Skip to main content
NCBI home page
ACS AuthorChoice logoLink to ACS AuthorChoice
. 2023 Feb 13;9(3):1510–1519. doi: 10.1021/acsbiomaterials.2c01141

Expansion Culture of Hair Follicle Stem Cells through Uniform Aggregation in Microwell Array Devices

Sugi Hirano †, Tatsuto Kageyama †,‡, Maki Yamanouchi †, Lei Yan †,‡, Kohei Suzuki †,§, Katsumi Ebisawa ∥, Keiichiro Kasai ⊥, Junji Fukuda †,‡,*
PMCID: PMC10015430  PMID: 36781164

Abstract

graphic file with name ab2c01141_0008.jpg

Hair regeneration using hair follicle stem cells (HFSCs) and dermal papilla cells is a promising approach for the treatment of alopecia. One of the challenges faced in this approach is the quantitative expansion of HFSCs while maintaining their hair induction capacity. In this study, HFSC expansion was achieved through the formation of uniform-diameter cell aggregates that were subsequently encapsulated in Matrigel. We designed a microwell array device, wherein mouse HFSCs were seeded, allowed to form loosely packed aggregates for an hour, and then embedded in Matrigel. Quantitative analysis revealed a 20-fold increase in HFSC number in 2 weeks through this culture device. Gene expression of trichogenic stem cell markers in the device-grown cells showed a significant increase compared with that of typical flat substrate Matrigel suspension culture cells. These microwell array-cultured HFSCs mixed with freshly isolated embryonic mesenchymal cells indicated vigorous hair regeneration on the skin of nude mice. Furthermore, we examined the feasibility of this approach for the expansion of human HFSCs from androgenetic alopecia patients and found that the ratio of CD200+ cells was improved significantly in comparison with that of cells cultured in a typical culture dish or in a Matrigel suspension culture on a flat substrate. Therefore, the novel approach proposed in this study may be useful for HFSC expansion in hair regenerative medicine.

Keywords: regenerative medicine, hair follicle stem cells, polydimethylsiloxane, cell expansion culture, hair follicle germ

1. Introduction

Hair follicles are mini-organs exhibiting composite three-dimensional (3D) structures that contain concentric layers of epithelial cells (hair follicle stem cells (HFSCs), and inner and outer root sheath cells) surrounding the hair shaft and the mesenchymal dermal papilla (DP) at the base of the follicle bulb.1,2 HFSCs are normally quiescent. However, during the early anagen phase, they undergo a transient phase of cell proliferation. HFSCs reside in the bulge area of the hair follicle.3 DP is a highly specialized mesenchymal cell population that provides signals to HFSCs and their progeny, specifying the size and shape of hair follicles.4 HFSCs and DP cells are essential for inducing hair follicle neogenesis in non-hair-bearing skin.5−9 Considering that hair follicle formation is induced by the neogenesis of hair follicle germs (HFGs) through epithelial–mesenchymal cell interactions,1 approaches to prepare tissue grafts that recapitulate these interactions in vitro have been investigated using HFSCs and DP cells for hair follicle regeneration.10−13 A bioengineered HFG, fabricated by the in vitro integration of epithelial and mesenchymal aggregates, indicated efficient regeneration of hair follicles on the back skin of mice.12 Recent studies have reported scalable approaches for the preparation of HFGs10,14−16 as large number of tissue grafts are required for human treatment (>3000 HFGs/patient). However, a major limitation is the lack of a culture system to expand the number of HFSCs necessary for the fabrication of tissue grafts.

The molecular mechanisms underlying the maintenance, proliferation, and differentiation of HFSCs have been studied extensively, and several approaches have been proposed for HFSC expansion. The activation of wingless-type MMTV integration site family member and suppression of bone morphogenetic protein (BMP) initiate the activation of HFSCs, and the subsequent activation of sonic hedgehog (Shh) initiates the differentiation of HFSCs into the progeny that generate the hair shaft.17,18 Several approaches to maintain the hair generation ability of HFSCs in culture have been examined, including the use of these signaling molecules and growth factors,19−22 and 3D culture in biocompatible scaffolds or non-cell-adhesive culture conditions.23−26 In a recent study, using Matrigel-embedded culture, spontaneous bidirectional interconversion of HFSCs and their progeny was replicated in vitro, wherein α6+/CD34+ HFSCs proliferated while maintaining their trichogenous ability.25 A more recent study identified a subpopulation of α6+/CD34+/Itgβ5+ HFSCs responsible for continual hair regeneration.26 Although these studies reveal that Matrigel-embedded culture was useful for the expansion of mouse HFSCs, the proliferated cells, therein, exhibited nonuniform aggregates and single cells. In addition, the applicability of Matrigel-embedded cultures to adult human HFSCs has not yet been examined.

We hypothesized that precise control over initial cell aggregation and distribution in Matrigel would improve the expansion of HFSCs. We fabricated a microwell array device in which mouse/human HFSC aggregates were formed, followed by encapsulation in Matrigel for expansion culture. Proliferation, trichogenic gene expression, and hair regeneration capacity of the expanded cells were examined and compared with those of single-cell suspension cultures in Matrigel. This approach may be useful for efficient and scalable preparation of HFSCs for hair regenerative medicine.

2. Materials and Methods

2.1. Microwell Array Device

The microwell array device was fabricated via micro-molding as previously described.10,15 Briefly, polydimethylsiloxane (PDMS; Shin-etsu Silicone, Japan) was poured onto the positive mold with microwell array (configurations: diameter, 1 mm; pitch, 1.3 mm; depth, 1 mm; 169 microwells) and cured at 80 °C for 3 h in an oven. The device was autoclaved and non-cell-adhesive coated by treating with 4% (v/v) Pluronic F-127 solution (Sigma-Aldrich) for >6 h at 37 °C. After washing off excess Pluronic F-127 with phosphate-buffered saline (PBS; Sigma-Aldrich), the microwell array device was used for cell culture.

2.2. Animals

C57BL/6 mice (6–8 week old) were purchased from CLEA (Tokyo, Japan). Five-week-old ICR nude mice were purchased from Charles River (Japan). The animal study was approved by the Committee on animal care and use at the Yokohama National University (Permit Number: 2019-04). All mouse care and handling procedures strictly complied with the guidelines of the Animal Care and Use Committee of the Yokohama National University.

2.3. Preparation of Mouse HFSCs

HFSCs were dissociated as previously described.19 Briefly, the epidermal skin of 6- to 8-week-old C57BL/6 mice was surgically excised and treated with 0.25% (v/v) trypsin (Thermo Fisher Scientific, Inc.) at 37 °C for 70 min. The debris and undissociated tissues in the trypsinized cell suspensions were removed through 70- and 40 μm mesh cell strainers (BD Bioscience). HFSCs were maintained in keratinocyte growth medium-2 (KG2; Kurabo, Japan) supplemented with 5 μM Y-27632 (FUJIFILM-Wako Pure Chemical Corporation), 20 ng/mL human fibroblast growth factor-2 (FUJIFILM-Wako Pure Chemical Corporation), 20 ng/mL mouse vascular endothelial growth factor-A (FUJIFILM-Wako Pure Chemical Corporation), and 8% (v/v) fetal bovine serum (FBS; Biowest, France), and the medium (KG2+ medium) was renewed every 2–3 days.

2.4. Encapsulation of HFSC Aggregates in Matrigel on Microwell Array Device

HFSCs were seeded into the non-cell-adhesive microwell array device at different cell densities (1.0 × 103, 2.5 × 103, 5.0 × 103, and 50 × 103 cells/well). After 1 h of incubation, Matrigel (Corning) was cast onto the device to encapsulate the aggregates (Figure 1, device culture). For comparison, HFSCs were suspended in an ice-cold 1:1 mixture of KG2+ and Matrigel as single cells at 2 × 106 cells/mL and seeded in a 24-well culture plate (40 μL per well) (Figure 1, flat culture).25 Changes in the aggregate diameter and cell morphology were observed with a phase-contrast microscope (IX-73, Olympus, Japan). As described below, the proliferation of HFSCs in the flat and device cultures was evaluated using a colony-forming assay. The relative gene expression of stemness markers was evaluated using real-time reverse transcription polymerase chain reaction (RT-PCR). The ratio of CD34+α6+ cells was quantified using a flow cytometer (LSRFortessa X-20, BD Bioscience).

Figure 1.

Figure 1

Open in a new tab

Expansion culture of hair follicle stem cells (HFSCs): HFSCs were isolated from the back skin of adult mice or from human scalp hair follicles and seeded in a typical culture dish (flat) and a microwell array device (device). In the flat culture, HFSCs were suspended in a Matrigel solution, seeded, and encapsulated as a single-cell suspension in a culture dish. In the device culture, HFSCs in the culture medium were seeded in a PDMS microwell array device, where the cells aggregated in each microwell for 1 h of culture and were then encapsulated in the Matrigel in a spatially controlled manner.

2.5. Colony-Forming Assay

The proliferative potential of HFSCs was examined as previously described.27 Briefly, HFSCs (2–5 × 103 cells/mL) were seeded in six-well plates in the presence of mitomycin C-treated J2 feeder cells and cultured in KG2+ at 37 °C for eight days. Samples were fixed with 4% paraformaldehyde (FUJIFILM-Wako Pure Chemical Corporation) for 10 min and stained with 1% (v/v) crystal violet (Sigma-Aldrich) for 1 min. The stained colony areas were quantified using the ImageJ software.

2.6. Flow Cytometry

Enzymatically dissociated cells were rinsed once with KG2+ and stained with fluorescein isothiocyanate (FITC)-conjugated anti-CD34 antibody (eBioscience) and phycoerythrin (PE)-conjugated anti-α6 integrin antibody (eBioscience) for 30 min on ice. After two washes with FACS buffer (PBS containing 2% BSA, 2 mM EDTA), cells were analyzed in a flow cytometer (LSRFortessa X-20). The CD34-positive cells were quantified using the FlowJo software version 10. The marker expression was examined using live cells after the exclusion of cell doublets and dead cells stained with 7AAD (eBioscience).

2.7. Measurement of 4,6-Diamino-2-phenylindole (DAPI) Intensity

Samples were washed with PBS and treated with 4.8 U/mL dispase II (Sigma-Aldrich) for 60 min at 37 °C. After centrifugation at 180g for 5 min, DNA was extracted from dissociated cells by treating it with an extraction solution containing 50 mM Tris solution (Sigma-Aldrich), 100 mM NaCl (FUJIFILM-Wako Pure Chemical Corporation), 5 mM EDTA (Thermo Fisher Scientific, Inc.), and 20 mg/mL proteinase K (Sigma-Aldrich) for 60 min at 37 °C. The DNA solutions were homogenized using a polytron homogenizer and mixed with 1 μg/mL DAPI solution (Sigma-Aldrich) at a 1:1 ratio. DAPI fluorescence intensity (excitation at 355 nm and emission at 460 nm) was measured using a microplate reader (Sunrise, TECAN, Switzerland).

2.8. Hair-Chamber Assay

To assess the hair regeneration ability of HFSCs, a chamber assay was performed as previously described.27,28 Briefly, a full-thickness wound (4–6 mm in diameter) was surgically generated under isoflurane anesthesia on the back skin of nude mice and a silicon chamber (Nissan Chemical Industries, Japan) was implanted onto the muscle fascia. A mixture of HFSCs (5 × 105 cells) and embryonic mesenchymal cells (5 × 106 cells) was injected into the silicon chamber. Embryonic mesenchymal cells were enzymatically dissociated from the back skin of C57BL/6 embryonic mice (E18.5) as previously described.15 The chamber was removed 2 weeks after transplantation, and hair growth was monitored for 4 weeks using a digital camera (Tough, Olympus). The transplanted skin was histologically stained after 4 weeks. The number of generated hair shafts divided by single transplanted site was counted after treatment with 100 U/mL collagenase at 37 °C for 2 h.

2.9. Preparation and Transplantation of HFG-like Tissue Grafts Using Expanded HFSCs and Embryonic Mesenchymal Cells

HFSCs cultured for 14 days were mixed with embryonic mesenchymal cells (total 2 × 104 cells; HFSCs/mesenchymal cells = 1:1), suspended in 0.2 mL of Dulbecco’s modified Eagle’s medium (DMEM; Sigma-Aldrich) supplemented with 10% (v/v) FBS and 1% (v/v) penicillin-streptomycin + KG2+ mixed in equal volumes, and seeded into a non-cell-adhesive round-bottom 96-well plate (Primesurface 96U plate; Sumitomo Bakelite, Ltd. Japan). After 3 days of culture, the spatial cell distribution was examined using a fluorescence microscope (DP-71, Olympus, Japan).

HFG-like tissue grafts were transplanted into shallow stab wounds generated on the backs of nude mice under anesthesia using a 20-G Ophthalmic V-lance (Alcon, Japan). Thereafter, an ointment was rubbed on the transplantation sites. The mice were raised for up to 3 weeks under pathogen-free conditions with ad libitum feeding. Transplanted sites were observed every 2–3 days, and images of the hair generated were captured using a digital camera (Tough, Olympus). Hematoxylin and eosin (HE) staining was performed 21 days after the transplantation. The hair cuticles were observed with a scanning electron microscope (Miniscope; Hitachi, Japan) without any treatment.

2.10. Isolation of Human HFSCs

Human scalp hair follicles were obtained from androgenetic alopecia (AGA) patients after informed consent was obtained. This study was performed in accordance with protocols approved by the Institutional Ethics Committee of the YNU Ethical Committee for Medical and Health Research (Authorization No. Hitoi-2018-16), and Kanagawa Institute of Industrial Science and Technology (Authorization No. S-2019-01). All of the experimental procedures were conducted in accordance with the principles of the Declaration of Helsinki. The hair bulb, which contained DP, was removed in DMEM, supplemented with 10 mM HEPES, 10% (v/v) FBS, and 1% (v/v) penicillin-streptomycin. The remaining epithelial components were treated with 4.8 U/mL dispase II and 100 U/mL collagenase in a mixture (1:1) of Hanks’ balanced salt solution (Thermo Fisher Scientific, Inc.) and PBS for 10 min at 37 °C. The collagen sheath was surgically removed and treated with 0.05% trypsin in PBS for 60 min at 37 °C. The debris and undissociated tissues were removed by passing through a 40 μm mesh cell strainer. After centrifugation (180g, 3 min), the human HFSCs were suspended in StemFit AK02N medium (Reprocell, Japan) and counted.

2.11. Effects of Inhibitors on Maintenance and Expansion of Human HFSCs in the Microwell Array Device

Human HFSCs (8 × 104 cells/well) were cultured in a conventional laminin-coated six-well plate in StemFit AK02N medium supplemented with 10 μM Y-27632 and 5 μM A83-01, a TGF-β receptor inhibitor. Laminin-coated six-well plates were prepared by treating with Easy iMatrix-511 (Matrixome, Japan) for >1 h at 37 °C. After 5 days of culture, the proliferation of cells and the expression of CD200 and K14 were evaluated using a hemocytometer and an RT-PCR, respectively.

Similar to mouse HFSCs, human HFSCs were seeded into the microwell array device at 2.5 × 103 cells/well. After 1 h of incubation, the HFSC aggregates in the microwells were embedded in Matrigel. For comparison, HFSCs were suspended in an ice-cold 1:1 mixture of StemFit AK02N medium (supplemented with 10 μM Y-27632 and 5 μM A83-01) and Matrigel as single cells at 1.3 × 106 cells/mL and seeded in a 96-well culture plate (40 μL per well). Changes in aggregate diameter and cell morphology were observed with a phase-contrast microscope (BZ-X700, Keyence). The relative expression of CD200 was evaluated using an RT-PCR (see below).

2.12. Histological and Immunohistochemical Staining

Samples were washed with PBS and fixed with 10% formaldehyde (FUJIFILM-Wako Pure Chemical Corporation), overnight at 25 °C. After embedding in optimal cutting temperature compound (O.C.T. compound; Sakura Finetek, Japan), 8 μm thick sections were cut and stained with Meyer’s hematoxylin solution (FUJIFILM-Wako Pure Chemical Corporation) and 1% eosin Y solution (Muto Pure Chemical, Tokyo, Japan). For immunohistochemical staining, the sections were fixed in 4% formaldehyde for 1 h at 25 °C. The samples were first blocked in PBS containing 1% bovine serum albumin (Thermo Fisher Scientific, Inc.) and 0.01% Triton X-100 (Thermo Fisher Scientific, Inc.) for 1 h at 25 °C and subsequently incubated overnight with anti-CD34 antibody (Thermo Fisher Scientific, Inc.) at 4 °C. The sections were incubated with the corresponding secondary antibodies in blocking solution for 3 h at 25 °C and finally with DAPI in PBS for 10 min. A confocal microscope (LSM 700; Carl Zeiss) was used for fluorescence imaging.

2.13. Gene Expression Analysis

Total RNA was extracted from the samples using an RNeasy mini kit (Qiagen, Netherlands), and cDNA was synthesized via reverse transcription using a ReverTraAce RT-qPCR kit (Toyobo, Japan), according to the manufacturer’s instructions. qPCR was performed using the StepOne Plus RT-PCR system (Applied Biosystems), with SYBR Premix Ex Taq II (Takara-bio, Japan). The following primers (5′-3′) were used: mouse CD34 (TGGGTCAAGTTGTGGTGGGAA and GAAGAGGCGAGAGAGGAGAAATG), mouse NFATc1 (GGTGCTGTCTGGCCATAACT and CCAGGGAATTTGGCTTGCAC), mouse Tcf3 (CTCAGCAGCAAATCCAAGAGGCAGAG and TGGGAAGACGCAGGGCTATCACAAG), mouse Sox9 (TCTGGAGGCTGCTGAACGA and TCCGTTCTTCACCGACTTCCT), mouse GAPDH (AGAACATCATCCCTGCATCC and TCCACCACCCTGTTGCTGTA), human CD200 (TGACTCTGTCTCACCCAAATG and GCTTAGCAATAGCGGAACTG), human K14 (GGCCTGCTGAGATCAAAGACTAC and CACTGTGGCTGTGAGAATCTTGTT), human ITGA6 (GCTGGTTATAATCCTTCAATATCAATTGT and TTGGGCTCAGAACCTTGGTTT), and human GAPDH (TGGAAATCCCATCACCATCTTC and CGCCCCACTTGATTTTGG).

The expression levels of all of the genes were normalized to those of GAPDH. Relative gene expression was determined using the 2–ΔΔCt method and is presented as the mean ± standard error of three independent experiments.

3. Results and Discussion

3.1. Aggregate-Embedded Culture on the PDMS Microwell Array Device

Maintenance of HFSC characteristics in culture has been a longstanding issue in the fields of stem cell research and hair regenerative medicine.24 Recently, HFSCs encapsulated in Matrigel as single-cell suspensions were reported to possess the self-organizing plasticity of stem cells (α6+/CD34+ cells) and their progeny (α6+/CD34– cells).25 The authors showed that Matrigel encapsulation enabled the expansion and long-term maintenance of murine HFSCs in the absence of heterologous cell types. This is a sophisticated approach for partially recapitulating the in vivo HFSC environment. However, various sizes of colonies, even single cells, were observed in their culture, which encouraged us to conduct the present study to culture HFSCs in a more controlled manner. An oxygen-permeable PDMS microwell array device with 20–5000 round-shaped microwells, to prepare uniform-diameter cell aggregates, has been fabricated previously.10,15,16 PDMS possesses a diffusion coefficient and an oxygen solubility 1.5- and 10-fold greater than those of culture medium (water), respectively.29 In this device, oxygen is supplied to the cells from the top through the culture medium as well as from the bottom through the PDMS.10,15,16 We previously reported that cell aggregates cultured in the PDMS device represented better hepatic,30 pancreatic,31 and trichogenic10 functions compared with those cultured in non-oxygen-permeable material. Thus, we hypothesized that this improved oxygen supply might provide a suitable culture environment for the expansion and maintenance of HFSCs in Matrigel.

We fabricated a microwell array device with 169 round-bottom wells (1 mm diameter, 1 mm depth, 1.3 mm pitch; Figure 2a) using soft lithography. Mouse HFSCs were seeded at different cell densities in the device, cultured for an hour to form loosely packed aggregates in the microwell array, and then encapsulated in Matrigel. This procedure is important to increase intercellular interactions, as previously demonstrated in MSC aggregation culture in collagen gel.32

Figure 2.

Figure 2

Open in a new tab

HFSC aggregate formation in the device: (a) Microwell array device: (i) The layout of 169 microwells designed using a computer-aided design software. (ii) The fabricated microwell array device. (iii) A representative cross-sectional image indicating the microwell dimensions—1.0 mm in diameter, 1.3 mm in pitch (center-to-center), and 1.0 mm in depth. (b) Phase-contrast microscopic image of HFSC aggregates in the device. (c) HFSC aggregates with different seeding densities at 14 days of culture. (d) Dependence of gene expression of HFSC marker, CD34, on the seeding density; the evaluation was performed at 14 days of culture. Data represent mean values ± standard error (SE) from three different experiments. Tukey’s test p-values indicate statistical significance (*p < 0.05).

After 14 days of culture, the aggregate diameter was almost uniform in each well (Figure 2b) and was dependent on the seeding cell number (Figure 2c). The gene expression level of CD34, a mouse HFSC marker, peaked at 2.5 × 103 cells (Figure 2d). This result may be attributed to the positive effects of cell–cell interactions and the negative effect of oxygen shortage at higher cell numbers. Based on these results, HFSC aggregates at a seeding density of 2.5 × 103 cells/aggregate were used for the subsequent experiments.

We further compared the aggregate-embedded culture in the microwell array device (device) with the single-cell embedded culture in flat vessels (flat). While HFSCs formed many small aggregates in the flat culture, single large-sized aggregates were observed in the device culture (Figure 3a). The distribution of the aggregate diameter was markedly different between the flat and the device (Figure 3b). In the flat culture, some cells formed aggregates and proliferated, while others maintained a single-cell state without proliferation. The diameter of the HFSC aggregates in the device reached ∼250 μM after 2 weeks of culture. Immunohistochemical staining of CD34 revealed that HFSC aggregates cultured under both the conditions contained CD34+ cells, while few CD34+ cells were observed in the 2D culture on a tissue culture plate (TCP) of the negative control (Figure 3c). In colony-forming assays, HFSCs maintaining stemness tend to form relatively large colonies on feeder layers.25 HFSCs cultured on the device formed large colonies and filled a 2 times larger area (Figure 3di,ii).

Figure 3.

Figure 3

Open in a new tab

Characterizations of expanded HFSCs: (a) Formation of HFSC aggregates in the flat and device culture. (b) Distribution of the diameter of HFSC aggregates at 14 days of culture. (c) Immunohistochemical staining of the HFSCs expanded in the flat and device culture; as a negative control, HFSCs were seeded on six-well tissue culture plates (TCPs) without Matrigel. CD34 (green) and nuclei (blue) were visualized. (d) Colony-forming assay: (i) HFSCs cultured in the flat and the device for 14 days were seeded on a feeder cell layer. Colonies were visualized by crystal violet staining at 8 days of culture. (ii) The colony area per well was quantified using the ImageJ software. Data represent mean values ± SE from three different experiments; Tukey’s test p-values indicate statistical significance (**p < 0.01).

We next compared the expression of the HFSC markers CD34, Nfatc1, Tcf3, and SOX9 under both the culture conditions. The expression of these genes was significantly upregulated in the HFSCs cultured in the device compared with those cultured in the flat (Figure 4a). Flow cytometry analysis showed that the α6+/CD34+ cell populations among total cells were greater in the HFSCs cultured in the device (53%) compared with those in the HFSCs cultured in the flat (39%) and in the freshly isolated HFSCs (7%) (Figure 4b,c). Total cell numbers, quantified using DNA intensity, increased 3-fold after 14 days of culture in both the flat and the device (Figure 4d). Calculation of the number of α6+/CD34+ cells suggested that the device culture had a higher number of expanded HFSCs compared to the flat culture. These results indicated that optimization of the Matrigel embedding conditions using our device enabled efficient expansion of α6+/CD34+ cell populations.

Figure 4.

Figure 4

Open in a new tab

Expression of stem cell markers in expanded HFSCs: (a) Gene expression of HFSC markers at 14 days of culture. (b) FACS plots of freshly isolated HFSCs (fresh) and those expanded in the flat and device culture for 14 days. Blue area indicates CD34+ /integrin α6+ cells. (c) Ratios of α6+/CD34+ cells in the flat and device culture at 14 days. (d) Changes in cell number; DNA contents were quantified on days 0 and 14 in the flat and device culture. Data represent mean values ± SE from three different experiments; Student’s t-test p-values indicate statistical significance (*p < 0.05, **p < 0.01).

3.2. Hair Regeneration Assay

We further investigated the ability of the expanded HFSCs to regenerate hair using a hair-chamber assay. The HFSCs (expanded on the flat/device) and mesenchymal cells were transplanted into a chamber implanted on the back skin of nude mice (Figure 5a–i). Abundant hair shaft regeneration and morphological features typical of hair, including hair cuticles, were observed under both the conditions after 4 weeks (Figure 5b,c). Histology of the cross-section of the regenerated skin tissue revealed features typical of hair follicles (Figure 5d). The number of hairs regenerated with the HFSCs cultured in the device was significantly greater than that of those cultured in the flat (Figure 5e). A previous study, in which the HFSCs were expanded in the flats, showed that 3D expanded cells have greater hair follicle regeneration capacity by cell transplantation, with greater α6+/CD34+ cell populations than freshly isolated cells.25 Our approach also achieved an increase in capacity, due likely to the increase in α6+/CD34+ cell populations.

Figure 5.

Figure 5

Open in a new tab

Hair regeneration using mouse HFSCs cultured in the device: (a) Schematics of two hair regeneration assays; In the hair-chamber assay. (i) The lower silicone part of the chamber was fixed into the back skin of nude mice where cultured HFSCs (5 × 105 cells) and freshly isolated mouse embryonic mesenchymal cells (5 × 106 cells) were grafted, and then capped with the upper silicone part. (ii) In the HFG transplantation assay, cultured HFSCs (1 × 104 cells) and freshly isolated embryonic mesenchymal cells (1 × 104 cells) were mixed and seeded into a non-cell-adhesive round-bottom 96-well plate. During the 3 days of culture, the two types of cells formed a single aggregate and then separated spatially, resulting in the formation of HFG-like aggregates. The HFG-like aggregates were transplanted into the back skin of nude mice individually. (b) Hair shafts regenerated 4 weeks after transplantation in the chamber assay (c) Scanning electron microscopic images of regenerated hair shafts. (d) HE staining of cross sections of de novo generated hair follicles, 4 weeks after the transplantation. (e) Quantification of regenerated hair shafts. (f) Spontaneous formation of HFG-like structures. Mesenchymal cells were pre-labeled with fluorescent Vybrant DiI (red). The fluorescent and stereomicroscopic images were overlaid. (g) Hair shafts 3 weeks after transplantation. (h) Scanning electron microscopic images of regenerated hair shafts. Data represent mean values ± SE from three different experiments. Student’s t-test p-values indicate statistical significance (**p < 0.01).

In our previous study, where two types of cells—epithelial and mesenchymal—were mixed and seeded in a well, the cells separated spatially and self-organized into an HFG—self-sorting HFG (ssHFG)—during the 3 days of culture.10 We investigated whether expanded HFSCs formed ssHFGs and regenerated hair after transplantation. HFSCs (grown in the device) and the mesenchymal cells initially formed an aggregate in which the two cell types were randomly distributed on day 1 of culture; however, they were spatially separated from each other and exhibited HFG features after 3 days of culture (Figure 5f). ssHFGs were transplanted onto the back skin of nude mice for evaluating hair regeneration. Three weeks after transplantation, black hair regenerated at the transplantation site (Figure 5g). Scanning electron microscopic images of the regenerated hair shafts revealed morphological characteristics typical of hair, including the hair cuticle (Figure 5h).

Embryonic or neonatal skin-derived epithelial cells and adult HFSCs are promising sources of epithelial cells for hair regenerative medicine. Although embryonic cells generally have a strong ability for de novo regeneration of hair follicles, the regenerative ability of adult HFSCs often deteriorates even when the same approach is used.9 A large number of ssHFGs have been reportedly prepared using mouse embryonic epithelial cells and mouse embryonic mesenchymal/human DP cells.10,15,16 Considering the clinical applications, autologous HFSCs should be used as the ideal cell source. In the above-mentioned study, the expanded HFSCs were reported to self-organize with mesenchymal cells and form dumbbell-shaped HFGs, using an HFG preparation technique. For clinical use, a microarray device with approximately 5000 microwells could be used to generate the large number of HFGs required to treat a patient using expanded HFSCs.

3.3. Human HFSC Expansion Culture

Although a precisely controlled 3D environment allowed murine HFSCs to expand and self-sustain in this study, the suitability of the system for culturing human HFSCs remained unknown. Therefore, we evaluated the feasibility of our aggregate-embedded culture system for culturing human HFSCs dissociated from AGA-patient-derived hair follicles (Figure 6a). In human HFSCs, CD200+ cells are defined as HFSCs and are extracted from the outer root sheath of hair follicles.33,34 Histological staining of AGA-patient-derived hair follicles revealed the presence of CD200+ cells in the outer root sheath (Figure 6b). Optimization of enzymatic treatment conditions, including enzyme type, concentration, and treatment time, enabled the dissociation of human HFSCs from the outer root sheath with >80% viability. We further examined the expansion culture conditions by changing the coating, culture medium, and soluble factors. Laminin, the main component of the basement membrane and mature hair follicles,31 enhances the attachment of human HFSCs.35 Rho-associated protein kinase inhibitor, Y-27632, maintains the self-renewal and stemness characteristics of murine HFSCs.21 BMP and TGF-β signaling pathways stimulate HFSC quiescence and are blocked by their respective inhibitors, Noggin and A83-01.36,37 The HFSC culture conditions were dramatically improved in this study using a laminin-coated dish and by adding Y-27632 and A83-01. HFSCs cultured for 5 days in the presence of Y-27632 and A83-01 (YA medium) proliferated well and increased in number by approximately 20 times in comparison with the number at day 0 (Figure 6c,d), whereas the withdrawal of A83-01 resulted in a decrease in cell proliferation. We next compared the expression of the HFSC marker, CD200, and the differentiation marker, K14, to examine the maintenance of stemness. CD200 gene expression was not significantly different between the cultures in Y-27632-supplemented medium (Y medium) and YA medium, while K14 gene expression was significantly downregulated after 5 days of culture (Figure 6e). Based on these results, we decided to use the YA medium for HFSC expansion culture.

Figure 6.

Figure 6

Open in a new tab

Human HFSC expansion: (a) Preparation of HFSCs from human hair follicles. (b) Appearance of human hair follicles: (i, ii) Stereomicroscopic, (iii, iv) histochemical, and (v) immunofluorescent images. Histochemical and immunofluorescence analyses were conducted with HE staining and CD200 (antibody against human HFSC marker), respectively. (c) Phase-contrast microscopic images of HFSCs on a conventional culture dish; Freshly isolated HFSCs were expanded in five different culture media. (d) Number of expanded HFSCs: Day 0 indicates the number of seeded cells. HFSCs were grown in culture medium supplemented with 10 μM Y-27632 (Y), 5 μM A83-01 (A), both (YA), and no supplementation (w/o). (e) Human HFSC marker, CD200, and differentiation marker, K14, expression at 5 days of culture. (f) Phase-contrast microscopic images of human HFSCs in the flat and device culture. (g) Changes in aggregate diameter in the flat and device culture. (h) Changes in cell number; Enzymatically dissociated cells were counted at 0 and 7 days in the flat and device culture. (i) HFSC marker gene expression after 7 days in the device culture. Data represent mean values ± SE from three different experiments (d, h, i) or 25 different samples (g). Student’s t-test p-values indicate statistical significance (*p < 0.05).

After primary culture in YA medium, human HFSCs were seeded in our device and embedded in Matrigel. For comparison, HFSCs were cultured in a laminin-coated 2D plate using the flat approach. The diameter of HFSC aggregates increased under both flat and device conditions during the 7 days of culture (Figure 6f,g), and the number of human HFSCs also increased (Figure 6h). The expression of CD200 and ITGA6 genes was significantly upregulated in the device compared to that in the flat and 2D cultures (Figure 6i). Although we need to investigate this in a future study using time-course gene expression assay and extensive signal transduction analysis, our HFSC expansion approach provides an important research avenue for human hair follicle regeneration.

A fundamental issue in the field of hair follicle regeneration is the expansion of HFSCs to maintain their hair regeneration capacity. This study demonstrates the significant potential of the proposed 3D expansion approach. Although we used primary cells or early passaged cells as a proof-of-concept study, we need to repeat the passage culture and examine the limitations of HFSC expansion in a future study. In addition, the hair regeneration capacity of human HFSCs should be investigated by transplantation of HFGs prepared using expanded HFSCs and DP cells.

Matrigel is a basement membrane matrix that is extracted from Engelbreth–Holm–Swarm mouse sarcomas. It is the most reliable hydrogel for tissue engineering research because of its close resemblance to the in vivo environment. Therefore, we used Matrigel for the 3D expansion culture in this study. However, Matrigel is difficult to use in clinical applications owing to the possibility of xenogenic contamination. A recent study has shown that atelocollagen, a defined type I collagen that lacks telopeptide regions and has potential for clinical applications, can be used as an alternative matrix for 3D HFSC cultures.26 Further investigation using atelocollagen should be performed in alternative Matrigel for clinical applications. To the best of our knowledge, this study is the first to demonstrate a 3D expansion culture of human HFSCs isolated from AGA-patient hair follicles. This approach may advance research on hair regenerative medicine. In addition, HFSCs have a multilineage differentiation capacity and can produce keratinocytes, smooth muscle cells, cardiac muscle cells, neurons, and glial cells.38 Our technology may contribute to the preparation of cell sources for skin, heart, and brain tissue engineering.

4. Conclusions

A major challenge in this field is the expansion of HFSCs that can retain a high trichogenic ability upon transplantation. Our 3D Matrigel culture approach using the PDMS microarray device was beneficial for the expansion of HFSCs while maintaining their stemness. Compared with that in the conventional 3D Matrigel culture, gene expression of mouse/human HFSC markers was upregulated in our approach, and the transplantation of HFSCs with mouse mesenchymal cells resulted in an almost 3-fold increase in the number of hair shafts generated. Although further hair generation assays using DP cells from individuals with hair loss are necessary, this approach may open a new avenue for HFSC expansion for hair regenerative medicine.

Acknowledgments

The silicon chamber was generously provided by Nissan Chemical Industries, Japan.

Glossary

Abbreviations

HFSCs

hair follicle stem cells

DP

dermal papilla

HFGs

hair follicle germs

ssHFG

self-sorting HFG

Data Availability Statement

All data generated or analyzed during this study are included in the main text of this manuscript.

Author Contributions

# S.H. and T.K. contributed equally to this work. S.H., T.K., and J.F. designed the experiments. S.H. and M.Y. conducted the mouse HFSC expansion. S.H., T.K., L.Y., and M.Y. conducted human HFSC expansion. K.S. prepared the microarray device. K.E. and K.K. provided the human samples. S.H., T.K., and J.F. wrote the manuscript. All authors have given approval to the final version of the manuscript.

This work was partially supported by the Ministry of Education, Culture, Sports, Science, and Technology of Japan; Grants-in-Aid for Scientific Research (Kakenhi) (20H02535 and 20K20208); Kanagawa Institute of Industrial Science and Technology (KISTEC); Agency for Medical Research and Development (19213841); and Japan Science and Technology Agency (JST)-PRESTO (JPMJPR19H2).

The authors declare the following competing financial interest(s): T.K., L.Y., and J.F. are co-founders of TrichoSeeds, a company that provides hair regeneration medicine. The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

References

  1. Millar S. E. Molecular Mechanisms Regulating Hair Follicle Development. J. Invest. Dermatol. 2002, 118, 216–225. 10.1046/j.0022-202x.2001.01670.x. [DOI] [PubMed] [Google Scholar]
  2. Schneider M. R.; Schmidt-Ullrich R.; Paus R. The Hair Follicle as a Dynamic Miniorgan. Curr. Biol. 2009, 19, R132–R142. 10.1016/j.cub.2008.12.005. [DOI] [PubMed] [Google Scholar]
  3. Woo W. M.; Oro A. E. SnapShot: Hair Follicle Stem Cells. Cell 2011, 146, 334–334.e2. 10.1016/j.cell.2011.07.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Driskell R. R.; Clavel C.; Rendl M.; Watt F. M. Hair Follicle Dermal Papilla Cells at a Glance. J. Cell Sci. 2011, 124, 1179–1182. 10.1242/jcs.082446. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Jahoda C. A. B.; Horne K. A.; Oliver R. F. Induction of Hair Growth by Implantation of Cultured Dermal Papilla Cells. Nature 1984, 311, 560–562. 10.1038/311560a0. [DOI] [PubMed] [Google Scholar]
  6. Weinberg W. C.; Goodman L. V.; George C.; Morgan D. L.; Ledbetter S.; Yuspa S. H.; Lichti U. Reconstitution of Hair Follicle Development In Vivo: Determination of Follicle Formation, Hair Growth, and Hair Quality by Dermal Cells. J. Invest. Dermatol. 1993, 100, 229–236. 10.1111/1523-1747.ep12468971. [DOI] [PubMed] [Google Scholar]
  7. Zheng Y.; Du X. B.; Wang W.; Boucher M.; Parimoo S.; Stenn K. S. Organogenesis From Dissociated Cells: Generation of Mature Cycling Hair Follicles From Skin-Derived Cells. J. Invest. Dermatol. 2005, 124, 867–876. 10.1111/j.0022-202X.2005.23716.x. [DOI] [PubMed] [Google Scholar]
  8. Ehama R.; Ishimatsu-Tsuji Y.; Iriyama S.; Ideta R.; Soma T.; Yano K.; Kawasaki C.; Suzuki S.; Shirakata Y.; Hashimoto K.; Kishimoto J. Hair Follicle Regeneration Using Grafted Rodent and Human Cells. J. Invest. Dermatol. 2007, 127, 2106–2115. 10.1038/sj.jid.5700823. [DOI] [PubMed] [Google Scholar]
  9. Wu X. W.; Scott L.; Washenik K.; Stenn K. Full-Thickness Skin With Mature Hair Follicles Generated From Tissue Culture Expanded Human Cells. Tissue Eng., Part A 2014, 20, 3314–3321. 10.1089/ten.TEA.2013.0759. [DOI] [PubMed] [Google Scholar]
  10. Kageyama T.; Yoshimura C.; Myasnikova D.; Kataoka K.; Nittami T.; Maruo S.; Fukuda J. Spontaneous Hair Follicle Germ (HFG) Formation In Vitro, Enabling the Large-Scale Production of HFGs for Regenerative Medicine. Biomaterials 2018, 154, 291–300. 10.1016/j.biomaterials.2017.10.056. [DOI] [PubMed] [Google Scholar]
  11. Abaci H. E.; Coffman A.; Doucet Y.; Chen J.; Jacków J.; Wang E.; Guo Z. Y.; Shin J. U.; Jahoda C. A.; Christiano A. M. Tissue Engineering of Human Hair Follicles Using a Biomimetic Developmental Approach. Nat. Commun. 2018, 9, 5301 10.1038/s41467-018-07579-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Toyoshima K. E.; Asakawa K.; Ishibashi N.; Toki H.; Ogawa M.; Hasegawa T.; Irié T.; Tachikawa T.; Sato A.; Takeda A.; Tsuji T. Fully Functional Hair Follicle Regeneration Through the Rearrangement of Stem Cells and Their Niches. Nat. Commun. 2012, 3, 784 10.1038/ncomms1784. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Lei M. X.; Schumacher L. J.; Lai Y. C.; Juan W. T.; Yeh C. Y.; Wu P.; Jiang T. X.; Baker R. E.; Widelitz R. B.; Yang L.; Chuong C. M. Self-Organization Process in Newborn Skin Organoid Formation Inspires Strategy to Restore Hair Regeneration of Adult Cells. Proc. Natl. Acad. Sci. U.S.A. 2017, 114, E7101–E7110. 10.1073/pnas.1700475114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Kageyama T.; Yan L.; Shimizu A.; Maruo S.; Fukuda J. Preparation of Hair Beads and Hair Follicle Germs for Regenerative Medicine. Biomaterials 2019, 212, 55–63. 10.1016/j.biomaterials.2019.05.003. [DOI] [PubMed] [Google Scholar]
  15. Kageyama T.; Nanmo A.; Yan L.; Nittami T.; Fukuda J. Effects of Platelet-Rich Plasma on In Vitro Hair Follicle Germ Preparation for Hair Regenerative Medicine. J. Biosci. Bioeng. 2020, 130, 666–671. 10.1016/j.jbiosc.2020.08.005. [DOI] [PubMed] [Google Scholar]
  16. Kageyama T.; Chun Y.-S.; Fukuda J. Hair Follicle Germs Containing Vascular Endothelial Cells for Hair Regenerative Medicine. Sci. Rep. 2021, 11, 624 10.1038/s41598-020-79722-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Genander M.; Cook P. J.; Ramsköld D.; Keyes B. E.; Mertz A. F.; Sandberg R.; Fuchs E. BMP Signaling and Its pSMAD1/5 Target Genes Differentially Regulate Hair Follicle Stem Cell Lineages. Cell Stem Cell 2014, 15, 619–633. 10.1016/j.stem.2014.09.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Sennett R.; Rendl M. Mesenchymal-Epithelial Interactions During Hair Follicle Morphogenesis and Cycling. Semin. Cell Dev. Biol. 2012, 23, 917–927. 10.1016/j.semcdb.2012.08.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Ouji Y.; Yoshikawa M.; Nishiofuku M.; Ouji-Sageshima N.; Kubo A.; Ishizaka S. Effects of Wnt-10b on Proliferation and Differentiation of Adult Murine Skin-Derived CD34 and CD49f Double-Positive Cells. J. Biosci. Bioeng. 2010, 110, 217–222. 10.1016/j.jbiosc.2010.01.020. [DOI] [PubMed] [Google Scholar]
  20. Ouji Y.; Ishizaka S.; Nakamura-Uchiyama F.; Okuzaki D.; Yoshikawa M. Partial Maintenance and Long-Term Expansion of Murine Skin Epithelial Stem Cells by Wnt-3a In Vitro. J. Invest. Dermatol. 2015, 135, 1598–1608. 10.1038/jid.2014.510. [DOI] [PubMed] [Google Scholar]
  21. An L. Y.; Ling P. P.; Cui J.; Wang J. Q.; Zhu X. M.; Liu J.; Dai Y. J.; Liu Y. H.; Yang L.; Du F. L. ROCK Inhibitor Y-27632 Maintains the Propagation and Characteristics of Hair Follicle Stem Cells. Am. J. Transl. Res. 2018, 10, 3689–3700. [PMC free article] [PubMed] [Google Scholar]
  22. Oshimori N.; Fuchs E. Paracrine TGF-Beta Signaling Counterbalances BMP-Mediated Repression in Hair Follicle Stem Cell Activation. Cell Stem Cell 2012, 10, 63–75. 10.1016/j.stem.2011.11.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Boonekamp K. E.; Kretzschmar K.; Wiener D. J.; Asra P.; Derakhshan S.; Puschhof J.; López-Iglesias C.; Peters P. J.; Basak O.; Clevers H. Long-Term Expansion and Differentiation of Adult Murine Epidermal Stem Cells in 3D Organoid Cultures. Proc. Natl. Acad. Sci. U.S.A. 2019, 116, 14630–14638. 10.1073/pnas.1715272116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Sánchez-Danés A.; Blanpain C. Maintaining Hair Follicle Stem Cell Identity in a Dish. EMBO J. 2017, 36, 132–134. 10.15252/embj.201696051. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Chacón-Martínez C. A.; Klose M.; Niemann C.; Glauche I.; Wickström S. A. Hair Follicle Stem Cell Cultures Reveal Self-Organizing Plasticity of Stem Cells and their Progeny. EMBO J. 2017, 36, 151–164. 10.15252/embj.201694902. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Takeo M.; Asakawa K.; Toyoshima K. E.; Ogawa M.; Tong J.; Irié T.; Yanagisawa M.; Sato A.; Tsuji T. Expansion and Characterization of Epithelial Stem Cells with Potential for Cyclical Hair Regeneration. Sci. Rep. 2021, 11, 1173 10.1038/s41598-020-80624-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Jensen K. B.; Driskell R. R.; Watt F. M. Assaying Proliferation and Differentiation Capacity of Stem Cells Using Disaggregated Adult Mouse Epidermis. Nat. Protoc. 2010, 5, 898–911. 10.1038/nprot.2010.39. [DOI] [PubMed] [Google Scholar]
  28. Blanpain C.; Lowry W. E.; Geoghegan A.; Polak L.; Fuchs E. Self-Renewal, Multipotency, and the Existence of Two Cell Populations Within an Epithelial Stem Cell Niche. Cell 2004, 118, 635–648. 10.1016/j.cell.2004.08.012. [DOI] [PubMed] [Google Scholar]
  29. Evenou F.; Fujii T.; Sakai Y. Spontaneous Formation of Highly Functional Three-Dimensional Multilayer from Human Hepatoma Hep G2 Cells Cultured on an Oxygen-Permeable Polydimethylsiloxane Membrane. Tissue Eng., Part C 2010, 16, 311–318. 10.1089/ten.TEC.2009.0042. [DOI] [PubMed] [Google Scholar]
  30. Anada T.; Fukuda J.; Sai Y.; Suzuki O. An Oxygen-Permeable Spheroid Culture System for the Prevention of Central Hypoxia and Necrosis of Spheroids. Biomaterials 2012, 33, 8430–8441. 10.1016/j.biomaterials.2012.08.040. [DOI] [PubMed] [Google Scholar]
  31. Myasnikova D.; Osaki T.; Onishi K.; Kageyama T.; Zhang Molino B.; Fukuda J. Synergic Effects of Oxygen Supply and Antioxidants on Pancreatic Beta-Cell Spheroids. Sci. Rep. 2019, 9, 1802 10.1038/s41598-018-38011-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Wang Y.; Xiao Y.; Long S.; Fan Y.; Zhang X. Role of N-Cadherin in a Niche-Mimicking Microenvironment for Chondrogenesis of Mesenchymal Stem Cells In Vitro. ACS Biomater. Sci. Eng. 2020, 6, 3491–3501. 10.1021/acsbiomaterials.0c00149. [DOI] [PubMed] [Google Scholar]
  33. Inoue K.; Aoi N.; Sato T.; Yamauchi Y.; Suga H.; Eto H.; Kato H.; Araki J.; Yoshimura K. Differential Expression of Stem-Cell-Associated Markers in Human Hair Follicle Epithelial Cells. Lab. Invest. 2009, 89, 844–856. 10.1038/labinvest.2009.48. [DOI] [PubMed] [Google Scholar]
  34. Ohyama M.; Terunuma A.; Tock C. L.; Radonovich M. F.; Pise-Masison C. A.; Hopping S. B.; Brady J. N.; Udey M. C.; Vogel J. C. Characterization and Isolation of Stem Cell-Enriched Human Hair Follicle Bulge Cells. J. Clin. Invest. 2006, 116, 249–260. 10.1172/JCI26043. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Jahoda C. A. B.; Mauger A.; Bard S.; Sengel P. Changes in Fibronectin, Laminin and Type IV Collagen Distribution Relate to Basement Membrane Restructuring During the Rat Vibrissa Follicle Hair Growth Cycle. J. Anat. 1992, 181, 47–60. [PMC free article] [PubMed] [Google Scholar]
  36. Botchkarev V. A.; Botchkareva N. V.; Nakamura M.; Huber O.; Funa K.; Lauster R.; Paus R.; Gilchrest B. A. Noggin Is Required for Induction of the Hair Follicle Growth Phase in Postnatal Skin. FASEB J. 2001, 15, 2205–2214. 10.1096/fj.01-0207com. [DOI] [PubMed] [Google Scholar]
  37. Kulessa H.; Turk G.; Hogan B. L. M. Inhibition of Bmp Signaling Affects Growth and Differentiation in the Anagen Hair Follicle. EMBO J. 2000, 19, 6664–6674. 10.1093/emboj/19.24.6664. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Obara K.; Tohgi N.; Mii S.; Hamada Y.; Arakawa N.; Aki R.; Singh S. R.; Hoffman R. M.; Amoh Y. Hair-Follicle-Associated Pluripotent Stem Cells Derived From Cryopreserved Intact Human Hair Follicles Sustain Multilineage Differentiation Potential. Sci. Rep. 2019, 9, 9326 10.1038/s41598-019-45740-9. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All data generated or analyzed during this study are included in the main text of this manuscript.

Articles from ACS Biomaterials Science & Engineering are provided here courtesy of American Chemical Society

RESOURCES