Skip to main content
PLOS One logoLink to PLOS One
. 2023 Mar 16;18(3):e0283291. doi: 10.1371/journal.pone.0283291

Molecular characterization of Blastocystis subtypes in symptomatic patients from the southern region of Syria

Buthaina Darwish 1, Ghalia Aboualchamat 1, Samar Al Nahhas 1,*
Editor: Kovy Arteaga-Livias2
PMCID: PMC10019620  PMID: 36928869

Abstract

Blastocystis sp. is an enteric protist found in humans and a wide range of animal hosts. Genetic variations were established among the 38 different subtypes detected so far, 14 of which are commonly found in human and animal hosts. The aim of the present study is to estimate the prevalence of the common Blastocystis subtypes and evaluate the possible correlation with several variables (gender, age, symptoms, domestic animals…), among patients from the southern region of Syria. Fecal samples were collected from individuals suffering from gastrointestinal complaints. Microscopic examination along with genotype analyses using seven pairs of subtype-specific primers was performed. Our results revealed the presence of Blastocystis sp. in 46 isolates out of the 60 samples microscopically studied (76.7%); single infection was detected in 24 isolates whereas co-infection with other protozoa was identified in 22 ones. Molecular detection targeting the SSU rRNA gene revealed a 100% positive presence of Blastocystis sp. in all the samples. Genotyping results detected the presence of five different subtypes (ST1-ST5) with varying proportions. However, ST1 was the dominant subtype observed (66.7%). Mixed subtype infections were found in 9 isolates (15%). Three samples remained undefined, nonetheless. Our statistical results showed no significant correlation between Blastocystis STs infection and the different studied variables. In conclusion, this study provides the first genetic characterization of Blastocystis subtypes prevalence in patients from the southern region of Syria. ST1 distribution was highly predominant. Further molecular studies are needed to estimate the prevalence of Blastocystis sp. infection in other regions in Syria and to understand the epidemiology and sources of transmission to humans.

Introduction

Blastocystis sp. is a gastrointestinal protozoan found in humans and many animals [1, 2]. It has a large distribution worldwide, with increasing cases in developing countries, due to poor hygiene practices and consumption of contaminated food or water [3, 4]. The pathogenicity of this parasite is questionable. For example, according to some studies, Blastocystis has no clinical relevance, while recent associations have been found between its presence and some specific gastrointestinal symptoms [5, 6]. An extensive genetic diversity has been observed among numerous Blastocystis sp. isolated from different hosts [7, 8]. At present, 38 subtypes (STs) have been identified (ST1-ST38) [911], 14 of which have been isolated from both humans and animals worldwide [1214], while the other STs have been reportedly found only in animals [15, 16]. Researchers have found that STs 1–4 appear to be the most common Blastocystis inhabitants of the human intestines, and the other 10 STs are rare in humans but are frequently detected in various animal groups including birds and hoofed animals [1, 16, 17]. Molecular identification studies of Blastocystis STs provide a discriminating tool for investigating the epidemiology of the parasite including transmission route, host specificity, and chemotherapeutic drug resistance [18, 19]. In Syria, Blastocystis sp. is not well studied and there is a lack of information on its prevalence, distribution, and its diverse subtypes. Therefore, the present study aimed to estimate the infection incidence of the different common subtypes among resident patients in the southern region of Syria and their possible correlation with several variables.

Materials and methods

Ethics approval and informed consent

Damascus University approved the aims and the procedures of the study (Ref. No: 4031/2019). Written informed consent was obtained from all patients participating in the study, or their parents or legal guardians.

Sampling and the studied specimen

A cross-sectional study was conducted between the period of November 2019 and March 2020. Individuals attending outpatient clinics at Al-Assad University Hospital, the Syrian Specialty Hospital and Dara Health Center, suffering from various gastrointestinal disorders, were recruited in this study. All patients were residents from the southern region of Syria (including the city of Damascus and its countryside, Dara’ governorate and its countryside). General information was obtained from each patient including age, gender, general health conditions, source of drinking water, contact with domestic animals like cats and dogs as well as symptoms such as diarrhea, abdominal spam, flatulence, anorexia/weight loss, …etc. Stool specimens were collected in clean sterile plastic containers. Each specimen was divided into two parts: one part was fixed in formalin solution 10% (1:3) for microscopic investigation and the other was stored at -20°C for molecular studies.

Microscopic examination

Approximately 1 mg of each fixed sample was stained by Lugol’s iodine as described in [20] and examined directly using light microscope (×40 magnifications). The diagnostic criterion adopted in determining the positivity of Blastocystis sp. infection was the detection of at least 5 vacuolar forms [21].

Molecular detection and subtyping

The total genomic DNA was extracted from almost 250–300 mg of each fecal sample collected using QIAamp-DNA stool mini kit (QIAamp-DNA Stool Mini Kit, QIAGEN) as described in [22] and stored at -20°C until use.

The small subunit ribosomal RNA (SSU-rRNA) gene was used for the detection of Blastocystis sp. in all the studied samples. For each specimen, 4 μl of the extracted template DNA was amplified using a pair of specific diagnostic primers (b11400 FORC and b11710. REVC) [23]. Each PCR reaction was conducted in 25μl final volume consisting of 12.5 μl One PCRTM master mix 2X (GeneDirex Inc, Taiwan ROC), 1 μl of each primer, and 10.5 μl nuclease-free water. Amplification conditions consisted of initial denaturation at 94°C for 3 min, 30 cycles including denaturation at 94°C for 1 min, annealing at 58°C for 1 min and extension at 72°C for 1 min. The final extension was at 72°C for 5 minutes.

Seven subtype-specific sequence-tagged-site (STS) primers were chosen for the identification of the different STs studied as shown in Table 1 [24]. The PCR cycling conditions were as described by [25].

Table 1. The primer sets used for genotyping.

STS primers sets / subtype Sequences of forward and reverse primers Product size
SB 83 / ST1 F: GAAGGACTCTCTGACGATGA 351 (bp)
R: GTCCAAATGAAAGGCAGC
SB340 / ST2 F: TGTTCTTGTGTCTTCTCAGCTC 704 (bp)
R: TTCTTTCACACTCCCGTCAT
SB227 / ST3 F: TAGGATTTGGTGTTTGGAGA 526 (bp)
R: TTAGAAGTGAAGGAGATGGAAG
SB337 / ST4 F: GTCTTTCCCTGTCTATTCTGCA 487 (bp)
R: AATTCGGTCTGCTTCTTCTG
SB336 / ST5 F: GTGGGTAGAGGAAGGAAAACA 317 (bp)
R: AGAACAAGTCGATGAAGTGAGAT
SB332 / ST6 F: GCATCCAGACTACTATCAACATT 338 (bp)
R: CCATTTTCAGACAACCACTTA
SB155 / ST7 F: ATCAGCCTACAATCTCCTC 650 (bp)
R: ATCGCCACTTCTCCAAT

All PCR experiments contained a negative control (4 μl of nuclease-free water) for contamination detection. PCR reactions were carried out using Eppendorf Master Cycler. The PCR products were electrophoresed in 1.5–2% agarose gel stained with ethidium bromide (Sigma-Aldrich, USA) along with a 100 bp DNA ladder (GeneDirex Inc, Taiwan ROC) as a standard size.

Statistical analysis

All data were analyzed using IBM SPSS Statistics Version 25.0 (SPSS, Inc.; Chicago, IL, USA). Percentages were used to describe the prevalence of the different Blastocystis STs. Pearson’s chi-squared and Fisher’s Exact tests were used to assess the possible association between subtypes and the different studied variables. A P value of ≤ 0.05 was considered statistically significant.

Results

A total of 60 outpatients, who visited hospitals and health centres located in the southern region of Syria with different digestive complaints, participated in this study. The female to male ratio was approximately 1.4 (58.3%; 41.7% respectively). In general, the age of patients ranged from 3 to 76 years. The mean was 31.9 ± 21.3 and the median age was 26 years old.

Microscopic analysis showed that only 46 (76.7%) samples were positive for the presence of vacuolar forms of Blastocystis sp., whereas molecular detection revealed the existence of Blastocystis sp. in all the samples (n = 60, 100%).

Furthermore, our genotyping results detected the presence of five different STs in 57 isolates (95%), while three samples remained undefined (5%). A single ST infection was found in 48 samples (84.2%), while mixed STs were found in nine isolates (15.8%) as follows: ST1+ST3 (n = 5), ST1+ST2 (n = 3) and ST1+ST2+ST3 (n = 1).

The infection with different STs alone was detected in more than half of the samples (33, ~55%), while co-infection with other intestinal parasites was found in 27 samples (45%). Interestingly, ST1 infection was predominant in both cases (55%, and 41% respectively) (Table 2).

Table 2. The prevalence of Blastocystis subtypes with/without other intestinal parasites infections.

DIFFERENT SUBTYPES
ST1 ST2 ST3 ST4 ST5 MIX STS UNKNOWN STS
Single Infection (Blastocystis sp.): total (n = 33) 18 0 7 0 1 5 2
    (%) 54.5% 0 21.2% 0 3.03% 15.2% 6.1%
Protozoa Co-Infection: total (n = 27) 11 3 6 1 1 4 1
    (%) 40.7% 11.1% 22.2% 3.7% 3.7% 14.8% 3.7%
Co-infection
Blastocystis sp + Entamoeba sp 7 0 0 1 1 0 1
Blastocystis sp + Entamoeba sp + Entamoeba coli 0 1 1 0 0 1 0
Blastocystis sp + Entamoeba coli 2 1 5 0 0 2 0
Blastocystis sp + Giardia 1 1 0 0 0 0 0
Blastocystis sp + Entamoeba sp + Giardia 1 0 0 0 0 1 0

Furthermore, to exclude intestinal manifestations caused by other parasites, the clinical disorders in patients infected with Blastocystis sp. alone (31 isolates) were analyzed. Our results showed that the most frequent symptoms were flatulence, abdominal pain, and abdominal spam (61.3%, 58.1% and 54.8% respectively) (Table 3).

Table 3. The clinical symptoms relevant to the Blastocystis subtypes detected.

Clinical symptoms Different Subtypes Total
N = 31
(%)
ST1 ST3 ST5 ST1+ST2 ST1+ST3
(n = 18) (n = 7) (n = 1) (n = 3) (n = 2)
Abdominal pain 11 4 1 2 - 18 (58.1%)
Flatulence 11 4 1 2 1 19 (61.3%)
Abdominal spam 10 4 - 2 1 17 (54.8%)
Anorexia/Weight loss 8 2 1 1 1 13 (41.9%)
Nausea/ Vomiting 10 4 - - 1 15 (48.4%)
Diarrhea 5 2 - 1 - 8 (25.8%)
Constipation 5 - 1 1 - 7 (22.6%)
Headache 4 1 1 1 2 9 (29.03%)

Our statistical analysis results showed no significant correlation between any of the STs detected and between age groups, gender, drinking water supply, contact with domestic animals nor between mechanical vectors, as shown in Table 4.

Table 4. Association between Blastocystis subtypes and the studied variables.

Variable ST1 P ST2 P ST3 P ST4 P ST5 P MIX STs P
n(%) n(%) n(%) n(%) n(%) n(%)
29 3 13 1 2 9
50.9% 5.3% 22.8% 1.8% 3.5% 15.8%
Gender
Male 12 0.872a 1 1b 4 0.423a - - - - 6 0.137 b
(n = 23; 40.1%)
Female 17 2 9 1 2 3
(n = 34; 59.6%)
Age
3–20 11 0.886 a 1 - 5 0.928 a - - - - 3 0.969 a
(n = 20; 35.1%)
21–40 8 0 4 1 1 3
(n = 17; 29.8%)
>40 10 2 4 - 1 3
(n = 20; 35.1%)
Water Supply
Tap water 15 0.753 a 2 1b 6 0.208 a 1 - - - 5 1b
(n = 29; 50.9%)
No tap water 14 1 7 - 2 4
(n = 28; 49.1%)
Domestic animals (cat, dog,…)
Presence 7 0.346 a 1 0.481 b 4 0.251 b - - - - 2 1b
(n = 14; 24.6%)
No presence 22 2 9 1 2 7
(n = 43; 75.4%)
Mechanical vector (cockroaches, flies.)
Presence 4 0.352 b - - 1 1b - - - - - -
(n = 5; 8.8%)
No presence 25 3 12 1 2 9
(n = 52; 91.2%)

n = number of participants, a: Chi-squared test; b: Fisher test

*statistically significant at p≤0.05

Additionally, no significant correlation was found between symptoms and any STs detected in our study (Table 5).

Table 5. Association between dominant Blastocystis subtypes and patients’ symptoms.

ST1 (n = 18) P ST3 (n = 7) P Mixed STs (n = 5) P
Clinical Symptoms
Abdominal pain Yes 11 0.972a 4 1b
2 0.369b
No 7 3 3
Flatulence Yes 11 0.285a 4 1b
3 1b
No 7 3 2
Abd. Spasm Yes 10 0.490a 4 0.703b 3 0.668b
No 8 3 2
Nausea/Vomiting Yes 10 0.123a 4 0.427b 1 0.391b
No 8 3 4
Anorexia/WL Yes 8 0.214a 2 1b 2 1b
No 10 5 3
Headache Yes 5 1b 1 0.662b 3 0.098b
No 13 6 2
Diarrhea Yes 5 0.488b 2 0.635b 1 1b
No 13 5 4
Constipation Yes 6 0.164b - - 1 1b
No 12 7 4

n = number of participants; WL: weight lost, a: Chi-squared test; b: Fisher test; *statistically significant at p≤0.05

Discussion

Blastocystis sp. is an intestinal parasite whose pathogenic role is underestimated; several studies reported its presence in both asymptomatic and symptomatic patients [26, 27]. In Syria, epidemiological and molecular studies on this parasite are scarce. This study is the first to identify and characterize Blastocystis sp. subtypes in 60 individuals from the southern region of Syria suffering from various gastrointestinal symptoms. The infection of Blastocystis sp. was detected by direct examination and conventional PCR methods. Our results revealed a high prevalence of infection, reaching 100% using the molecular tool. It was found that the rate of infection varies widely between different countries and between regions within the same country [2831]; for example, in countries such as Lebanon, Qatar, United Arab Emirates, Saudi Arabia and Libya, the incidence of Blastocystis sp. ranged from 44.4% up to 86.6% [1, 3235]. Whereas other studies from Iran [29], Tunisia [15], Egypt [36] and Lebanon [37] showed low infection rates (8.1%, 13%, 15.3% and 19% respectively). This difference can be explained according to the prevailing epidemiological situation and different climatic conditions [38].

Our data identified five different Blastocystis STs (ST1-ST5) in 57 samples (95%). However, three samples remained undefined (5%). This could be explained by the moderate sensitivity of the primers used in genotyping [39] or could be other different subtypes.

Previous studies have shown that ST1 and ST3 are the most prevalent subtypes distributed among human individuals and several kinds of animals worldwide [31, 40, 41]. Earlier reports from the Middle East revealed that the most dominant Blastocystis subtype was ST3 followed by ST1 [26, 36, 42, 43]. However, in our study, ST1 was the most predominant (66.7%). This finding is in agreement with previous studies conducted in Iran [2, 44], Libya [35], Turkey [45] and the United Arab Emirates [33].

Interestingly, our present study has identified mixed different STs infection in approximately one-sixth of the samples. Mixed STs infection has been reported previously with varying prevalence [8, 4648] and can be explicated with probable exposure to different sources of contamination [49].

Earlier reports pointed out to a possible high risk of Blastocystis sp. infection in people with close contact to animals, supporting the hypothesis of transmission from animals to humans [50, 51]. For example, Ruaux et al. found that ST1 was the main subtype amongst patients working in shelter-resident dogs and cats, emphasizing the potential role of domestic animals in human Blastocystis sp. infection, while ST3 was more limited to humans [52]. However, in our study, none of the STs identified were significantly associated with the presence of domestic animals or the mechanical vectors either, which may be due to the limited number of the studied samples.

Additionally, in this study, no significant correlation was found between the different drinking water sources and between any Blastocystis STs infection. This finding can be explained by the fact that most of our patients stated that they drink tap water, which is generally purified before being distributed to the residences and is in accordance with several previous studies which detected a negative association between Blastocystis STs and tap water as a drinking source [19, 53].

The pathogenic role of Blastocystis sp. in causing clinical symptoms remains a controversial issue due to its genetic diversity, inability to exclude any other intestinal parasites, bacteria, or virus causing the same digestive symptoms as well as the different immune responses and the composition of the intestinal microbiota of the host [39, 54, 55].

In this study, 56.9% of individuals infected with ST1 had various gastrointestinal symptoms; however, no significant correlation was found between the different symptoms. This finding disagrees with some previous studies that suggest that Blastocystis sp. ST1 may have a pathogenic effect and cause symptomatic infections [42, 56, 57] and is in line with previous data that did not find any statistically significant correlation between Blastocystis sp. infection and any gastrointestinal symptoms. It is worth mentioning that half of the samples ~55% in this study were infected with the different STs detected alone, while co-infection with other intestinal parasites were found in 45% of the samples, which leaves the question about the possible real pathogenic potential of this parasite still open [19, 58].

Furthermore, our data showed that females had a higher infection rate compared to males. Yet, no significant association was found between gender and Blastocystis infection (P = 0.872). This finding is consistent with several previous studies conducted in many countries [35, 59]. Moreover, the incidence of Blastocystis infection was relatively similar in all age groups. No association was detected with any particular ST. Our data comes in line with the study of Khaled et al. conducted on Syrian refugees living in North Lebanon [49], and with research from Qatar by Abu-Madi et al. where no difference was found between the prevalence of Blastocystis and between age groups [32]. However, our finding did not support previous reports indicating an association between age and infection being more common in young or adult patients [29, 36].

Conclusion

This study is the first report from the southern region of Syria to characterize and detect the prevalence of different Blastocystis sp. STs. Despite the limited number of the samples, this study showed the predominant distribution of ST1. However, further studies are needed on large samples (humans and animals) and in the different regions of Syria that may lead to a better knowledge of the Blastocystis sp. prevalence, transmission sources to humans, interaction with the host, and pathogenicity.

Acknowledgments

The authors gratefully acknowledge all the patients and their families for taking part in this study. We also thank Ms. Marah Marrawi for her assistance with statistical analyses and Dr Rasheed Abdul Hadi for proofreading.

Data Availability

All relevant data are within the manuscript.

Funding Statement

the authors received no specific funding for this work.

References

  • 1.Osman M, El Safadi D, Cian A, Benamrouz S, Nourrisson C, Poirier P, et al. Prevalence and risk factors for intestinal protozoan infections with Cryptosporidium, Giardia, Blastocystis and Dientamoeba among schoolchildren in Tripoli, Lebanon. PLoS Negl Trop Dis. 2016. Mar 14. 10(3):e0004496. doi: 10.1371/journal.pntd.0004496 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Delshad A, Saraei M, Alizadeh SA, Niaraki SR, Alipour M, Hosseinbigi B, et al. Distribution and molecular analysis of Blastocystis subtypes from gastrointestinal symptomatic and asymptomatic patients in Iran. Afr Health Sci. 2020. Oct 7. 20(3):1179–89. doi: 10.4314/ahs.v20i3.21 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Al Nahhas S, Aboualchamat G. Investigation of parasitic contamination of salad vegetables sold by street vendors in city markets in Damascus, Syria. Food and Waterborne Parasitology. 2020. Dec 1;21:e00090. doi: 10.1016/j.fawpar.2020.e00090 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Belkhair J, Karrati I, Tarmidi M, El Mezouari M, Moutaj R. Blastocystis hominis microbiota: study of 13255 patients and review of the literature. J Microbiol Exp. 2021;9(2):29–32. doi: 10.15406/jmen.2021.09.00319 4. [DOI] [Google Scholar]
  • 5.Verma R, Delfanian K. Blastocystis hominis associated acute urticaria. Am J Med Sci. 2013. Jul 1. 346(1):80–1. doi: 10.1097/MAJ.0b013e3182801478 [DOI] [PubMed] [Google Scholar]
  • 6.Deng Y, Zhang S, Ning C, Zhou Y, Teng X, Wu X, et al. Molecular Epidemiology and Risk Factors of Blastocystis sp. Infections Among General Populations in Yunnan Province, Southwestern China. Risk Manag Health Policy. 2020. 13:1791. doi: 10.2147/RMHP.S269664 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Wawrzyniak I, Poirier P, Viscogliosi E, Dionigia M, Texier C, Delbac F. Blastocystis, an unrecognized parasite: an overview of pathogenesis and diagnosis. Ther Adv Infect Dis. 2013; 1 (5): 167–78. doi: 10.1177/2049936113504754 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Khademvatan S, Masjedizadeh R, Yousefi-Razin E, Mahbodfar H, Rahim F, Yousefi E, et al. PCR-based molecular characterization of Blastocystis hominis subtypes in southwest of Iran. J Infect Public Health. 2018. Jan 1; 11(1):43–7. doi: 10.1016/j.jiph.2017.03.009 [DOI] [PubMed] [Google Scholar]
  • 9.Stensvold CR, Clark CG. Pre-empting Pandora’s box: Blastocystis subtypes revisited. Trends in parasitology. 2020. Mar 1;36(3):229–32. [DOI] [PubMed] [Google Scholar]
  • 10.Baek S, Maloney JG, Molokin A, George NS, Cortés Vecino JA, Santin M. Diversity of Blastocystis subtypes in horses in Colombia and identification of two new subtypes. Microorganisms. 2022. Aug 24;10(9):1693 doi: 10.3390/microorganisms10091693 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Maloney JG, Molokin A, Seguí R, Maravilla P, Martínez-Hernández F, Villalobos G, et al. Identification and Molecular Characterization of Four New Blastocystis Subtypes Designated ST35-ST38. Microorganisms. 2022. Dec 23;11(1):46. doi: 10.3390/microorganisms11010046 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Alfellani MA, Stensvold CR, Vidal-Lapiedra A, Onuoha ES, Fagbenro-Beyioku AF, Clark CG. Variable geographic distribution of Blastocystis subtypes and its potential implications. Acta tropica. 2013. Apr 1;126(1):11–8 [DOI] [PubMed] [Google Scholar]
  • 13.Khaled S, Gantois N, Ly AT, Senghor S, Even G, Dautel E, et al. Prevalence and subtype distribution of Blastocystis sp. in Senegalese school children. Microorganisms. 2020. Sep 12;8(9):1408 doi: 10.3390/microorganisms8091408 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Hubline JS, Maloney JG, Santin M. Blastocystis in domesticated and wild mammals and birds. Research in Veterinary Science. 2021. Mar 1;135:260–82 [DOI] [PubMed] [Google Scholar]
  • 15.Abda IB, Maatoug N, Romdhane RB, Bouhelmi N, Zallegua N, Aoun K, et al. Prevalence and subtype identification of Blastocystis sp. in healthy individuals in the Tunis area, Tunisia. Am J Trop Med Hyg. 2017. Jan 11; 96(1):202. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Bahrami F, Haghighi A, Zamini G, Khademerfan M. Molecular evidence for zoonotic transmission of Blastocystis subtypes in Kurdistan province, West of Iran. Ann Parasitol. 2020. Jan 1; 66(1):19–25. doi: 10.17420/ap6601.234 [DOI] [PubMed] [Google Scholar]
  • 17.Parkar U, Traub RJ, Kumar S, Mungthin M, Vitali S, Leelayoova S, et al. Direct characterization of Blastocystis from faeces by PCR and evidence of zoonotic potential. Parasitol. 2007. Mar; 134(3):359–67. doi: 10.1017/S0031182006001582 [DOI] [PubMed] [Google Scholar]
  • 18.Özyurt M, Kurt Ö, Mølbak K, Nielsen HV, Haznedaroglu T, Stensvold CR. Molecular epidemiology of Blastocystis infections in Turkey. Parasitol Int. 2008. Sep 1; 57(3):300–6. [DOI] [PubMed] [Google Scholar]
  • 19.Seyer A, Karasartova D, Ruh E, Güreser AS, Turgal E, Imir T, et al. Epidemiology and prevalence of Blastocystis spp. in North Cyprus. Am J Trop Med Hyg. 2017. May 3;96(5):1164. doi: 10.4269/ajtmh.16-0706 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Manser MM, Saez AC, Chiodini PL. Faecal parasitology: concentration methodology needs to be better standardised. Plos neglected tropical diseases. 2016. Apr 13;10(4): e0004579. doi: 10.1371/journal.pntd.0004579 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Speich B, Marti H, Ame SM, Ali SM, Bogoch II, Utzinger J, et al. Prevalence of intestinal protozoa infection among school-aged children on Pemba Island, Tanzania, and effect of single-dose albendazole, nitazoxanide and albendazole-nitazoxanide. Parasites & vectors. 2013. Dec;6(1):1–8. doi: 10.1186/1756-3305-6-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Rebih N, Boutaiba S, Aboualchamat G, Souttou K, Hakem A, Al Nahhas S. Molecular and epidemiological characterization of Giardia intestinalis assemblages detected in Djelfa, Algeria. J Parasit Dis. Official Organ of the Indian Society for Parasitology. 2020. Jun;44(2):281. doi: 10.1007/s12639-020-01206-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Stensvold R, Brillowska-Dabrowska A, Nielsen HV, Arendrup MC. Detection of Blastocystis hominis in unpreserved stool specimens by using polymerase chain reaction. J Parasitol. 2006. Oct;92(5):1081–7. doi: 10.1645/GE-840R.1 [DOI] [PubMed] [Google Scholar]
  • 24.Yoshikawa H, Wu Z, Nagano I, Takahashi Y. Molecular comparative studies among Blastocystis isolates obtained from humans and animals. J Parasitol. 2003. Jun;89(3):585–94. doi: 10.1645/00223395(2003)089[0585:MCSABI]2.0.CO;2 [DOI] [PubMed] [Google Scholar]
  • 25.Yakoob J, Jafri W, Beg MA, Abbas Z, Naz S, Islam M, et al. irritable bowel syndrome is it associated with genotypes of Blastocystis hominis. Parasitol Res. 2010. Apr;106(5):1033–8. doi: 10.1007/s00436-010-1761-x [DOI] [PubMed] [Google Scholar]
  • 26.Mohamed RT, El-Bali MA, Mohamed AA, Abdel-Fatah MA, El-Malky MA, Mowafy NM, et al. Subtyping of Blastocystis sp. isolated from symptomatic and asymptomatic individuals in Makkah, Saudi Arabia. Parasites & vectors. 2017. Dec;10(1):1–7. doi: 10.1186/s13071-017-2114-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Asghari A, Hassanipour S, Hatam G. Comparative molecular prevalence and subtypes distribution of Blastocystis sp. a potentially zoonotic infection isolated from symptomatic and asymptomatic patients in Iran: a systematic review and meta-analysis. Acta Parasitologica. 2021. Sep;66(3):745–59. doi: 10.1007/s11686-021-00360-0 [DOI] [PubMed] [Google Scholar]
  • 28.Niaraki SR, Hajialilo E, Delshad A, Alizadeh SA, Alipour M, Heydarian P, et al. Molecular epidemiology of Blastocystis spp. in children referred to Qods hospital in northwest of Iran. J Parasit Dis. 2020. Mar 44(1):151–8. doi: 10.1007/s12639-019-01177-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Salehi M, Mardaneh J, Niazkar HR, Minooeianhaghighi M, Arshad E, Soleimani F, et al. Prevalence and subtype analysis of Blastocystis hominis isolated from patients in the northeast of Iran. J Parasitol Res. 2021. Jan 13;2021. doi: 10.1155/2021/8821885 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Souppart L, Sanciu G, Cian A, Wawrzyniak I, Delbac F, Capron M, et al. Molecular epidemiology of human Blastocystis isolates in France. Parasitol Res. 2009. Jul;105(2):413–21. doi: 10.1007/s00436-009-1398-9 [DOI] [PubMed] [Google Scholar]
  • 31.Popruk S, Pintong AR, Radomyos P. Diversity of Blastocystis subtypes in humans. J Trop Med Parasitol. 2013;36(2):88–97. [Google Scholar]
  • 32.Abu-Madi M, Aly M, Behnke JM, Clark CG, Balkhy H. The distribution of Blastocystis subtypes in isolates from Qatar. Parasit. Vectors 2015, 8, 465 doi: 10.1186/s13071-015-1071-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.AbuOdeh R, Ezzedine S, Samie A, Stensvold CR, ElBakri A. Prevalence and subtype distribution of Blastocystis in healthy individuals in Sharjah, United Arab Emirates. Infect. Genet. Evol. 2016, 37, 158–162. [DOI] [PubMed] [Google Scholar]
  • 34.Wakid MH, Aldahhasi WT, Alsulami MN, El-Kady AM, Elshabrawy HA. Identification and Genetic Characterization of Blastocystis Species in Patients from Makkah, Saudi Arabia. Infection and Drug Resistance. 2022;15:491. doi: 10.2147/IDR.S347220 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Abdulsalam AM, Ithoi I, Al-Mekhlafi HM, Al-Mekhlafi AM, Ahmed A, Surin J. Subtype distribution of Blastocystis isolates in Sebha, Libya. PLoS One. 2013. Dec 20;8(12):e84372 doi: 10.1371/journal.pone.0084372 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Ahmed SA, El-Mahallawy HS, Mohamed SF, Angelici MC, Hasapis K, Saber T, et al. Subtypes and phylogenetic analysis of Blastocystis sp. isolates from West Ismailia, Egypt. Scientific Reports. 2022. Nov 9;12(1):1–2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.El Safadi D, Meloni D, Poirier P, Osman M, Cian A, Gaayeb L, et al. Molecular epidemiology of Blastocystis in Lebanon and correlation between subtype 1 and gastrointestinal symptoms. Am. J. Trop. Med. Hyg. 2013, 88, 1203–1206. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Javanmard E, Niyyati M, Ghasemi E, Mirjalali H, Aghdaei HA, Zali MR. Impacts of human development index and climate conditions on prevalence of Blastocystis: a systematic review and meta-analysis. Acta tropica. 2018. Sep 1; 185:193–203. doi: 10.1016/j.actatropica.2018.05.014 [DOI] [PubMed] [Google Scholar]
  • 39.Stensvold CR. Comparison of sequencing (barcode region) and sequence-tagged-site PCR for Blastocystis subtyping. J clin microbiol. 2013. Jan;51(1):190–4. doi: 10.1128/JCM.02541-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Clark CG, van der Giezen M, Alfellani MA, Stensvold CR. Recent developments in Blastocystis research. Adv. Parasitol. 2013, 82, 1–32. doi: 10.1016/B978-0-12-407706-5.00001-0 [DOI] [PubMed] [Google Scholar]
  • 41.Stensvold CR, Clark CG. Current status of Blastocystis: a personal view. Parasitology international. 2016. Dec 1;65(6):763–71 [DOI] [PubMed] [Google Scholar]
  • 42.Moosavi A, Haghighi A, Mojarad EN, Zayeri F, Alebouyeh M, Khazan H, et al. Genetic variability of Blastocystis sp. isolated from symptomatic and asymptomatic individuals in Iran. Parasitol Res. 2012. Dec;111(6):2311–5. [DOI] [PubMed] [Google Scholar]
  • 43.Greige S, El Safadi D, Khaled S, Gantois N, Baydoun M, Chemaly M, et al. First report on the prevalence and subtype distribution of Blastocystis sp. in dairy cattle in Lebanon and assessment of zoonotic transmission. Acta Trop. 2019, 194, 23–29. [DOI] [PubMed] [Google Scholar]
  • 44.Taghipour A, Javanmard E, Mirjalali H, Haghighi A, Tabarsi P, Sohrabi MR, et al. Blastocystis subtype 1 (allele 4); predominant subtype among tuberculosis patients in Iran. Comp Immunol Microbiol Infect Dis. 2019. Aug 1; 65:201–6. doi: 10.1016/j.cimid.2019.06.005 [DOI] [PubMed] [Google Scholar]
  • 45.Eroglu F, Genc A, Elgun G, Koltas IS. Identification of Blastocystis hominis isolates from asymptomatic and symptomatic patients by PCR. Parasitol Res. 2009. Nov;105(6):1589–92 [DOI] [PubMed] [Google Scholar]
  • 46.Malheiros AF, Stensvold CR, Clark CG, Braga GB, Shaw JJ. Molecular characterization of Blastocystis obtained from members of the indigenous Tapirapé ethnic group from the Brazilian Amazon region, Brazil. The American journal of tropical medicine and hygiene. 2011. Dec 12;85(6):1050. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Ascuña-Durand K, Salazar-Sánchez RS, Castillo-Neyra R, Ballón-Echegaray J. Relative Frequency of Blastocystis Subtypes 1, 2, and 3 in Urban and Periurban Human Populations of Arequipa, Peru. Trop Med Infect. 2020. Dec;5(4):178. doi: 10.3390/tropicalmed5040178 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Dogan N, Aydin M, Tuzemen NU, Dinleyici EC, Oguz I, Dogruman-Al F. Subtype distribution of Blastocystis spp. isolated from children in Eskisehir, Turkey. Parasitol Int. 2017. Feb 1;66(1):948–51. [DOI] [PubMed] [Google Scholar]
  • 49.Khaled S, Gantois N, Ayoubi A, Even G, Sawant M, El Houmayraa J, et al. Blastocystis sp. prevalence and subtypes distribution amongst Syrian refugee communities living in North Lebanon. Microorganisms. 2021. Jan 16;9(1):184. doi: 10.3390/microorganisms9010184 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Li W, Liu X, Gu Y, Liu J, Luo J. Prevalence of Cryptosporidium, Giardia, Blastocystis, and trichomonads in domestic cats in East China. J Vet Med Sci. 2019:19–0111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Mohammadpour I, Bozorg-Ghalati F, Gazzonis AL, Manfredi MT, Motazedian MH, Mohammadpour N. First molecular subtyping and phylogeny of Blastocystis sp. isolated from domestic and synanthropic animals (dogs, cats and brown rats) in southern Iran. Parasites & Vectors. 2020. Dec;13(1):1–1. 10.1186/s13071-020-04225-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Ruaux CG, Stang BV. Prevalence of Blastocystis in shelter-resident and client-owned companion animals in the US Pacific Northwest. PLoS One. 2014. Sep 16;9(9): e107496 doi: 10.1371/journal.pone.0107496 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Leelayoova S, Siripattanapipong S, Thathaisong U, Naaglor T, Taamasri P, Piyaraj P, et al. Drinking water: a possible source of Blastocystis spp. subtype 1 infection in schoolchildren of a rural community in Central Thailand. Am J Trop Med Hyg. 2008;79(3):401–6. [PubMed] [Google Scholar]
  • 54.Tan KS. New insights on classification, identification, and clinical relevance of Blastocystis spp. Clinical microbiology reviews. 2008. Oct;21(4):639–65. doi: 10.1128/CMR.00022-08 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Audebert C, Even G, Cian A, Loywick A, Merlin S, Viscogliosi E, et al. Colonization with the enteric protozoa Blastocystis is associated with increased diversity of human gut bacterial microbiota. Scientific reports. 2016. May 5;6(1):1–1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Yoshikawa H, Wu Z, Kimata I, Iseki M, Ali IK, Hossain MB, et al. Polymerase chain reaction-based genotype classification among human Blastocystis hominis populations isolated from different countries. Parasitology research. 2004. Jan;92(1):22–9. doi: 10.1007/s00436-003-0995-2 [DOI] [PubMed] [Google Scholar]
  • 57.Yan Y, Su S, Lai R, Liao H, Ye J, Li X, et al. Genetic variability of Blastocystis hominis isolates in China. Parasitol Res. 2006. Oct;99(5):597–601. [DOI] [PubMed] [Google Scholar]
  • 58.Guilavogui T, Gantois N, Even G, Desramaut J, Dautel E, Denoyelle C, et al. Detection, Molecular Identification and Transmission of the Intestinal Protozoa Blastocystis sp. in Guinea from a Large-Scale Epidemiological Study Conducted in the Conakry Area. Microorganisms. 2022. Feb 15;10(2):446. doi: 10.3390/microorganisms10020446 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Li LH, Zhou XN, Du ZW, Wang XZ, Wang LB, Jiang JY, et al. Molecular epidemiology of human Blastocystis in a village in Yunnan province, China. Parasitol. Int. 2007. Dec 1;56(4):281–6. doi: 10.1016/j.parint.2007.06.001 [DOI] [PubMed] [Google Scholar]

Decision Letter 0

Kovy Arteaga-Livias

29 Nov 2022

PONE-D-22-27237Molecular characterization of Blastocystis subtypes in symptomatic patients from the southern region of SyriaPLOS ONE

Dear Dr. Nahhas,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

After a lengthy review, we are pleased to have achieved an adequate assessment of your manuscript.

Note that we had to resort to a third reviewer who has suggested significant changes; I hope you will consider all the indications and improve the validity and quality of your manuscript.

Please submit your revised manuscript by Dec 29 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.​

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Kovy Arteaga-Livias

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at 

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and 

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels. 

  

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: No

Reviewer #2: Partly

Reviewer #3: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: No

Reviewer #2: Yes

Reviewer #3: No

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: No

Reviewer #2: Yes

Reviewer #3: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: No

Reviewer #2: No

Reviewer #3: No

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: Comments to the Authors

This manuscript assesses the occurrence and molecular diversity of the Stramenopile of uncertain pathogenicity Blastocystis sp. in outpatients (n=60) of all age groups with gastrointestinal manifestations seeking medical care in southern Syria. Detection of the protist was simultaneously accomplished by conventional microscopy and PCR using subtype-specific primers. An infection/colonization rate of 100% was obtained by PCR. Five different STs (ST1-ST5) were identified. No Sanger sequencing was conducted for subtype confirmation and allele calling. Basic statistical analyses were conducted to ascertain whether epidemiological or clinical variables were associated with an increased risk of harbouring Blastocystis sp. The manuscript is hampered by methodological issues that have compromised the quality of the obtained results and the conclusions reached by the Authors. Writing of the manuscript is poor, with some sections (e.g., discussion) needing more in-depth comments and analyses integrating the information provided here with that already known from previous surveys. The finding of 15% of samples harbouring mixed subtype combinations is interesting, as it demonstrates that mixed infections might be more frequent than initially anticipated in endemic areas. English grammar and editing need polishing. I recommend reviewing by an English native speaker.

Major issues

1. Please note that there are 30 Blastocystis subtypes currently considered as valid, not 17 as the Authors claim in lines 20 and 49. For subtypes ST1-ST22 please see Stensvold and Clark Trends Parasitol. 2020;36:229-232. For the description of ST23-ST26 see Maloney et al. Parasitol Res. 2019;118:575-582. For the description of ST27 and ST28 see Maloney et al. Parasite Epidemiol Control. 2020;9:e00138. For the description of ST29 see Maloney et al. Parasitol Res. 2021;120:2219-2231. For the description of ST30-ST31 see Maloney et al. Microorganisms. 2021;9:1343. For the description of ST32 see Higuera et al. Front Vet Sci. 2021;8:732129. For the description of ST33 and ST34 see Baek et al. Microorganisms 2022;10:1693. Just with this detail the Authors demonstrated very poor awareness of the current Blastocystis field.

2. It is very unclear why the Authors conducted both microscopy and PCR in all faecal samples collected. What is the rationale of using microscopy under these circumstances? In other words, what is the benefit of conducting microscopy over PCR (a method far more sensitive and specific for the detection of Blastocystis) in this study?

3. Sample size is an issue. Sixty samples is a very limited sample panel to extract robust and credible results, particularly from an statistical point of view.

4. Some of the conclusions reached by the Authors are overstated and not supported by the evidence provided.

5. Lines 46-47: Morphological differentiation among Blastocystis subtypes is not difficult. It is impossible. Please amend.

6. Line 57: I am not aware of any campaign specifically devoted to preventing blastocystiasis. If the Authors have this information, please mention it, otherwise, remove this statement.

7. Line 59: please clearly define what a “resident patient” is. Do you mean inpatient? Perhaps outpatient? Please clarify.

8. Line 66: this section is very poorly written and little informative. Please indicate the inclusion/exclusion criteria followed to recruit patients, and define the clinical manifestations considered. Indicate also the exact location where stool samples were collected, and which hospital/medical centres participated in the study and analysed the samples. Also, provide detailed information on the epidemiological (e.g, which types of drinking water sources were considered? Which domestic animals were considered?) and clinical variables gathered to assess the risk of infection/colonization by Blastocystis sp. Please be as thorough as possible in your description of this section.

9. Line 77: Blastocystis presents vacuolar, avacuolar, granular, amoeboid, and cyst forms. What was the rationale for considering vacuolar forms only for diagnosing the presence of the protist? Why the Authors stablished a cut-off of five vacuolar forms for considering a result positive? Any reference to back up this decision?

10. Line 83: The QIAamp DNA Stool Mini Kit is optimized for using 180-220 mg of faecal sample. Why did the authors decided to use 250-300 mg? By doing this the authors are hampering the performance of the kit to obtain good quality/quantity of genomic DNA.

11. Why did the Authors not submit PCR amplicons of the expected size for Sanger sequencing? This would allow subtype confirmation and probably allele calling. Also submitting representative sequences to GenBank as reference sequences obtained in Syria. All these would have added value to the manuscript.

12. Lines 133 and 140: Current Figures 1 and 2 are not essential and can be moved to the Supplmentary material section or even removed from the text.

13. Discussion section. Please describe what the current know epidemiological situation of Blastocystis in Syria and in neighbouring countries is. See for instance Al Nahhas and Aboualchamat Food Waterborne Parasitol. 2020;21:e00090. Clearly mention what is, in the opinion of the Authors, the main contribution of the manuscript to the field. Importantly, please devote a specific paragraph in the discussion section to list the limitations of the study and how these drawbacks have likely influenced the results obtained and the conclusions reached. For instance, how do the Authors feel about the robustness of their statistical analyses over 60 samples only?

14. Discussion section lines 173-181: please focus the discussion on the epidemiological scenario present in Middle East countries. It makes little sense include information from regions and countries (Australia, Peru, China) where the epidemiology of Blasotcystis can be very different and difficult to compare with. Amend.

15. Discussion section, lines 182-183: this statement is wrong. Please note that ST3 has been widely found in wildlife and livestock. See for instance Hublin et al. Res Vet Sci. 2021;135:260-282. Please make statements based on solid scientific evidence only

16. Discussion section, lines 188-190: any chance of analysing these isolates by Sanger sequencing and determine the subtypes involved?

17. Lines 193-196: please note that in Table 4 no associations were found between a given Blastocystis ST and the occurrence of gastrointestinal disorders. Therefore, this paragraph is overstated and misleading. Please amend and avoid extracting conclusions not supported by the results obtained in the study.

18. Lines 199-205: following my line of reasoning above, and in the absence of epidemiological and molecular data on Blastocystis in domestic animals and wildlife, the Authors cannot infer any zoonotic potential. Again, please avoid overstating and extracting conclusions not supported by the results obtained in the study.

Minor issues

1. Line 14: please clearly indicate which authors contributed equally to the work.

2. Lines 24 and 30: the abstract should include the nature of the variables included in the statistical analyses.

3. Line 26: the abstract should make clear that all 60 faecal samples were simultaneously investigated by microscopy and PCR.

4. Line 41: “sp.” should not be italicised.

5. Line 73: please clearly indicate here how long elapsed between sample collection and DNA extraction and purification.

6. Line 93: 94ºC.

7. Lines 94 and 95: 72ºC.

8. Line 118: please provide the median value instead the mean value. The former is far more informative.

9. Line 118: please see my comments above regarding proper description of clinical variables.

10. Line 169: the meaning of this sentence is apparently contradictory. Please amend.

Reviewer #2: Darwish et al., investigated the prevalence of Blastocystis sp., subtypes in southern regions of Syria. Data about the protist is rare in that region and such studies could be interesting. The manuscript need English writing revision and some clarification before consideration for publishing in the journal.

Abstract

Line: 20-21, the number of subtypes are now 22. Please check the literature (10.1016/j.pt.2019.12.009) and revise it here and through the text.

Introduction

Line 42: … the presence of Blastocystis sp.; however, …

Line 43: after references ([3, 4]) please insert a dot and insert new sentence.

Lines 41-45 need writing revision.

Line 49: please correct as mentioned for abstract. (Now, 22 subtypes have been characterized).

Line 53: rare in humans, but…

You may add some data about the prevalence of Blastocystis in Syria or neighbor countries.

Materials and Methods

Line 64: please terminate the sentence with a dot. … all patients participated in…

Please unify the term “Blastocystis” to “Blastocystis sp.” throughout the text.

Results

Line 127: … isolates.

Line 130: please delete “only”.

L137: mixed subtypes were …

L146: since all 60 samples were positive for Blastocystis with the SSU rRNA gene primers, you cannot rule out the symptoms due to other parasites. Therefore, please delete this sentence and modify your statement. You can discuss this in the discussion.

Discussion

This part is just a comparison between your data and data released by other countries. You should add more discussion about HOW and WHY you obtained this data. You should discuss about the distribution of subtypes in your study, the subtyping methods and translated subtypes from STS primer subtyping (what is discussed in your study) to consensus subtypes, which is mentioned in the “ Terminology for Blastocystis subtypes-a consensus (table 2)”.

Reviewer #3: This manuscript describes the occurrence and distribution of different Blastocystis subtypes detected in 48 samples out of 60 samples of symptomatic patients from southern region of Syria.

The distribution was compared according to age, gender, presence of domestic animals and availability of water supply. Moreover, association of different subtypes (single or mixed) with clinical symptoms was investigated. Five subtypes were identified; with ST1 was the predominant subtype followed by ST3.

Overall, the manuscript is straightforward; the findings are interesting and provide baseline molecular information on the distribution of Blastocystis subtypes in Syria. However, major drawbacks that clearly appear in the study design, data analysis and results presentation should be adequately addressed before this manuscript can be acceptable for publication. Please refer to the comments given below.

MAJOR REVISION

1. Justification of the study should be strengthened. If this is the first study to provide molecular information about Blastocystis in Syria; then this should be clearly stated as a justification; in addition to some epidemiological characteristics of the study area or some population-specific characteristics. If previous studies from other regions of Syria are available then related findings should be presented and research gaps should be stated.

2. The manuscript lacks information about the study design. Information about study design should be added to abstract and methods section. A STROBE checklist, used for the reporting of observational studies, can be downloaded (http://www.strobe-statement.org/index.php?id=available-checklists), filled in applicable manuscript section, and then the completed checklist can be uploaded as a Supporting Information file.

3. The manuscript lacks important information about the study area. What is the name of included city (cities) or districts? Was it a hospital-based or community-based study? What are the characteristics related to intestinal parasites? E.g. sanitation, rural or urban or semi-urban settings, etc. Such information is important for findings generalizability.

4. The manuscript lacks important information about the study population. Information on the recruitment strategy, sample size estimation, sample collection and transport should be provided. Such information is important for findings generalizability.

5. The sample size is small (n = 60). This should be acknowledged as a limitation. Another limitation should also be acknowledged; bacterial and viral causes of symptoms were not ruled out.

6. Data analysis and findings presentation should be improved. Refer to comments # 15-17.

MINOR REVISION

7. Introduction, 2nd sentence: Indeed, pathogenicity of Blastocystis is still controversial. This should be clearly indicated.

8. Line 68: “…from residing patients of the southern regions of Syria…”. What were the included cities or districts or health centers?

9. Line 76: cite a reference for the adopted diagnostic criterion.

10. Line 113: “assess the correlation” change to “assess the association”.

11. Line 122: rephrase the sentence. The word “isolates” can be a source of confusion to readers.

12. Line 124: what about the results of the other 12 patients? Was there any parasites detected or they were negative for any parasites?

13. Line 128: “60 isolates”. Does this refer to the 60 samples or the overall detected subtypes in the 48 samples?

14. Line 137-138: add the percentage after the subtype; i.e. by ST1+2 (5%) and ….

15. Table 2: It can be modified to improve clarity. Remove first total (%) row; and add its data to Single infection row. Then, add a row for co-infection with the data of last row. Then, add a row of Type of co-infection with the 5 rows of combination.

16. Table 4: it should be split into 2 tables. Table 1 for associated factors. Because of small number of positive cases, this table can include all samples; add a column for N examined (n=60) then a column for overall Blastocystis infection, then a column for P. Add columns for ST1 and ST3 with P column for each. The ST1 data should include all ST1 (single and mixed and co-infection; i.e. 34 cases (18+11+5), ST3 should include all ST3 (7+6+1!). Chi square test is not applicable for all variables, indicate where Fischer’s Exact test used. The suggested table design can be found in the attached file of these comments.

17. Table 4: Revise variables grouping. Age groups can be 4 – 20 and the last one should be > 40. Presence of animals should be Presence of domestic animals (Yes or No), why “Presence of insects” is mentioned here?

18. The new table 5 can be for Association of common subtypes and clinical symptoms. Modify the table to avoid repeating Chi square/p value rows. This table should include single infections of related subtypes, as it is. So, add columns for P values after each subtype column. No need to report Chi square values, just the P values and indicate the test used in footnote.

19. Lines 163-165: But these are for ST1 only, as indicated by the p value.

20. Avoid repeating results in discussion.

21. Are there previous findings from other regions of Syria? If yes, compare and discuss. Findings from neighbouring countries (Jordan, Lebanon, Iraq, Turkey, etc) can be used too.

22. Lines 196-198: indicate the limitation here that bacterial and viral causes were not ruled out.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.​

Reviewer #1: Yes: David Carmena

Reviewer #2: Yes: Hamed Mirjalali

Reviewer #3: Yes: Hesham M. Al-Mekhlafi

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

Attachment

Submitted filename: Reviewer report.pdf

PLoS One. 2023 Mar 16;18(3):e0283291. doi: 10.1371/journal.pone.0283291.r002

Author response to Decision Letter 0


20 Jan 2023

Reviewer #1: thank you for your precise and valuable time and comments, please find below our response to each comment.

Major Issues

1. Please note that there are 30 Blastocystis subtypes currently considered as valid, not 17 as the Authors claim in lines 20 and 49. For subtypes ST1-ST22 please see Stensvold and Clark Trends Parasitol. 2020;36:229-232. For the description of ST23-ST26 see Maloney et al. Parasitol Res. 2019;118:575-582. For the description of ST27 and ST28 see Maloney et al. Parasite Epidemiol Control. 2020;9:e00138. For the description of ST29 see Maloney et al. Parasitol Res. 2021;120:2219-2231. For the description of ST30-ST31 see Maloney et al. Microorganisms. 2021;9:1343. For the description of ST32 see

2. Higuera et al. Front Vet Sci. 2021;8:732129. For the description ofST33 and ST34 see Baek et al. Microorganisms 2022;10:1693. Just with this detail the Authors demonstrated very poor awareness of the current Blastocystis field. Modification has been done

2. It is very unclear why the Authors conducted both microscopy and PCR in all faecal samples collected. What is the rationale of using microscopy under these circumstances? In other words, what is the benefit of conducting microscopy over PCR (a method far more sensitive and specific for the detection of Blastocystis) in this study?

Microscopical examination was conducted for all stool samples in order to detect the presence of other types of Parasites (co infection) and to exclude these samples when correlate the possible association with symptoms.

3. Sample size is an issue. Sixty samples is a very limited sample panel to extract robust and credible results, particularly from an statistical point of view. We agree with that point, however previous studies in other countries applied on small/similar number of samples to our study, such as the study Perea et al., 2020 (number of samples is 66); Dogruman et al., 2009 (number of samples is 61)

4. Some of the conclusions reached by the Authors are overstated and not supported by the evidence provided. Thank you, we took this point in consideration.

Modification has been done

5. Lines 46-47: Morphological differentiation among Blastocystis subtypes is not difficult. It is impossible. Please amend. Modified

6. Line 57: I am not aware of any campaign specifically devoted to preventing blastocystiasis. If the Authors have this information, please mention it, otherwise, remove this statement. Statement has been removed

7. Line 59: please clearly define what a “resident patient” is. Do you mean inpatient? Perhaps outpatient? Please clarify We clarified this point in the M&M and in the Result sections

8. Line 66: this section is very poorly written and little informative. Please indicate the inclusion/exclusion criteria followed to recruit patients, and define the clinical manifestations considered. Indicate also the exact location where stool samples were collected, and which hospital/medical centres participated in the study and analysed the samples. Also, provide detailed information on the epidemiological (e.g, which types of drinking water sources were considered? Which domestic animals were considered?) and clinical variables gathered to assess the risk of infection/colonization by Blastocystis sp. Please be as thorough as possible in your description of this section. This section has been modified taking in consideration all your comments

9. Line 77: Blastocystis presents vacuolar, avacuolar, granular, amoeboid, and cyst forms. What was the rationale for considering vacuolar forms only for diagnosing the presence of the protist? Why the Authors stablished a cut-off of five vacuolar forms for considering a result positive? Any reference to back up this decision? We considered the 5 and plus vacuolar forms as being more accurate to detect, depending on previous reference (added in the text)

10. Line 83: The QIAamp DNA Stool Mini Kit is optimized for using 180-220 mg of faecal sample. Why did the authors decided to use 250-300 mg? By doing this the authors are hampering the performance of the kit to obtain good quality/quantity of genomic DNA.

This protocol is recommended by the kit itself when the target DNA is not distributed homogeneously in the stool and /or low concentration

11. Why did the Authors not submit PCR amplicons of the expected size for Sanger sequencing? This would allow subtype confirmation and probably allele calling. Also submitting representative sequences to GenBank as reference sequences obtained in Syria. All these would have added value to the manuscript. Thank you. We indeed planning to do so, but unfortunately due to the high coast and the sanctions on Syria this may take a while to accomplish

12. Lines 133 and 140: Current Figures 1 and 2 are not essential and can be moved to the Supplmentary material section or even removed from the text. Thank you for your comment. We removed the figures.

13. Discussion section. Please describe what the current know epidemiological situation of Blastocystis in Syria and in neighbouring countries is. See for instance Al Nahhas and Aboualchamat Food Waterborne Parasitol. 2020;21:e00090. Clearly mention what is, in the opinion of the Authors, the main contribution of the manuscript to the field. Importantly, please devote a specific paragraph in the discussion section to list the limitations of the study and how these drawbacks have likely influenced the results obtained and the conclusions reached. For instance, how do the Authors feel about the robustness of their statistical analyses over 60 samples only? We should clarify that this is the first molecular study on the Blastocystis sp. subtypes in the southern region of Syria.

We took your consideration and made the suitable modification

14. Discussion section lines 173-181: please focus the discussion on the epidemiological scenario present in Middle East countries. It makes little sense include information from regions and countries (Australia, Peru, China) where the epidemiology of Blasotcystis can be very different and difficult to compare with. Amend Modification has been made

15. Discussion section, lines 182-183: this statement is wrong. Please note that ST3 has been widely found in wildlife and livestock. See for instance Hublin et al. Res Vet Sci. 2021;135:260-282. Please make statements based on solid scientific evidence only

Modification has been made

16. Discussion section, lines 188-190: any chance of analysing these isolates by Sanger sequencing and determine the subtypes involved? We will try to do so as we mentioned above

17. Lines 193-196: please note that in Table 4 no associations were found between a given Blastocystis ST and the occurrence of gastrointestinal disorders. Therefore, this paragraph is overstated and misleading. Please amend and avoid extracting conclusions not supported by the results obtained in the study. Modification has been done

18. Lines 199-205: following my line of reasoning above, and in the absence of epidemiological and molecular data on Blastocystis in domestic animals and wildlife, the Authors cannot infer any zoonotic potential. Again, please avoid overstating and extracting conclusions not supported by the results obtained in the study. Modification has been done

Minor issues

1. Line 14: please clearly indicate which authors contributed equally to the work. Clarifying has been done

2. Lines 24 and 30: the abstract should include the nature of the variables included in the statistical analyses

Done

3. Line 26: the abstract should make clear that all 60 faecal samples were simultaneously investigated by microscopy and PCR. Done

4. Line 41: “sp.” should not be italicised.

Done

5. Line 73: please clearly indicate here how long elapsed between sample collection and DNA extraction and purification. Each stool specimen was divided into two parts: one part was fixed in formalin solution 10% (1:3) for microscopic investigation and the other was stored at -20◦C for molecular studies

6. Line 93: 94ºC. Done

7. Lines 94 and 95: 72ºC. Done

8. Line 118: please provide the median value instead the mean value. The former is far more informative. Done

9. Line 118: please see my comments above regarding proper description of clinical variables. The clinical symptoms were clearly stated in table 3

10. Line 169: the meaning of this sentence is apparently contradictory. Please amend. Clarification has been done

Reviewer #2: thank you for your valuable comments, please find below our response to each comment

Line: 20-21, the number of subtypes are now 22. Please check the literature (10.1016/j.pt.2019.12.009) and revise it here and through the text. Done

Line 42: … the presence of Blastocystis sp.; however, … Modified

Line 43: after references ([3, 4]) please insert a dot and insert new sentence. Modified

Lines 41-45 need writing revision. Modified

Line 49: please correct as mentioned for abstract. (Now, 22 subtypes have been characterized). Done

Line 53: rare in humans, but…

You may add some data about the prevalence of Blastocystis in Syria or neighbor countries. To our knowledge no previous molecular studies were done in other regions of Syria. However, we compared our results with neighboring countries

Line 64: please terminate the sentence with a dot. … all patients participated in…

Please unify the term “Blastocystis” to “Blastocystis sp.” throughout the text. Done

Line 127: … isolates. Done

Line 130: please delete “only”. Modified

L137: mixed subtypes were … Done

L146: since all 60 samples were positive for Blastocystis with the SSU rRNA gene primers, you cannot rule out the symptoms due to other parasites. Therefore, please delete this sentence and modify your statement. You can discuss this in the discussion. We made some modification to the paragraph making it clearer (table 3)

Discussion

This part is just a comparison between your data and data released by other countries. You should add more discussion about HOW and WHY you obtained this data. You should discuss about the distribution of subtypes in your study, the subtyping methods and translated subtypes from STS primer subtyping (what is discussed in your study) to consensus subtypes, which is mentioned in the “ Terminology for Blastocystis subtypes-a consensus (table 2)”. Modifying has been made to the Discussion section

Reviewer #3: thank you for your comments, please find below our response to each comment

Major revision

1.Justification of the study should be strengthened. If this is the first study to provide molecular information about Blastocystis in Syria; then this should be clearly stated as a justification; in addition to some epidemiological characteristics of the study area or some population-specific characteristics. If previous studies from other regions of Syria are available then related findings should be presented and research gaps should be stated This study provided the first genetic characterization of Blastocystis subtypes prevalence in patients from the southern region of Syria (Abstract- Discussion).

2.The manuscript lacks information about the study design. Information about study design should be added to abstract and methods section. A STROBE checklist, used for the reporting of observational studies, can be downloaded (http://www.strobe-statement.org/index.php?id=available-checklists), filled in applicable manuscript section, and then the completed checklist can be uploaded as a Supporting Information file. Study design done

3. The manuscript lacks important information about the study area. What is the name of included city (cities) or districts? Was it a hospital-based or community-based study? What are the characteristics related to intestinal parasites? E.g. sanitation, rural or urban or semi-urban settings, etc. Such information is important for findings generalizability. Study areas done (study design). The study was based on hospital and health centers samples (results). This study was conducted on the semi urban areas (Sampling collection and the studied specimen)

4. The manuscript lacks important information about the study population. Information on the recruitment strategy, sample size estimation, sample collection and transport should be provided. Such information is important for findings generalizability. Done (Sampling collection and the studied specimen)

5. The sample size is small (n = 60). This should be acknowledged as a limitation. Another limitation should also be acknowledged; bacterial and viral causes of symptoms were not ruled out. Done (Discussion and conclusion)

6. Data analysis and findings presentation should be improved. Refer to comments # 15-17. Done

Minor Revision

7.Introduction, 2nd sentence: Indeed, pathogenicity of Blastocystis is still controversial. This should be clearly indicated. Done

8. Line 68: “…from residing patients of the southern regions of Syria…”. What were the included cities or districts or health centers? Done

9. Line 76: cite a reference for the adopted diagnostic criterion. Done

10. Line 113: “assess the correlation” change to “assess the association”. Done

11. Line 122: rephrase the sentence. The word “isolates” can be a source of confusion to readers. Changed to samples

12. Line 124: what about the results of the other 12 patients? Was there any parasites detected or they were negative for any parasites? 14 samples (not 12) out of 60 contained other parasites (table 2) but they were negative for Blastocystis sp. using microscopic examination

13. Line 128: “60 isolates”. Does this refer to the 60 samples or the overall detected subtypes in the 48 samples? We clarified this point in the result section (lines-119-123)

14. Line 137-138: add the percentage after the subtype; i.e. by ST1+2 (5%) and…. Done

15. Table 2: It can be modified to improve clarity. Remove first total (%) row; and add its data to Single infection row. Then, add a row for co-infection with the data of last row. Then, add a row of Type of co-infection with the 5 rows of combination. Done

16. Table 4: it should be split into 2 tables. Table 1 for associated factors. Because of small number of positive cases, this table can include all samples; add a column for N examined (n=60) then a column for overall Blastocystis infection, then a column for P. Add columns for ST1 and ST3 with P column for each. The ST1 data should include all ST1 (single and mixed and co-infection; i.e. 34 cases (18+11+5), ST3 should include all ST3 (7+6+1!). Chi square test is not applicable for all variables, indicate where Fischer’s Exact test used. The suggested table design can be found in the attached file of these comments. Done

17. Table 4: Revise variables grouping. Age groups can be 4– 20 and the last one should be > 40. Presence of animals should be Presence of domestic animals (Yes or No), why “Presence of insects” is mentioned here? Done

Insects may play a mechanical role in the transmission of Enteric Parasites (Patel et al., 2022)

18. The new table 5 can be for Association of common subtypes and clinical symptoms. Modify the table to avoid repeating Chi square/p value rows. This table should include single infections of related subtypes, as it is. So, add columns for P values after each subtype column. No need to report Chi square values, just the P values and indicate the test used in footnote. Done

19. Lines 163-165: But these are for ST1 only, as indicated by the p value. Modified/Done

20. Avoid repeating results in discussion Done

21. Are there previous findings from other regions of Syria? If yes, compare and discuss. Findings from neighbouring countries (Jordan, Lebanon, Iraq, Turkey, etc) can be used too. To our knowledge no previous molecular studies were done in other regions of Syria. However, we compared our results with neighboring countries

22. Lines 196-198: indicate the limitation here that bacterial and viral causes were not ruled out. Done (discussion and conclusion)

Decision Letter 1

Kovy Arteaga-Livias

21 Feb 2023

PONE-D-22-27237R1Molecular characterization of Blastocystis subtypes in symptomatic patients from the southern region of SyriaPLOS ONE

Dear Dr. Nahhas,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Apr 07 2023 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Kovy Arteaga-Livias

Academic Editor

PLOS ONE

Journal Requirements:

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: (No Response)

Reviewer #3: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

Reviewer #3: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: No

Reviewer #3: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #3: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #3: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: Minor issues

1. Line 30: rRNA not italicised. Amend here and through the whole manuscript.

2. Line 31: 100% (without space).

3. Line 50: Please note that four new Blastocystis STs (ST35-ST38) have been recently described. See Maloney et al. Microorganisms. 2022;11(1):46. doi: 10.3390/microorganisms11010046. Please update this information.

4. Line 68: In my previous appraisal, I specifically requested improving this subsection by providing information on inclusion/exclusion criteria followed to recruit patients, defining the clinical manifestations considered, and indicating the hospital/medical centres participating in the study. These requests, which are still pending.

Reviewer #3: The authors have adequately addressed all my comments highlighted on the first version of the manuscript.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: David Carmena

Reviewer #3: Yes: Hesham M. Al-Mekhlafi

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2023 Mar 16;18(3):e0283291. doi: 10.1371/journal.pone.0283291.r004

Author response to Decision Letter 1


27 Feb 2023

Reviewer #1:

We would like to thank you for your precise and valuable time and comments, please find below our response to each comment.

1. Line 30: rRNA not italicised. Amend here and through the whole manuscript.

Done

2- Line 31: 100% (without space).

Done

3. Line 50: Please note that four new Blastocystis STs (ST35-ST38) have been recently described. See Maloney et al. Microorganisms. 2022;11(1):46. doi: 10.3390/microorganisms11010046. Please update this information.

Modification has been done

4. Line 68: In my previous appraisal, I specifically requested improving this subsection by providing information on inclusion/exclusion criteria followed to recruit patients, defining the clinical manifestations considered, and indicating the hospital/medical centers participating in the study. These requests, which are still pending

We did not have any exclusion criteria; we only included all patients suffering from different gastrointestinal symptoms.

We modified all other requested points.

Attachment

Submitted filename: Response to Reviewers.docx

Decision Letter 2

Kovy Arteaga-Livias

6 Mar 2023

Molecular characterization of Blastocystis subtypes in symptomatic patients from the southern region of Syria

PONE-D-22-27237R2

Dear Dr. Nahhas,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Kovy Arteaga-Livias

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Acceptance letter

Kovy Arteaga-Livias

9 Mar 2023

PONE-D-22-27237R2

Molecular characterization of Blastocystis subtypes in symptomatic patients from the southern region of Syria

Dear Dr. Al Nahhas:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Kovy Arteaga-Livias

Academic Editor

PLOS ONE

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    Attachment

    Submitted filename: Reviewer report.pdf

    Attachment

    Submitted filename: Response to Reviewers.docx

    Data Availability Statement

    All relevant data are within the manuscript.


    Articles from PLOS ONE are provided here courtesy of PLOS

    RESOURCES