the genomic material, optimizing the time for diagnosis, resulting in reagent savings (detection of the PCR product) without losing the quality of the results.

1 - PLoS One 2021 Mar 22;16(3):e0248639. DOI: 10.1371/journal.pone.0248639. eCollection 2021;

2 - J Med Virol . 2014 Feb;86(2):266-71. DOI: 10.1002/jmv.23725. Epub 2013 Sep 5

3 - BMC Pregnancy Childbirth. 2006 Sep 4;6:28. doi: 10.1186/1471-2393-6-28;

4 - Gravitt PE, Peyton CL, Apple RJ, Wheeler CM: Genotyping of 27 human papillomavirus types by using L1 consensus PCR products by a single-hybridization, reverse line blot detection method. J Clin Microbiol. 1998, 36 (10): 3020-3027;

5 - Gravitt PE, Peyton CL, Alessi TQ, Wheeler CM, Coutlee F, Hildesheim A, Schiffman MH, Scott DR, Apple RJ: Improved amplification of genital human papillomaviruses. J Clin Microbiol. 2000, 38 (1): 357-361.;

6 - Fuessel Haws AL, He Q, Rady PL, Zhang L, Grady J, Hughes TK, Stisser K, Konig R, Tyring SK: Nested PCR with the PGMY09/11 and GP5(+)/6(+) primer sets improves detection of HPV DNA in cervical samples. J Virol Methods. 2004, 122 (1): 87-93. 10.1016/j.jviromet.2004.08.007).

3. Lines 166 and 538: a wrong reference (23) for Ct primers and detection..

Response: The reference 23 was changed.

Results:

1. If could be nice to include the cytokine levels from the individuals that had co-infection of Ct and HPV.

Response: “Due to the low number of co-infection samples, it was impossible to include the HPV x Chlamydia trachomatis co-infection in analyses (3/25) (S1 Table)” (Lines 235-237).

2. Lines 267-268: the tittle was unclear here. Perhaps it should be “comparison of cytokine levels in samples positive for C. trachomatis DNA with those in HPV DNA-positive samples”.

Response: The title was rewritten as suggested (Lines 259-261).

3. Table 2: column 4 “C. tracomatis negative” should be healthy control or no infections?

Response: The words “tracomatis negative” were changed to “healthy patients”.

4. If could be interesting to compare whether the cytokine levels with the individuals that had HPV DNA were different from the healthy controls.

Response: A comparison of cytokine levels of HPV-positive patients and healthy controls with these same samples was published in PLoS One. 2021 Mar 22;16(3):e0248639. DOI: 10.1371/journal.pone.0248639. eCollection 2021.

5. Figures 1 and 2 were blurred.

Response: The figures was enhaced.

Minor Concerns：

Response: This information was excluded (Lines 80-82).

2. Line 92: use a reference with women study is better.

Response: We changed the reference 6.

Response to Reviewer #2 Comments

Response: This study is not intended to be definitive or conclusive on the subject, but contribute to understand more about the interaction between the immune response and these two microorganisms, if the cervical or systemic microenvironment can somehow influence viral persistence and if the presence of C. Trachomatis can modulate this environment. We added this information in the introduction section (Lines 117-121).

Response: The age group ranged from 26 to 64 years, with a mean of 44 years. 41,7% of patients aged between 25 and 40 years and 58,3% aged >40 and ≤64 years. The age group of patients included in our study is 25 years or older, as they are seen in health services in Brazil for cervical cancer screening, being submitted to Pap smear and detection of HPV when necessary. According to Beydoun et al., (2010) the prevalence under 25 years is slightly higher, and the differences are influenced by sociodemographic and behavioral factors.

J Women's Health (Larchmt). 2010 Dec;19(12):2183-90. doi: 10.1089/jwh.2010.1975. Epub 2010 Oct 15.

Response: The existence of active or previous infection was not clinically investigated, the presence of CT was verified by the PCR technique, which is considered the gold standard for the diagnosis of this microorganism. When considering the immune response, the presence of this antigen in the cervical tract inevitably culminates in the formation of a specific immune response and production of cytokines in the cervical microenvironment, which can be disseminated systemically. This study is not intended to be definitive or conclusive in the clinic , therefore the aim of the work was to report the differences in the production of cytokines considering the presence of CT.

1)Expert Rev Mol Diagn. 2018 Aug;18(8):739-747. doi: 10.1080/14737159.2018.1498785. Epub 2018 Jul 19.

2)Best Pract Res Clin Obstet Gynaecol. 2002 Dec;16(6):789-99. doi: 10.1053/beog.2002.0322.

3) Clin Vaccine Immunol. 2017 Oct 5;24(10):e00203-17. doi: 10.1128/CVI.00203-17. Print 2017 Oct

4. What are the cell types involved in cytokine signatures. Immune cell profiling data is required to be added to make better sense of the source of key cytokines.

Response: The samples collected from the cervix and blood were not submitted for immunophenotyping but cytokine measurement using the Cytokine Bead Array (CBA) Th1/Th2/Th17 (BD Biosciences, San Jose, CA, USA). The purpose of the work was to consider the cytokines produced by the different groups. Future studies by our group are already considering immunophenotyping associated with cytokine dosage to characterize better the patterns obtained.

Response: Regarding comparing IL-10 and INF-y concentrations in peripheral blood between positive and negative groups for DNA CT, we still observed significant differences in the DNA CT+ group, even with slightly higher levels. The same was observed concerning IL-4 and IL-2 in the ECC among the DNA CT + and DNA CT - groups. Regarding the cytokines IL-6 and IL-17, the results were also statistically significant and in this case the concentrations detected were much higher in DNA CT + patients (levels 50 to 150% higher). We know that the present work, being of a transversal nature, portrays a momentary panel of the systemic immune response and the uterine cervix. However, considering that the immune response occurs over a longer period, the high expression of a continued cytokine, even at slightly higher concentrations, may be sufficient to modulate the immune response profile. Thus, we can infer that the persistence of bacterial infection, due to lack of diagnosis or treatment, can cause an increase in cytokine expression for a sufficient time to modulate the immune response to cellular profiles that do not favor viral elimination.

6. Minor- figure quality is very poor and needs to be enhanced.

Response: The figures was enhaced.

Attachment

Submitted filename: Response to Reviewers.docx

Click here for additional data file.^{(21.5KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0279390.r003

Decision Letter 1

Thomas Forsthuber

17 Oct 2022

PONE-D-22-04538R1Cytokine profiling of samples positive for Chlamydia trachomatis and Human papillomavirusPLOS ONE

Dear Dr. Puga,

Please submit your revised manuscript by Dec 01 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

We look forward to receiving your revised manuscript.

Kind regards,

Thomas Forsthuber

Academic Editor

PLOS ONE

Journal Requirements:

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

Additional Editor Comments:

The authors have revised the manuscript according to the reviewers comments and satisfactorily addressed most of the comments.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #2: Partly

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #2: Yes

**********

6. Review Comments to the Author

Reviewer #2: The authors have made the best attempts to address comments raised by reviewers and have satisfactorily provided responses. However, given the nature of the study design and the limitations therein as indicated by the authors in the revision, it is advised to include a paragraph in the discussion section highlighting study design related caveats and the endeavor to undertake future/ ongoing studies to address them. This will serve as a good start point for other research groups investigation similar pathogens or study designs.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #2: Yes: Rishein Gupta

**********

PLoS One. 2023 Mar 10;18(3):e0279390. doi: 10.1371/journal.pone.0279390.r004

Author response to Decision Letter 1

1 Dec 2022

Response to Review’s Comments

(Manuscript Number: PONE-D-22-04538

"Cytokine profiling of samples positive for Chlamydia trachomatis and Human papillomavirus" (Original Article)

Dear Editor,

We appreciated the suggestion from reviewer about our manuscript. Please find below the answer to his specific comments/suggestions/queries.

Response to Reviewer #2 Comment

1. The authors have made the best attempts to address comments raised by reviewers and have satisfactorily provided responses. However, given the nature of the study design and the limitations therein as indicated by the authors in the revision, it is advised to include a paragraph in the discussion section highlighting study design related caveats and the endeavor to undertake future/ ongoing studies to address them. This will serve as a good start point for other research groups investigation similar pathogens or study designs.

Response: “This study is not intended to be definitive or conclusive on the subject. Still, it contributes to understanding more about the interaction between the immune response and these two microorganisms, if the cervical or systemic microenvironment can somehow influence viral persistence and if the presence of C. Trachomatis can modulate this environment. The work aimed to consider the cytokines produced by the different groups with samples collected from the cervix and blood. However, studies by our group associated immunophenotyping with cytokine dosage to characterize better the patterns obtained. One of these studies is already published [50].” We added this information in the discussion section (Lines 421-429).

Attachment

Submitted filename: Response to Reviewers.docx

Click here for additional data file.^{(13.8KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0279390.r005

Decision Letter 2

Thomas Forsthuber

6 Dec 2022

Cytokine profiling of samples positive for Chlamydia trachomatis and Human papillomavirus

PONE-D-22-04538R2

Dear Dr. Puga,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Thomas Forsthuber

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

PLoS One. doi: 10.1371/journal.pone.0279390.r006

Acceptance letter

Thomas Forsthuber

12 Dec 2022

PONE-D-22-04538R2

Cytokine profiling of samples positive for Chlamydia trachomatis and Human papillomavirus

Dear Dr. Puga:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Thomas Forsthuber

Academic Editor

PLOS ONE

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Table. Cytokines concentrations from coinfected individuals HPV/Chlamydia.

(PDF)

Click here for additional data file.^{(68.6KB, pdf)}

Attachment

Submitted filename: In this manuscript 3-21-22.docx

Click here for additional data file.^{(15.3KB, docx)}

Attachment

Submitted filename: Response to Reviewers.docx

Click here for additional data file.^{(21.5KB, docx)}

Attachment

Submitted filename: Response to Reviewers.docx

Click here for additional data file.^{(13.8KB, docx)}

Data Availability Statement

All relevant data are within the manuscript.

[pone.0279390.ref001] 1.BROTMAN RM, KLEBANOFF MA, NANSEL TR, et et al. Bacterial vaginosis assessed by gram stain and diminished colonization resistance to incident gonococcal, chlamydial, and trichomonal genitalinfection. J Infect Dis. 2010; 202:1907–1915. [PubMed: doi: 10.1086/657320 ]. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0279390.ref002] 2.International Agency for Research on Cancer (IARC). IARC Working Group on the Evaluation of Carcinogenic Risk to Humans. Biological Agents. Lyon (FR): International Agency for Research on Cancer; 2012. (IARC Monographs on the Evaluation of Carcinogenic Risks to Humans, No. 100B.) Human Papillomaviruses. Available from: https://www.ncbi.nlm.nih.gov/books/NBK304347/ [Google Scholar]

[pone.0279390.ref003] 3.RODRIGUEZ-CERDEIRA C.; SANCHEZ-BLANCO E.; ALBA A. Evaluation of Association between vaginal infections and high-risk human papillomavirus types in female sex workers in Spain.Obstetrics & Gynecology, ID 240190, 2012. doi: 10.5402/2012/240190 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0279390.ref004] 4.SALFA MC, LATINO MA, REGINE V, DE MARIA D, DE INTINIS G, CAMONI L, et al. Prevalence and determinants of Chlamydia trachomatis infection among sexually active women in Turin, Italy. IJPH. 2011;8(3):295–301 [Google Scholar]

[pone.0279390.ref005] 5.NEWMAN L, ROWLEY J, VANDER HOORN S, et al. Global estimates of the prevalence and incidence of four curable sexually transmitted infections in 2012 based on systematic review and global reporting. PLoS One 2015;10:e0143304. doi: 10.1371/journal.pone.0143304 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0279390.ref006] 6.Hammerschlag MR. The intracellular life of chlamydiae. Seminars in Pediatric Infectious Diseases. 2002;13(4):239–248. doi: 10.1053/spid.2002.127201 [DOI] [PubMed] [Google Scholar]

[pone.0279390.ref007] 7.Redgrove K A., McLaughlin E A. The Role of the Immune Response in Chlamydia trachomatis Infection of the Male Genital Tract: A DoubleEdged Sword. Front Immunol [Internet]. 2014;5(October):1–22. Available from: http://journal.frontiersin.org/article/10.3389/fimmu.2014.00534/abstract. doi: 10.3389/fimmu.2014.00534 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0279390.ref008] 8.Robial R, Longatto-Filho A, Roteli-Martins CM, Silveira MF, Stauffert D, Ribeiro GG, et al. (2017) Frequency of Chlamydia trachomatis infection in cervical intraepithelial lesions and the status of cytological p16/Ki-67 dual-staining. Infect Agent Cancer 12:3. doi: 10.1186/s13027-016-0111-8 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0279390.ref009] 9.Bébéar C., and de Barbeyrac B. Genital Chlamydia trachomatis infections. Clin Microbiol Infect. 2009;15:4–10. doi: 10.1111/j.1469-0691.2008.02647.x [DOI] [PubMed] [Google Scholar]

[pone.0279390.ref010] 10.STELLATO G.; NIEMINEN P.; AHO M.; LEHTINEN T.; LEHTINEN M.; PAAVONEN J. Type 1 cytokine response and treatment outcome of genital HPV lesions.Genitourinary Medicine, v. 73, n.5, p. 387–390, Oct.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0279390.ref011] 11.SCOTT M.; NAKAGAWA M.; MOSCICKI A. B. Cell-mediated immune response to human papillomavirus infection.Clinical and Diagnostic Laboratory Immunology, v. 8, n. 2, p. 209–20, Mar. 2001. doi: 10.1128/CDLI.8.2.209-220.2001 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0279390.ref012] 12.Silva J., Cerqueira F. & Medeiros R. Chlamydia trachomatis infection: implications for HPV status and cervical cancer. Arch Gynecol Obstet 289, 715–723 (2014) doi: 10.1007/s00404-013-3122-3 [DOI] [PubMed] [Google Scholar]

[pone.0279390.ref013] 13.Vriend HJ, Bogaards JA, van Bergen JEAM., Brink AATP., van den Broek IVF, Hoebe CJPA., et al. (2015) Incidence and persistence of carcinogenic genital human papillomavirus infections in young women with or without Chlamydia trachomatis co-infection. Cancer Med 4:1589. doi: 10.1002/cam4.496 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0279390.ref014] 14.Frazer IH, Thomas R, Zhou J, Leggatt GR, Dunn L, McMillan N, et al. Potential strategies utilized by papillomavirus to evade host immunity. Immunol Rev. 1999. Apr; 168: 131–42.–1598. 10.1002/cam4.496. [DOI] [PubMed] [Google Scholar]

[pone.0279390.ref015] 15.Prasad P, Singh N, Das B, Raisuddin S, Dudeja M, Rastogi S. Differential expression of circulating Th1/ Th2/ Th17 cytokines in serum of Chlamydia trachomatis-infected women undergoing incomplete spontaneous abortion. Microbial Pathogenesis, Volume 110, September 2017, Pages 152–158Crossref doi: 10.1016/j.micpath.2017.06.031 [DOI] [PubMed] [Google Scholar]

[pone.0279390.ref016] 16.Xue J, Wang Y, Chen C, Zhu X, Zhu H, Hu Y. Effects of Th17 cells and IL-17 in the progression of cervical carcinogenesis with high-risk human papillomavirus infection. Cancer Med 2018; 7:297–306: doi: 10.1002/cam4.1279 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0279390.ref017] 17.Scurlock Amy M., Frazer Lauren C., Andrews Charles W. Jr., O’Connell Catherine M., Foote Isaac P., Bailey Sarabeth L., et al. Interleukin-17 Contributes to Generation of Th1 Immunity and Neutrophil Recruitment during Chlamydia muridarum Genital Tract Infection but Is Not Required for Macrophage Influx or Normal Resolution of Infection. Infection and Immunity Feb 2011, 79 (3) 1349–1362; doi: 10.1128/IAI.00984-10 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0279390.ref018] 18.Tavares-Murta BM, De Resende AD, Cunha FQ, Murta EF. Local profile of cytokines and nitric oxide in patients with bacterial vaginosis and cervical intraepithelial neoplasia.Eur J Obstet Gynecol Reprod Biol 2008;138:93–9. 38. doi: 10.1016/j.ejogrb.2007.06.015 [DOI] [PubMed] [Google Scholar]

[pone.0279390.ref019] 19.Marks MA, Viscidi RP, Chang K, Silver M, Burke A, Howard R, et al. Differences in the concentration and correlation of cervical immune markers among HPV positive and negative perimenopausal women. Cytokine 2011; 56:798–803. 39. doi: 10.1016/j.cyto.2011.09.012 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0279390.ref020] 20.Bonin CM, Almeida-Lugo LZ, Rodrigues AS, Tezelli CJ, Silva AFP, Teixeira AMF, et al. Interleukin-17 expression in the serum and exfoliated cervical cells of patients infected with high-risk oncogenic human papillomavirus. CYTOKINE 2019; 120:92–98. doi: 10.1016/j.cyto.2019.04.008 [DOI] [PubMed] [Google Scholar]

[pone.0279390.ref021] 21.Gravitt PE, Peyton CI, Alessi TQ, Wheeler CM, Coutle´e F, Hildsheim A, et al. Improved amplification of genital human papillomaviruses. J Clin Microbiol 2000; 38:357–361. doi: 10.1128/JCM.38.1.357-361.2000 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0279390.ref022] 22.Bauer HM, Ting Y, Greer CE, Chambers JC, Tashiro CJ, Chimera J, et al. Genital human papillomavirus infection in female university students as determined by a PCR based method. JAMA 1991; 265:472–477. [PubMed] [Google Scholar]

[pone.0279390.ref023] 23.Santos C, Teixeira F, Vicente A, Astolfi-Filho S. Detection of Chlamydia trachomatis in endocervical smears of sexually active women in Manaus-AM, Brazil, by PCR. Braz J Infect Dis 2003; 7: 91–5. doi: 10.1590/s1413-86702003000200001 [DOI] [PubMed] [Google Scholar]

[pone.0279390.ref024] 24.Doorbar J, Egawa N, Griffin H, Kranjec C, Murakami I. Human papillomavirus molecular biology and disease association. Rev Med Virol. 2015. Mar;25 Suppl 1(Suppl 1):2–23. doi: 10.1002/rmv.1822 ; PMCID: PMC5024016. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0279390.ref025] 25.MADELEINE M. M.; ANTTILA T.; SCHWART S. M.; SAIKK P.; LEINONE M.; CART J. J., et al. Risk of cervical cancer associated with Chlamydia Trachomatis antibodies by histology, HPV type and HPV cofactors. International Journal of Cancer, v.120, n.3, p.650–655, Feb. 2007. doi: 10.1002/ijc.22325 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0279390.ref026] 26.Simonetti AC, Melo JH, de Souza PR, Bruneska D, de Lima Filho JL. (2009) Immunological’s host profile for HPV and Chlamydia trachomatis, a cervical cancer cofactor. Microbes Infect 11(4):435–442. doi: 10.1016/j.micinf.2009.01.004 [DOI] [PubMed] [Google Scholar]

[pone.0279390.ref027] 27.Gillet E, Meys JF, Verstraelen H, Verhelst R, De Sutter P, Temmerman M, et al. (2012) Association between bacterial vaginosis and cervical intraepithelial neoplasia: systematic review and meta-analysis. PLoS One 7(10):e45201. doi: 10.1371/journal.pone.0045201 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0279390.ref028] 28.SANTO, I.; AZEVEDO, J.; BORREGO, M. J.; GOMES, J. P.; VERDASCA, N.; PISTA, A. Chlamydia trachomatis infection in patients selected for HPV detection. In: International Papillomavirus Conference and Clinical Workshop, 27. 2011, Berlim.Anais Berlim: The Internationales Congress Centrum Berlin, 2011.

[pone.0279390.ref029] 29.Gopalkrishna V; Aggarwal N., Malhotra V.L., Koranne R.V., Mohan V.P., Mittal A., et al. Chlamydia trachomatis and human papillomavirus infection in Indian women with sexually transmitted diseases and cervical precancerous and cancerous lesions. Clinical Microbiology and Infection, Volume 6, Issue 2, 2000, Pages 88–93, ISSN 1198-743X, doi: 10.1046/j.1469-0691.2000.00024.x [DOI] [PubMed] [Google Scholar]

[pone.0279390.ref030] 30.Buchholz KR; Stephens RS. The Extracellular Signal-Regulated Kinase/Mitogen-Activated Protein Kinase Pathway Induces the Inflammatory Factor Interleukin-8 following Chlamydia trachomatis Infection. Infection and Immunity Nov 2007, 75 (12) 5924–5929. doi: 10.1128/IAI.01029-07 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0279390.ref031] 31.Iyer SS, Cheng G. Role of interleukin 10 transcriptional regulation in inflammation and autoimmune disease. Crit Rev Immunol 2012; 32:23–63. doi: 10.1615/critrevimmunol.v32.i1.30 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0279390.ref032] 32.Ohman H, Tiitinen A, Halttunen M, Lehtinen M, Paavonen J, et al. Cytokine polymorphisms and severity of tubal damage in women with Chlamydia-associated infertility. J Infect Dis 2009;199:1353–1359. doi: 10.1086/597620 [DOI] [PubMed] [Google Scholar]

[pone.0279390.ref033] 33.Yilma AN, Singh SR, Fairley SJ, Taha MA, Dennis VA. The antiinflammatory cytokine, interleukin-10, inhibits inflammatory mediators in human epithelial cells and mouse macrophages exposed to live and UV-inactivated Chlamydia trachomatis. Mediators Inflamm 2012;2012:1–10. doi: 10.1155/2012/520174 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0279390.ref034] 34.Vicetti Miguel RD, Harvey SA, LaFramboise WA, Reighard SD, Matthews DB, Cherpes TL. Human female genital tract infection by the obligate intracellular bacterium Chlamydia trachomatis elicits robust Type 2 immunity. PLoS One. 2013;8(3):e58565. doi: 10.1371/journal.pone.0058565 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0279390.ref035] 35.Li Y, Wei C, Xu H, Jia J, Wei Z, Guo R, et al. The Immunoregulation of Th17 in Host against Intracellular Bacterial Infection. Mediators Inflamm. 2018. Mar 19;2018:6587296. doi: 10.1155/2018/6587296 eCollection 2018. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0279390.ref036] 36.Harrington L. E., Hatton R. D., Mangan P. R., et al. “Interleukin 17–producing CD4+ effector T cells develop via a lineage distinct from the T helper type 1 and 2 lineages,” Nature Immunology, vol. 6, no. 11, pp. 1123–1132, 2005. doi: 10.1038/ni1254 [DOI] [PubMed] [Google Scholar]

[pone.0279390.ref037] 37.Frazer L. C., Scurlock A. M., Zurenski M. A., et al. “IL-23 induces IL-22 and IL-17 production in response to Chlamydia muridarum genital tract infection, but the absence of these cytokines does not influence disease pathogenesis,” American Journal of Reproductive Immunology, vol. 70, no. 6, pp. 472–484, 2013. doi: 10.1111/aji.12171 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0279390.ref038] 38.Hou W., Jin Y. H., Kang H. S., and Kim B. S. “Interleukin-6 (IL-6) and IL-17 synergistically promote viral persistence by inhibiting cellular apoptosis and cytotoxic T cell function,” Journal of Virology, vol. 88, no. 15, pp. 8479–8489, 2014. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0279390.ref039] 39.Muranski P1, Restifo NP. Adoptive immunotherapy of cancer using CD4(+) T cells. Curr Opin Immunol. 2009. Apr;21(2):200–8. doi: 10.1016/j.coi.2009.02.004 Epub 2009 Mar 13. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0279390.ref040] 40.Li W, Murthy AK, Guentzel MN, et al. Antigen-specific CD4+ T cells produce sufficient IFN-gamma to mediate robust protective immunity against genital Chlamydia muridarum infection. J Immunol 2008; 180:3375–82 doi: 10.4049/jimmunol.180.5.3375 [DOI] [PubMed] [Google Scholar]

[pone.0279390.ref041] 41.Poston TB, Lee DE, Darville T, Zhong W, Dong L, O’Connell CM, et al. Cervical Cytokines Associated With Chlamydia trachomatis Susceptibility and Protection. J Infect Dis. 2019. Jun 19;220(2):330–339. doi: 10.1093/infdis/jiz087 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0279390.ref042] 42.Skwor TA, Atik B, Kandel RP, Adhikari HK, Sharma B, et al. Role of secreted conjunctival mucosal cytokine and chemokine proteins in different stages of trachomatous disease. PLoS Negl Trop Dis 2008;2:e264 doi: 10.1371/journal.pntd.0000264 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0279390.ref043] 43.SMITH JS, BOSETTI C, MUNOZ N, HERRERO R, BOSCH FX, ELUF-NETO J, et al. Chamydia tachomatis and invasive cervical câncer: a pooled analysis of the IARC multicentric case-control study. Int j câncer. 2004; 111(3): 431–9. [DOI] [PubMed] [Google Scholar]

[pone.0279390.ref044] 44.Ohman H, Tiitinen A, Halttunen M, Birkelund S, Christiansen G, et al. IL-10 polymorphism and cell-mediated immune response to Chlamydia trachomatis. Genes Immun 2006;7:243–249. doi: 10.1038/sj.gene.6364293 [DOI] [PubMed] [Google Scholar]

[pone.0279390.ref045] 45.Du K, Zhou M, Li Q, Liu XZ. Chlamydia trachomatis inhibits the production of pro-inflammatory cytokines in human PBMCs through induction of IL-10. J Med Microbiol. 2018. Feb;67(2):240–248. doi: 10.1099/jmm.0.000672 [DOI] [PubMed] [Google Scholar]

[pone.0279390.ref046] 46.Rodolfo D. Vicetti Miguel, Stephen A. K. Harvey, William A. LaFramboise, Seth D. Reighard, Dean B. Matthews, and Thomas L. Cherpes. Human Female Genital Tract Infection by the Obligate Intracellular Bacterium Chlamydia trachomatis Elicits Robust Type 2 Immunity. PLoS One. 2013;8(3):e58565. doi: 10.1371/journal.pone.0058565 Epub 2013 Mar 13. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0279390.ref047] 47.Rasmussen SJ, Eckmann L, Quayle AJ, Shen L, Zhang YX, Anderson DJ, et al. Secretion of pro-inflammatory cytokines by epithelial cells in response to Chlamydia infection suggests a central role for epithelial cells in chlamydial pathogenesis. J Clin Invest. 1997. Jan 1;99(1):77–87. doi: 10.1172/JCI119136 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0279390.ref048] 48.BONIN-JACOB CM, ALMEIDA-LUGO LZ, PUGA MAM, MACHADO AP, PADOVANI CTJ, NOCETI MC, et al. IL-6 and IL-10 in the serum and exfoliated cervical cells of patients infected with high-risk human papillomavirus. PloS One. 2021. Mar 22;16(3):e0248639. doi: 10.1371/journal.pone.0248639 [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Cytokine profiling of samples positive for Chlamydia trachomatis and Human papillomavirus

Larissa Zatorre Almeida Lugo

Marco Antonio Moreira Puga

Camila Mareti Bonin Jacob

Cacilda Tezelli Junqueira Padovani

Mariana Calarge Nocetti

Maisa Souza Tupiná

Ana Flávia Silva Pina

Jennifer Naed Martins de Freitas

Alda Maria Teixeira Ferreira

Carlos Eurico dos Santos Fernandes

Adriane Cristina Bovo

Júlio César Possati Resende

Inês Aparecida Tozetti

Roles

Abstract

Introduction

Materials and methods

Study population and sample collection

Detection of human papillomavirus and β-globin

Detection of Chlamydia trachomatis

Detection of anti-HIV1 and 2, anti-Treponema pallidum and HBsAg antibodies

Composition of groups for the case-control study

Cytokine determination

Statistical analysis

Results

Socioepidemiological characteristics

Table 1. Socioepidemiological characteristics of patients treated at the Hospital de Amor, Campo Grande, MS, Brazil.

Viral genotyping

Fig 1. Viral genotyping and presence of multiple (by more than one viral type) or simple infections (by a single viral type) of samples from patients treated at Hospital de Amor, Campo Grande, MS, Brazil.

Comparison of cytokine levels in samples positive for C. trachomatis DNA with those in HPV DNA-positive samples

Table 2. Cytokine levels in the exfoliated cervical cell (ECC) and peripheral blood (PB) of patients with Chlamydia trachomatis infections and group control (no infections).

Cytokine levels in samples positive for C. trachomatis DNA and in HPV DNA-positive samples

Fig 2. Cytokine levels (pg/ml) in exfoliated cervical cells (ECC) from Chlamydia trachomatis (C. trachomatis) DNA-positive samples and human papillomavirus (HPV) DNA-positive samples.

Table 3. Cytokine levels in the peripheral blood (PB) samples of patients with Chlamydia trachomatis infections and HPV infection.

Discussion

Conclusion

Supporting information

Acknowledgments

Data Availability

Funding Statement

References

Decision Letter 0

Thomas Forsthuber

Roles

Author response to Decision Letter 0

Decision Letter 1

Thomas Forsthuber

Roles

Author response to Decision Letter 1

Decision Letter 2

Thomas Forsthuber

Roles

Acceptance letter

Thomas Forsthuber

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases