Simple Electric Device to Isolate Nucleic Acids from Whole Blood Optimized for Point of Care Testing of Brain Damage

Abstract

Background:

Detection or monitoring of brain damage is a clinically crucial issue. Nucleic acids in the whole blood can be used as biomarkers for brain injury. Polymerase chain reaction (PCR) which is one of the most commonly used molecular diagnostic assays requires isolated nucleic acids to initiate amplification. Currently used nucleic acid isolation procedures are complicated and require laboratory equipments.

Objective

In this study, we tried to develop a simple and convenient method to isolate nucleic acids from the whole blood sample using a tiny battery-powered electric device. The quality of the isolated nucleic acids should be suitable for PCR assay without extra preparation.

Methods

A plastic device with separation chamber was designed and printed with a 3D printer. Two platinum electrodes were placed on both sides and a battery was used to supply the electricity. To choose the optimal nucleic acid isolation condition, diverse lysis buffers and separation buffers were evaluated, and the duration and voltage of the electricity were tested. Western blot analysis and PCR assay were used to determine the quality of the separated nucleic acids.

Results

2ul of whole blood was applied to the cathode side of the separation chamber containing 78 ul of normal saline. When the electricity at 5 V was applied for 5 min, nucleic acids were separated from segment 1 to 3 of the separation chamber. The concentration of nucleic acids peaked around 7~8 mm from cathode side. PCR assay using the separation buffer as the template was performed successfully both in conventional and realtime PCR methods. The hemoglobin in the whole blood did not show the inhibitory effect in our separation system and it may be due to structural modification of hemoglobin during electric separation.

Conclusion

Our simple electric device can separate nucleic acids from the whole blood sample by applying electricity at 5 V for 5 min. The separation buffer solution taken from the device can be used for PCR assay successfully.

1. INTRODUCTION

Acute brain damage is one of the most critical clinical events with a high economic and social burden [1]. It is mainly caused by many pathologic conditions, including traumatic brain injury, infarction, and hemorrhagic stroke. Currently, imaging tools such as computed tomography (CT) and magnetic resonance imaging (MRI) are the most commonly used methods for diagnosis. It is expected that monitoring blood biomarkers for brain damage can be a beneficial and convenient way to evaluate the degree of damage and provide predictive information about the clinical outcome [2]. Imaging tools and blood monitoring methods can be complementary to each other. Some diagnostic tools using blood protein biomarkers are under development [3] or in the market, such as Abbott's i-STAT™ Alinity™ [4]. Even though Abbott's device is very useful to monitor the hospitalized patients but it is not easy to use this type of device for outpatient people or people at home. If we have any device which can monitor high-risk people at home or visit small clinics where the operation of diagnostic device is limited, more people will reap the benefits. In other studies, nucleic acids in the blood were under investigation [5, 6]. Whole blood is one of the most important sources for in vitro diagnosis and nucleic acids isolated from the blood can be used for diverse molecular diagnostic assays. Considering the higher performance of molecular diagnosis compared with other point of care test (POCT) methods, the need to use molecular diagnostic assays for POCT is supposed to increase, but its use is not common yet [7]. One of the reasons for this limited usage of molecular POCT assays is the lack of a proper sample preparation method. Isolation of nucleic acids is still a critical challenge outside the laboratory. Many approaches have been made to isolate nucleic acids from clinical samples, but most use complicated reagents and devices or need the expertise to manage the procedure. In this study, we suggest a simple and convenient method to isolate nucleic acids from whole blood using a small battery-powered electric device.

2. MATERIALS AND METHODS

2.1. Collection of Blood Sample

Blood samples were provided from Kyungpook National University Hospital (KNUH). Experimental procedure was approved by Ethics Committee and Institutional Review Board of KNUH (KNUH 2018-03-013). All experiments were carried out in accordance with relevant guidelines and regulations. Whole blood was collected, transported, and stored in ethylene-diamine-tetraacetic acid (EDTA)-treated bottles at 4°C when it was used within 24 hours after sampling. Whole blood was used for the experiment or fractionated for further use by centrifugation at 3,000g. Plasma or serum was carefully collected from the EDTA-containing or plain tubes, respectively, and it was transferred into plain polypropylene tubes. Great care was taken to ensure that the buffy coat or blood clot was undisturbed while collecting plasma or serum samples. The plasma or serum samples were stored at -80°C until further processing.

2.2. Reagents

All the reagents unless specifically mentioned were purchased from Sigma-Aldrich (Seoul, South Korea).

2.3. Electric Device

A small and simple plastic electric device was designed using Tinkercad online application (https://www.tink ercad.com/) and made using 3D printer (SMART3D, https://www.smart3d.tech/). The dimension of the separation buffer solution containing the chamber is 2 X 20 X 2 mm (80 ul) while the outer dimension is 10 X 30 X 5 mm. Two platinum wire electrodes (0.2 mm in diameter, 5 mm in length) were placed at both ends of the chamber. The battery was connected to the platinum wires, and an electrical switch was used to control the current. A single 9V rechargeable battery (E-KEEP 9V, 250mAh, Lexel, China) or combination of multiple batteries (BLUETEC Eneloop 1.25V, 800mAh, Bluetec, Korea) was used to supply electricity.

2.4. Isolation of Purified DNA

To find out the optimized separation buffer solution different types of solutions including distilled water, 1X phosphate buffered saline (NaCl, 137mM; KCl, 2.7mM; Na₂PO₄, 4.3mM; KH₂PO₄, 1.4mM, pH 7.2), 1X Tris-acetate EDTA solution (Trizma base, 2.42g; Acetic acid, 0.517g; 1 ml of 0.5M EDTA (pH 8.0) in one liter of distilled water), normal saline (0.9% NaCl in distilled water) were tried and normal saline was selected as the separation buffer. Two types of the electrode, platinum wire and copper wire, were compared and platinum wire was selected. To visualize the movement of deoxyribonucleic acid (DNA), 10 ul of nucleic acid staining solution (ECO dye, BIOFACT, Korea) was mixed with 10 ul of purified genomic DNA solution (30 ng/µl). Then 2 ul of the mixture was loaded into the separation solution on the cathode side of the chamber. Immediately after the application of DNA sample, an electrical switch was turned on under 5 or 9V for 5 min. The chamber (20 mm long) was divided into 4 segments and 1ul of separation buffer solution was taken up from each segment for PCR reaction.

2.5. Isolation of DNA from Whole Blood

Different methods were tried to find out the optimized preparation method for whole blood. First, we tested lysis buffer from QIAamp Blood Mini Kit (51104, Qiagen), 1% Triton X-100 in distilled water, and 0.5% Tween20 in distilled water. After mixing whole blood with these lysis buffers, 2 ul of the mixed solutions were applied to the separation buffer solution in the chamber. In addition to the lysis buffer method, we applied 2 ul of whole blood to the separation buffer solution directly or after incubation for 10 min at 56°C. For these two methods, lysis buffer was not used. Immediately after the application of the sample electrical switch was turned on under 5 or 9V for 5 min. The chamber (20 mm long) was equally divided into 4 segments and 1ul of the solution was taken up using a micropipette from the different location of each segment for PCR reaction.

2.6. Polymerase Chain Reaction (PCR)

PCR kit was purchased from Enzynomics (2X TOPsimple™ DyeMIX (aliquot)–nTaq, Korea), and all the experiments were conducted following the user’s manual provided by the company. Briefly, PCR assay was performed with the following condition. Initial denaturation at 95◦C for 2 min, amplification for 32 cycles (denaturation at 95◦C for 30 sec, annealing at 57◦C for 30 s, and extension at 72◦C for 30 s), and a final elongation step at 72◦C for 5 min. As a template, 1ul of buffer solution taken up from 4 different locations of the chamber was added to PCR reaction mixture. Primer set for the human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene was used. Forward, 5’ GGAGCGAGATCCCTCCAAAAT 3’; Reverse, 5’ GCTGTTGTCATACTTCTCATGG 3’. Amplified PCR products were loaded on 1.5% agarose gel and electrophoresis was done for 50 min at 100V.

2.7. Detection of Hemoglobin with Western Blot Assay

3 ul of separation buffer solution was taken from the chamber and treated with 1.5 ul of protein lysis buffer solution (#9806, Cell Signaling). Protein extraction was done following the manufacture’s protocol. Extracted protein samples were loaded on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gel (#456-1096, Bio-Rad). After electrophoresis (200 V, 40 min), transfer (200 V, 200 mA, 40 min) was made to the nitrocellulose (NC) membrane (GE 10600002, Cytiva). NC membrane was blocked with 1% bovine serum albumin (BSA, A7906, Sigma) in 0.1M Tris-buffered saline (TBS, #28358, Thermo Scientific™) at room temperature. After incubation with anti-human hemoglobin antibody (1:1000 in 1% BSA in TBS solution, ab77125, Abcam) for 1 hour at room temperature, washing was done three times with 0.1M TBS for 10 minutes. After incubation with anti-mouse IgG horseradish peroxidase (HRP)-linked antibody (#7074, Cell Signaling) for 1 hour at room temperature, washing was done three times with 0.1M TBS for 10 minutes. NC membrane was reacted with PicoEPD Western reagent (#EBP1073, ELPIS-BIOTECH) for enhanced chemiluminescence (ECL) reaction. ECL image was taken with Gel Doc system (GDS-200, Optimity, China) and band density was measured with NIH ImageJ software.

2.8. Inhibitory Effect of Hemoglobin on PCR Assay

1 ul of separation buffer solution was taken from the separation chamber and then used as the template for conventional or real-time PCR assays. For real-time PCR assay, TB Green^® Premix Ex Taq™ II kit (TaKaRa) was used with Thermal Cycler Dice^Ⓡ Real Time System TP800 (TaKaRa). Primer set for the human GAPDH gene was used. Briefly, PCR was performed with the following condition. Initial denaturation at 95◦C for 2 min, amplification for 32 cycles (denaturation at 95◦C for 30 sec, annealing at 57◦C for 30 s, and extension at 72◦C for 30 s), and a final elongation step at 72◦C for 5 min). The band density or the result from realtime PCR was compared to measure the inhibitory effect of hemoglobin.

3. RESULTS

3.1. Design of Device

The dimension of separation chamber was tested using different designs and 2 X 2 X 20 mm showed a good result. When the length of the chamber was too long, the time to run the sample took too long and DNA concentration was too diluted along the chamber length. When the width and depth were too large, the result was inconsistent (Fig. 1).

Fig. (1).

Design of the device. The electric device is made by a 3D printer to contain separation buffer solution (2 X 2 X 20 mm) (A). The photo of the device with scale bar (B). Electric circuit of the device (C). The photo of the whole system with battery and switch (D). Two platinum electrodes are placed at both ends of the chamber and electric power is supplied by small battery (5 V or 9 V).

We tested two types of electrode, platinum wire and copper wire. When copper wire was used, it produced a bluish and sticky plug in the middle of the chamber (Fig. 2). Since this copper plug blocked the flow of the separation buffer, we decided not to use copper wire. This plug was not observed when platinum wire was used (Fig. 3).

Fig. (2).

Effect of copper electrode on the separation buffer during electric current. 2 ul of purified DNA solution mixed with Eco dye was loaded in the cathode side of the chamber while electricity was off (A1) and 5 min after electricity was on. The bluish plug was observed in the middle of the chamber (A2). 2 ul of normal saline mixed with ECO dye was loaded in the cathode side of chamber while electricity was off (B1) and 5 min after electricity was on. The bluish plug was observed in the middle of the chamber (B2). The whole process was recorded in movie clips and snap shots are shown here. We concluded that copper electrode is not suitable for our study since it interfered with the movement of nucleic acids.

Fig. (3).

Separation of purified DNA using device with platinum electrode. 2 ul of purified DNA solution mixed with Eco dye was loaded in the cathode side of the chamber while electricity was off (A1) and 5 min after electricity was on (A2) at 5 V. Normal saline mixed with Eco dye was loaded in the chamber while electricity is off (B1) and 5 min after electricity was on (B2) at 5 V. Purified DNA solution mixed with Eco dye was loaded in the chamber while electricity is off (C1) and 5 min after electricity was on (C2) at 9 V. Normal saline mixed with Eco dye was loaded in the chamber while electricity was off (D1) and 5 min after electricity was on (D2) at 9 V. The chamber was filled with normal saline solution. The whole process was recorded in movie clips, and snap shots are shown here. We concluded that the platinum electrode is suitable for our study and the voltage of electricity at 5 V is applied for 5 min.

3.2. Separation of DNA Using Device

To evaluate whether our device can separate DNA, we loaded purified DNA solution which was extracted from whole blood on the cathode side of the chamber. In order to visualize the movement of DNA along the chamber, ECO dye was mixed with DNA solution and observation was made for 5 min. The movement was recorded as a movie clip and snap shots were taken (Fig. 3). After electricity at 5 V was on, the movement of ECO dye mixed with DNA toward anode side was far faster than ECO dye only case. We expected that the minimal movement of ECO dye was caused by diffusion. When current at 9 V was applied, severe bubble formation was observed, and buffer solution was seriously disturbed. To keep the separation buffer solution in a stable condition, we decided to use 5 V.

3.3. Separation Buffer Solution

Since ECO dye does not provide the accurate location of DNA, we evaluated the separation of DNA with PCR in addition to ECO dye observation. 1 ul of separation solution was taken from 4 different segments of the chamber and used as the template for PCR reaction. PCR reaction was done using a primer set targeting GAPDH, one of the housekeeping genes. We tested the different types of separation buffer solutions, including normal saline (0.9% NaCl in distilled water), 1X phosphate buffered saline (PBS, NaCl, 137mM; KCl, 2.7mM; Na₂PO₄, 4.3mM; KH₂PO₄, 1.4mM, pH 7.2), 1X Tris acetate EDTA solution (TAE, Trizma base, 2.42g; Acetic acid, 0.517g; 1 ml of 0.5M EDTA (pH8.0) in one liter of distilled water), and distilled water. In case of normal saline, DNA was detected in segment 1, 2 and 3. The density in segment 1 and 2 was higher than in segment 3. In the case of 1XPBS, DNA was detected in segment 1 and 2. The density in segments 1 and 2 was similar. In the case of 1XTAE, DNA was detected in segments 1 and 2. The density in segment 1 was higher than segment 2. In the case of distilled water, DNA was detected in segments 1 and 2. The density in segment 1 was higher than segment 2. Since normal saline showed the best separation (Fig. 4) we decided to use normal saline as the separation buffer solution.

Fig. (4).

PCR amplification of DNA from the separation buffer solution. 2 ul of purified DNA solution mixed with ECO dye was loaded in the cathode side of the chamber while electricity was on at 5 V for 5 min (A). 1ul of separation buffer solution was taken from each segment and used as the template for PCR reaction. PCR reaction was done and gel electrophoresis of PCR products from 4 segments of the chamber was observed when normal saline (B). 1XPBS (C), 1XTAE (D), and distilled water (E) were used as the separation buffer. In addition, 1 ul of distilled water and 1 ul of genomic DNA solution (1 ng/ul) were used as negative and positive controls for PCR assay. We decided to use normal saline as the separation buffer since it showed wider range of separation covering segment 1 to 3 of the chamber.

3.4. Preparation of Whole Blood Sample

Before separating DNA from the whole blood using an electric device, we treated the whole blood sample with diverse preparation methods. Since most DNAs in the blood are contained inside of the nuclei of white blood cells and small amounts of DNAs exist as cell free DNAs, we expected that special type of lysis buffer or preparation process is essential. Then we tested different types of lysis buffers, including QIAamp Blood Mini Kit (51104, Qiagen) with or without incubation for 10 min at 56°C 1% Triton X-100 in distilled water, and 0.5% Tween20 in distilled water. After preparation of whole blood with these lysis buffers, 2 ul of the processed solutions were applied to the separation buffer solution in the chamber. In addition to lysis buffer methods, we applied 2 ul of whole blood to the separation buffer solution directly or after incubation at 56°C for 10 min. To check the separation of DNA, we observed the movement of ECO dye and measured PCR products using separation buffer solution taken from the chamber as the template of PCR. When whole blood sample was used, we could observe the reddish color in the separation chamber. Due to this red color, observation of ECO dye was not successful especially in case of 1% Triton X-100 treatment and direct application of whole blood. The speed of separation of DNA was a little faster than purified genomic DNA in most cases. However, it was similar in the case of direct application of whole blood without any preparation or after mild heating (Fig. 5). Since this study is focused on developing a straightforward method, we decided to use the application of whole blood directly to the separation buffer solution without any treatment.

Fig. (5).

Separation of DNA from whole blood sample after different preparation steps. Movement of DNA mixed with ECO dye was observed in QIAamp Blood Mini Kit (51104, Qiagen) without (A) and with incubation for 10 min at 56°C (B), 1% Triton X-100 (C), 0.5% Tween20 (D), whole blood without (E) or with incubation for 10 min at 56°C (F) conditions. PCR amplification of DNA in the separation buffer solution taken from QIAamp Blood Mini Kit (51104, Qiagen) without (A) and with incubation for 10 min at 56°C (B), 1% Triton X-100 (C), 0.5% Tween20 (D), whole blood without (E) or with incubation at 56°C for 10 min (F) conditions. Normal saline was used as the final separation buffer. The electricity was on at 5 V for 5 min. 1 ul of distilled water and 1 ul of genomic DNA solution (1 ng/ul) were used as negative and positive controls. We concluded to apply whole blood directly to normal saline, the separation buffer, since it is the most straightforward method and there was no significant difference compared with other preparation methods.

3.5. Separation of Hemoglobin from Whole Blood Using Device

We speculated that the red color observed in the separation chamber was due to hemoglobin spilled from red blood cells. Since hemoglobin is one of the inhibitors of PCR and other nucleic acid amplification assays, we investigated whether hemoglobin can interfere with the separation of DNA or PCR assay in our system. First, the separation of hemoglobin was studied. Then, 3 ul of separation buffer solution was taken from 4 segments of the chamber, and Western blot assay was done to measure the amount of hemoglobin when whole blood was used. Hemoglobin bands (16, 32, 48, and 64 kDa) were observed in segments 1, 2, and 3. The decrease in the total amount of hemoglobin was correlated with the distance and 64 kDa band was not observed in segment 3 (Fig. 6). The movement of hemoglobin demonstrated a similar pattern compared with genomic DNA.

Fig. (6).

Separation of hemoglobin from whole blood sample. 2 ul of whole blood was added to the cathode side of the chamber containing 78 ul of normal saline. 3 ul of separation buffer solution (normal saline) was taken from 4 segments of the separation chamber 5 min after 5 V of electricity. These buffers were used to extract protein. The extracted protein samples were used to measure the amount of hemoglobin with Western blot analysis. The band density from gel image (A) was measured (B) for each segment. We concluded that our separation system can separate different size of hemoglobins and the movement of bigger hemoglobin was delayed.

3.6. Inhibitory Effect of Hemoglobin

Since the distribution of hemoglobin from whole blood demonstrated a similar pattern compared with genomic DNA, we worried that the inhibitory effect of hemoglobin can interfere PCR assay and evaluated the effect of hemoglobin in our system. First, we compared the inhibitory effect of pure hemoglobin by mixing hemoglobin with PCR assay buffer. The hemoglobin concentration was based on the Korean Food and Drug Administration (KFDA) guideline on PCR assay. When pure hemoglobin was added, it attenuated the PCR reaction in a dose-dependent manner (Fig. 7). In another experiment, we mixed pure hemoglobin and purified genomic DNA and separation was done in our device. Separation buffer solution taken from the same segment was used both for Western blot assay to measure the amount of hemoglobin and realtime PCR assay of GAPDH gene simultaneously. Despite the presence of hemoglobin in the separation buffer solution, in contrast to our expectation, PCR was not inhibited by hemoglobin when it was used in our system (Fig. 8). Therefore, we concluded that the separation of nucleic acids from the whole blood sample was successful and the presence of hemoglobin in the separation buffer did not inhibit the PCR assay in our separation system. To investigate how the inhibitory effect by hemoglobin was attenuated, we compared the hemoglobin bands using Western blot analysis. 2 ul of whole blood was added to 78 ul of separation buffer in the chamber and 3ul of separation buffer solution was taken from segment 2 with or without application of electricity (5 V, 5 min). The hemoglobin without the application of electricity showed a strong monomer band at 16 kDa and a weak dimer band at 32 kDa. After electric application, the hemoglobin showed strong tetramer and dimer bands in addition to the monomer band (Fig. 9).

Fig. (7).

Inhibitory effect of pure hemoglobin. 1 ul of genomic DNA solution (10 ng/ul) was used as the template for PCR reaction. Pure hemoglobin was added to PCR reaction mixture and then PCR reaction was done. Gel electrophoresis of PCR products was done to show the inhibitory effect against PCR assay. Concentration of pure hemoglobin was 20 g/dL (1), 10 g/dL (2), 5 g/dL (3), 1 g/dL (4), and 0 g/dL (5). N is negative control (DNA 0 ng/ul). We concluded that pure hemoglobin showed an inhibitory effect on PCR assay when it was mixed with PCR master mix directly.

Fig. (8).

Attenuation of inhibitory effect of hemoglobin. 1 ul of purified genomic DNA solution (30 ng/µl) and 1 ul of pure hemoglobin solution (20 g/dL) were mixed and loaded in the chamber while electricity was on at 5 V for 5 min. 1ul of separation buffer solution was taken from each segment and used as the template for realtime PCR reaction. 3 ul of separation buffer solution was taken from 4 segments and the extracted protein samples were used to measure the amount of hemoglobin with Western blot analysis. The band density from gel image (A) was measured (B) for each segment. The result of realtime PCR from the same segment was shown in (C). We concluded that the inhibitory effect of pure hemoglobin was attenuated when hemoglobin was gone through the separation system since the highest hemoglobin concentration from segment 2 did not show any attenuation of PCR assay result.

Fig. (9).

Modification of hemoglobin. To investigate how the inhibitory effect by hemoglobin was attenuated, we compared the pattern of hemoglobin bands using Western blot analysis. 2 ul of whole blood was added to 78 ul of separation buffer in the chamber and 3ul of separation buffer solution was taken from segment 2 of the separation chamber with (+) or without (-) application of electricity (5 V, 5 min). A separation buffer solution was used to extract protein. The extracted protein was loaded to SDS gel and band density was observed after Western blot analysis. We concluded that our separation system could modify the hemoglobin since the pattern of hemoglobin bands was changed by applying electricity.

4. DISCUSSION

Many cases of the brain damage are caused by acute events such as stroke or traumatic brain injury. Therefore, early detection is vital. Patients with high risk factors need close monitoring of their health condition. In addition, some patients who already have brain damage can be monitored to check their status and get predictive information on their outcomes. Many methods, including radiology imaging and some blood biomarker assays, have been developed and are under clinical use now. But considering the number of patients who need early detection or monitoring, current tools are limited in well-equipped hospitals and cannot cover most of the patients or people at risk. POCT is the way many clinicians and patients prefer to use, but most of the current assays are not accessible to most people with ease. Blood is one of the best sources which can provide rich information about disease and patient. Liquid biopsy is one of the hottest topics in cancer research [8-10]. By detecting cell free nucleic acids from blood, liquid biopsy contributes to many fields of cancer studies, including diagnosis. Some studies tried applying the liquid biopsy concept in stroke diagnosis [11] and traumatic brain injury research [12]. Molecular diagnostic assays finalize the final step of liquid biopsy. Currently molecular diagnostic assays have been developed well enough to be used for POCT purposes especially during COVID-19. But blood sampling and preparation of nucleic acids from whole blood is a key hindrance to using molecular POCT assay. In this study we developed a method which can separate nucleic acids from whole blood sample using a simple device and procedure.

There are approaches which use electricity to separate nucleic acids from clinical samples. For example, isotachophoresis has been studied by many researchers [13, 14] and commercially available instrument is on the market already [15]. This method has advantages and is reliable for sample preparation. But this system is designed for laboratory use and is not accessible in most POCT environments.

One of our concerns during the study was whether the separation buffer solution could be used for subsequent step analysis such as PCR assay since whole blood contains hemoglobin, the PCR inhibitor. Our system did not exclude hemoglobin contamination but PCR assay was not interfered with by the presence of hemoglobin. It is not clear how the contaminant hemoglobin did not inhibit PCR assay but we speculate that electricity might have an influence. When pure hemoglobin was used for PCR assay it demonstrated a dose-dependent inhibition. But when whole blood or hemoglobin was processed by our system, the inhibition disappeared. We hypothesize that electricity during the separation procedure caused structural or functional changes in hemoglobin. This hypothesis is based on our findings during this study. First, electricity caused the lysis of blood cells in the normal saline solution even though the duration was short and the voltage was low. Normal saline usually does not disturb blood cells if other factors are not added. Second, the pattern of hemoglobin bands showed changes after the electricity was applied. Hemoglobin comprises four subunits, each having one polypeptide chain and one heme group [16]. When we did Western blot analysis with whole blood without the application of electricity, the gel image demonstrated 2 bands of different sizes (16 and 32 kDa) and the monomer band was dominant. After the application of electricity, the pattern of bands changed to four bands with different sizes (16, 32, 48, and 64 kDa). This change may be the cause of attenuated inhibition. According to Sidstedt et al., hemoglobin hinders amplification throughout the PCR process by directly affecting the DNA polymerase activity [17]. Moreover, a change in hemoglobin structure may attenuate this direct effect.

The advantages of our method are summarized as follows. First, we used a minimal amount (2 ul) of blood obtained by pricking fingertips. Since blood sugar measuring at home is common to ordinary people, this approach can overcome the first barrier against blood sampling for assay. Second, we used a battery-powered plastic device and this device consisted of simple components. The heaviest and expensive part is rechargeable home batteries. The plastic part can be produced on a large scale at a meager cost. Third, our procedure uses only a tiny volume of normal saline solution compared to most other nucleic acid isolation methods. By using normal saline solution, troubles caused by toxic chemicals can be avoided, and transportation and storage issues can be overcome. Fourth, the quality of nucleic acids isolated is enough for PCR assay. The limitation of this study is that the precise specification of the isolated cell free nucleic acids was not considered. To overcome this limitation, we are planning to investigate further. In the next study, we will provide more data, including the limitation of detection, the quality of isolated nucleic acids, and so on. The trial to enhance the quality and yield of nucleic acid isolation will also be made by modifying the structure of the device.

CONCLUSION

Our simple electric device system can separate nucleic acids from the whole blood sample by applying electricity at 5 V for 5 min. The isolated nucleic acids in the separation buffer solution taken from the device can successfully be used for PCR assay.

LIST OF ABBREVIATIONS

PCR

Polymerase Chain Reaction

CT

Computed Tomography

MRI

Magnetic Resonance Imaging

POCT

Point Of Care Test

KNUH

Kyungpook National University Hospital

EDTA

Ethylene-Diamine-Tetraacetic Acid

DNA

DeoxyriboNucleic Acid

GAPDH

GlyceralDehyde-3-Phosphate DeHydrogenase

SDS-PAGE

Sodium Dodecyl Sulfate PolyAcrylamide Gel Electrophoresis

NC

Nitro Cellulose

BSA

Bovine Serum Albumin

TBS

Tris Buffered Saline

HRP

HorseRadish Peroxidase

ECL

Enhanced ChemiLuminescence

PBS

Phosphate Buffered Saline

TAE

Tris Acetate EDTA Solution

KFDA

Korean Food and Drug Administration

AUTHORS' CONTRIBUTIONS

Conceptualization, HSH; methodology, YML, MJB; validation, YSC, EL and MGK; formal analysis, JC, and DHL; data curation, LMT; writing-original draft preparation, YML; writing-review and editing, GOC, NJYP; visualization, THDN; supervision, HSH; funding acquisition, HSH. All authors have read and agreed to the published version of the manuscript.

ETHICS APPROVAL AND CONSENT TO PARTICIPATE

This study was approved by the Institutional Review Board of Kyungpook National University Hospital, Korea (KNUH 2018-03-013, 10-05-2018).

HUMAN AND ANIMAL RIGHTS

No animals were used for studies that are basis of this research. All the human procedures were followed in accordance with the ethical standards of the committee responsible for human experimentation (institutional and national), and with the Helsinki Declaration of 1975, as revised in 2013 (http://ethics.iit.edu/ecodes/node/3931).

CONSENT FOR PUBLICATION

As Kyungpook National University Hospital takes e-IRB system, all patient consent forms are processed as electronic document without physical signatures.

AVAILABILITY OF DATA AND MATERIALS

Not applicable.

FUNDING

This research was supported by a grant of the Korea Health Technology R&D Project through the Korea Health Industry Development Institute (KHIDI), funded by the Ministry of Health & Welfare, Republic of Korea (grant number: HI15C0001) and Brain Pool Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Science and ICT (grant number: NRF-2020H1D3A2-A02102040).

CONFLICT OF INTEREST

The authors declare no conflict of interest, financial or otherwise.