Abstract
Blastocystis sp. is an enteric protist found in humans and a wide range of animal hosts. Genetic variations were established among the 38 different subtypes detected so far, 14 of which are commonly found in human and animal hosts. The aim of the present study is to estimate the prevalence of the common Blastocystis subtypes and evaluate the possible correlation with several variables (gender, age, symptoms, domestic animals…), among patients from the southern region of Syria. Fecal samples were collected from individuals suffering from gastrointestinal complaints. Microscopic examination along with genotype analyses using seven pairs of subtype-specific primers was performed. Our results revealed the presence of Blastocystis sp. in 46 isolates out of the 60 samples microscopically studied (76.7%); single infection was detected in 24 isolates whereas co-infection with other protozoa was identified in 22 ones. Molecular detection targeting the SSU rRNA gene revealed a 100% positive presence of Blastocystis sp. in all the samples. Genotyping results detected the presence of five different subtypes (ST1-ST5) with varying proportions. However, ST1 was the dominant subtype observed (66.7%). Mixed subtype infections were found in 9 isolates (15%). Three samples remained undefined, nonetheless. Our statistical results showed no significant correlation between Blastocystis STs infection and the different studied variables. In conclusion, this study provides the first genetic characterization of Blastocystis subtypes prevalence in patients from the southern region of Syria. ST1 distribution was highly predominant. Further molecular studies are needed to estimate the prevalence of Blastocystis sp. infection in other regions in Syria and to understand the epidemiology and sources of transmission to humans.
Introduction
Blastocystis sp. is a gastrointestinal protozoan found in humans and many animals [1, 2]. It has a large distribution worldwide, with increasing cases in developing countries, due to poor hygiene practices and consumption of contaminated food or water [3, 4]. The pathogenicity of this parasite is questionable. For example, according to some studies, Blastocystis has no clinical relevance, while recent associations have been found between its presence and some specific gastrointestinal symptoms [5, 6]. An extensive genetic diversity has been observed among numerous Blastocystis sp. isolated from different hosts [7, 8]. At present, 38 subtypes (STs) have been identified (ST1-ST38) [9–11], 14 of which have been isolated from both humans and animals worldwide [12–14], while the other STs have been reportedly found only in animals [15, 16]. Researchers have found that STs 1–4 appear to be the most common Blastocystis inhabitants of the human intestines, and the other 10 STs are rare in humans but are frequently detected in various animal groups including birds and hoofed animals [1, 16, 17]. Molecular identification studies of Blastocystis STs provide a discriminating tool for investigating the epidemiology of the parasite including transmission route, host specificity, and chemotherapeutic drug resistance [18, 19]. In Syria, Blastocystis sp. is not well studied and there is a lack of information on its prevalence, distribution, and its diverse subtypes. Therefore, the present study aimed to estimate the infection incidence of the different common subtypes among resident patients in the southern region of Syria and their possible correlation with several variables.
Materials and methods
Ethics approval and informed consent
Damascus University approved the aims and the procedures of the study (Ref. No: 4031/2019). Written informed consent was obtained from all patients participating in the study, or their parents or legal guardians.
Sampling and the studied specimen
A cross-sectional study was conducted between the period of November 2019 and March 2020. Individuals attending outpatient clinics at Al-Assad University Hospital, the Syrian Specialty Hospital and Dara Health Center, suffering from various gastrointestinal disorders, were recruited in this study. All patients were residents from the southern region of Syria (including the city of Damascus and its countryside, Dara’ governorate and its countryside). General information was obtained from each patient including age, gender, general health conditions, source of drinking water, contact with domestic animals like cats and dogs as well as symptoms such as diarrhea, abdominal spam, flatulence, anorexia/weight loss, …etc. Stool specimens were collected in clean sterile plastic containers. Each specimen was divided into two parts: one part was fixed in formalin solution 10% (1:3) for microscopic investigation and the other was stored at -20°C for molecular studies.
Microscopic examination
Approximately 1 mg of each fixed sample was stained by Lugol’s iodine as described in [20] and examined directly using light microscope (×40 magnifications). The diagnostic criterion adopted in determining the positivity of Blastocystis sp. infection was the detection of at least 5 vacuolar forms [21].
Molecular detection and subtyping
The total genomic DNA was extracted from almost 250–300 mg of each fecal sample collected using QIAamp-DNA stool mini kit (QIAamp-DNA Stool Mini Kit, QIAGEN) as described in [22] and stored at -20°C until use.
The small subunit ribosomal RNA (SSU-rRNA) gene was used for the detection of Blastocystis sp. in all the studied samples. For each specimen, 4 μl of the extracted template DNA was amplified using a pair of specific diagnostic primers (b11400 FORC and b11710. REVC) [23]. Each PCR reaction was conducted in 25μl final volume consisting of 12.5 μl One PCRTM master mix 2X (GeneDirex Inc, Taiwan ROC), 1 μl of each primer, and 10.5 μl nuclease-free water. Amplification conditions consisted of initial denaturation at 94°C for 3 min, 30 cycles including denaturation at 94°C for 1 min, annealing at 58°C for 1 min and extension at 72°C for 1 min. The final extension was at 72°C for 5 minutes.
Seven subtype-specific sequence-tagged-site (STS) primers were chosen for the identification of the different STs studied as shown in Table 1 [24]. The PCR cycling conditions were as described by [25].
Table 1. The primer sets used for genotyping.
| STS primers sets / subtype | Sequences of forward and reverse primers | Product size |
|---|---|---|
| SB 83 / ST1 | F: GAAGGACTCTCTGACGATGA | 351 (bp) |
| R: GTCCAAATGAAAGGCAGC | ||
| SB340 / ST2 | F: TGTTCTTGTGTCTTCTCAGCTC | 704 (bp) |
| R: TTCTTTCACACTCCCGTCAT | ||
| SB227 / ST3 | F: TAGGATTTGGTGTTTGGAGA | 526 (bp) |
| R: TTAGAAGTGAAGGAGATGGAAG | ||
| SB337 / ST4 | F: GTCTTTCCCTGTCTATTCTGCA | 487 (bp) |
| R: AATTCGGTCTGCTTCTTCTG | ||
| SB336 / ST5 | F: GTGGGTAGAGGAAGGAAAACA | 317 (bp) |
| R: AGAACAAGTCGATGAAGTGAGAT | ||
| SB332 / ST6 | F: GCATCCAGACTACTATCAACATT | 338 (bp) |
| R: CCATTTTCAGACAACCACTTA | ||
| SB155 / ST7 | F: ATCAGCCTACAATCTCCTC | 650 (bp) |
| R: ATCGCCACTTCTCCAAT |
All PCR experiments contained a negative control (4 μl of nuclease-free water) for contamination detection. PCR reactions were carried out using Eppendorf Master Cycler. The PCR products were electrophoresed in 1.5–2% agarose gel stained with ethidium bromide (Sigma-Aldrich, USA) along with a 100 bp DNA ladder (GeneDirex Inc, Taiwan ROC) as a standard size.
Statistical analysis
All data were analyzed using IBM SPSS Statistics Version 25.0 (SPSS, Inc.; Chicago, IL, USA). Percentages were used to describe the prevalence of the different Blastocystis STs. Pearson’s chi-squared and Fisher’s Exact tests were used to assess the possible association between subtypes and the different studied variables. A P value of ≤ 0.05 was considered statistically significant.
Results
A total of 60 outpatients, who visited hospitals and health centres located in the southern region of Syria with different digestive complaints, participated in this study. The female to male ratio was approximately 1.4 (58.3%; 41.7% respectively). In general, the age of patients ranged from 3 to 76 years. The mean was 31.9 ± 21.3 and the median age was 26 years old.
Microscopic analysis showed that only 46 (76.7%) samples were positive for the presence of vacuolar forms of Blastocystis sp., whereas molecular detection revealed the existence of Blastocystis sp. in all the samples (n = 60, 100%).
Furthermore, our genotyping results detected the presence of five different STs in 57 isolates (95%), while three samples remained undefined (5%). A single ST infection was found in 48 samples (84.2%), while mixed STs were found in nine isolates (15.8%) as follows: ST1+ST3 (n = 5), ST1+ST2 (n = 3) and ST1+ST2+ST3 (n = 1).
The infection with different STs alone was detected in more than half of the samples (33, ~55%), while co-infection with other intestinal parasites was found in 27 samples (45%). Interestingly, ST1 infection was predominant in both cases (55%, and 41% respectively) (Table 2).
Table 2. The prevalence of Blastocystis subtypes with/without other intestinal parasites infections.
| DIFFERENT SUBTYPES | |||||||
|---|---|---|---|---|---|---|---|
| ST1 | ST2 | ST3 | ST4 | ST5 | MIX STS | UNKNOWN STS | |
| Single Infection (Blastocystis sp.): total (n = 33) | 18 | 0 | 7 | 0 | 1 | 5 | 2 |
| (%) | 54.5% | 0 | 21.2% | 0 | 3.03% | 15.2% | 6.1% |
| Protozoa Co-Infection: total (n = 27) | 11 | 3 | 6 | 1 | 1 | 4 | 1 |
| (%) | 40.7% | 11.1% | 22.2% | 3.7% | 3.7% | 14.8% | 3.7% |
| Co-infection | |||||||
| Blastocystis sp + Entamoeba sp | 7 | 0 | 0 | 1 | 1 | 0 | 1 |
| Blastocystis sp + Entamoeba sp + Entamoeba coli | 0 | 1 | 1 | 0 | 0 | 1 | 0 |
| Blastocystis sp + Entamoeba coli | 2 | 1 | 5 | 0 | 0 | 2 | 0 |
| Blastocystis sp + Giardia | 1 | 1 | 0 | 0 | 0 | 0 | 0 |
| Blastocystis sp + Entamoeba sp + Giardia | 1 | 0 | 0 | 0 | 0 | 1 | 0 |
Furthermore, to exclude intestinal manifestations caused by other parasites, the clinical disorders in patients infected with Blastocystis sp. alone (31 isolates) were analyzed. Our results showed that the most frequent symptoms were flatulence, abdominal pain, and abdominal spam (61.3%, 58.1% and 54.8% respectively) (Table 3).
Table 3. The clinical symptoms relevant to the Blastocystis subtypes detected.
| Clinical symptoms | Different Subtypes | Total | ||||
|---|---|---|---|---|---|---|
| N = 31 | ||||||
| (%) | ||||||
| ST1 | ST3 | ST5 | ST1+ST2 | ST1+ST3 | ||
| (n = 18) | (n = 7) | (n = 1) | (n = 3) | (n = 2) | ||
| Abdominal pain | 11 | 4 | 1 | 2 | - | 18 (58.1%) |
| Flatulence | 11 | 4 | 1 | 2 | 1 | 19 (61.3%) |
| Abdominal spam | 10 | 4 | - | 2 | 1 | 17 (54.8%) |
| Anorexia/Weight loss | 8 | 2 | 1 | 1 | 1 | 13 (41.9%) |
| Nausea/ Vomiting | 10 | 4 | - | - | 1 | 15 (48.4%) |
| Diarrhea | 5 | 2 | - | 1 | - | 8 (25.8%) |
| Constipation | 5 | - | 1 | 1 | - | 7 (22.6%) |
| Headache | 4 | 1 | 1 | 1 | 2 | 9 (29.03%) |
Our statistical analysis results showed no significant correlation between any of the STs detected and between age groups, gender, drinking water supply, contact with domestic animals nor between mechanical vectors, as shown in Table 4.
Table 4. Association between Blastocystis subtypes and the studied variables.
| Variable | ST1 | P | ST2 | P | ST3 | P | ST4 | P | ST5 | P | MIX STs | P |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| n(%) | n(%) | n(%) | n(%) | n(%) | n(%) | |||||||
| 29 | 3 | 13 | 1 | 2 | 9 | |||||||
| 50.9% | 5.3% | 22.8% | 1.8% | 3.5% | 15.8% | |||||||
| Gender | ||||||||||||
| Male | 12 | 0.872a | 1 | 1b | 4 | 0.423a | - | - | - | - | 6 | 0.137 b |
| (n = 23; 40.1%) | ||||||||||||
| Female | 17 | 2 | 9 | 1 | 2 | 3 | ||||||
| (n = 34; 59.6%) | ||||||||||||
| Age | ||||||||||||
| 3–20 | 11 | 0.886 a | 1 | - | 5 | 0.928 a | - | - | - | - | 3 | 0.969 a |
| (n = 20; 35.1%) | ||||||||||||
| 21–40 | 8 | 0 | 4 | 1 | 1 | 3 | ||||||
| (n = 17; 29.8%) | ||||||||||||
| >40 | 10 | 2 | 4 | - | 1 | 3 | ||||||
| (n = 20; 35.1%) | ||||||||||||
| Water Supply | ||||||||||||
| Tap water | 15 | 0.753 a | 2 | 1b | 6 | 0.208 a | 1 | - | - | - | 5 | 1b |
| (n = 29; 50.9%) | ||||||||||||
| No tap water | 14 | 1 | 7 | - | 2 | 4 | ||||||
| (n = 28; 49.1%) | ||||||||||||
| Domestic animals (cat, dog,…) | ||||||||||||
| Presence | 7 | 0.346 a | 1 | 0.481 b | 4 | 0.251 b | - | - | - | - | 2 | 1b |
| (n = 14; 24.6%) | ||||||||||||
| No presence | 22 | 2 | 9 | 1 | 2 | 7 | ||||||
| (n = 43; 75.4%) | ||||||||||||
| Mechanical vector (cockroaches, flies.) | ||||||||||||
| Presence | 4 | 0.352 b | - | - | 1 | 1b | - | - | - | - | - | - |
| (n = 5; 8.8%) | ||||||||||||
| No presence | 25 | 3 | 12 | 1 | 2 | 9 | ||||||
| (n = 52; 91.2%) | ||||||||||||
n = number of participants, a: Chi-squared test; b: Fisher test
*statistically significant at p≤0.05
Additionally, no significant correlation was found between symptoms and any STs detected in our study (Table 5).
Table 5. Association between dominant Blastocystis subtypes and patients’ symptoms.
| ST1 (n = 18) | P | ST3 (n = 7) | P | Mixed STs (n = 5) | P | ||
|---|---|---|---|---|---|---|---|
| Clinical Symptoms | |||||||
| Abdominal pain | Yes | 11 | 0.972a | 4 | 1b |
2 | 0.369b |
| No | 7 | 3 | 3 | ||||
| Flatulence | Yes | 11 | 0.285a | 4 | 1b |
3 | 1b |
| No | 7 | 3 | 2 | ||||
| Abd. Spasm | Yes | 10 | 0.490a | 4 | 0.703b | 3 | 0.668b |
| No | 8 | 3 | 2 | ||||
| Nausea/Vomiting | Yes | 10 | 0.123a | 4 | 0.427b | 1 | 0.391b |
| No | 8 | 3 | 4 | ||||
| Anorexia/WL | Yes | 8 | 0.214a | 2 | 1b | 2 | 1b |
| No | 10 | 5 | 3 | ||||
| Headache | Yes | 5 | 1b | 1 | 0.662b | 3 | 0.098b |
| No | 13 | 6 | 2 | ||||
| Diarrhea | Yes | 5 | 0.488b | 2 | 0.635b | 1 | 1b |
| No | 13 | 5 | 4 | ||||
| Constipation | Yes | 6 | 0.164b | - | - | 1 | 1b |
| No | 12 | 7 | 4 | ||||
n = number of participants; WL: weight lost, a: Chi-squared test; b: Fisher test; *statistically significant at p≤0.05
Discussion
Blastocystis sp. is an intestinal parasite whose pathogenic role is underestimated; several studies reported its presence in both asymptomatic and symptomatic patients [26, 27]. In Syria, epidemiological and molecular studies on this parasite are scarce. This study is the first to identify and characterize Blastocystis sp. subtypes in 60 individuals from the southern region of Syria suffering from various gastrointestinal symptoms. The infection of Blastocystis sp. was detected by direct examination and conventional PCR methods. Our results revealed a high prevalence of infection, reaching 100% using the molecular tool. It was found that the rate of infection varies widely between different countries and between regions within the same country [28–31]; for example, in countries such as Lebanon, Qatar, United Arab Emirates, Saudi Arabia and Libya, the incidence of Blastocystis sp. ranged from 44.4% up to 86.6% [1, 32–35]. Whereas other studies from Iran [29], Tunisia [15], Egypt [36] and Lebanon [37] showed low infection rates (8.1%, 13%, 15.3% and 19% respectively). This difference can be explained according to the prevailing epidemiological situation and different climatic conditions [38].
Our data identified five different Blastocystis STs (ST1-ST5) in 57 samples (95%). However, three samples remained undefined (5%). This could be explained by the moderate sensitivity of the primers used in genotyping [39] or could be other different subtypes.
Previous studies have shown that ST1 and ST3 are the most prevalent subtypes distributed among human individuals and several kinds of animals worldwide [31, 40, 41]. Earlier reports from the Middle East revealed that the most dominant Blastocystis subtype was ST3 followed by ST1 [26, 36, 42, 43]. However, in our study, ST1 was the most predominant (66.7%). This finding is in agreement with previous studies conducted in Iran [2, 44], Libya [35], Turkey [45] and the United Arab Emirates [33].
Interestingly, our present study has identified mixed different STs infection in approximately one-sixth of the samples. Mixed STs infection has been reported previously with varying prevalence [8, 46–48] and can be explicated with probable exposure to different sources of contamination [49].
Earlier reports pointed out to a possible high risk of Blastocystis sp. infection in people with close contact to animals, supporting the hypothesis of transmission from animals to humans [50, 51]. For example, Ruaux et al. found that ST1 was the main subtype amongst patients working in shelter-resident dogs and cats, emphasizing the potential role of domestic animals in human Blastocystis sp. infection, while ST3 was more limited to humans [52]. However, in our study, none of the STs identified were significantly associated with the presence of domestic animals or the mechanical vectors either, which may be due to the limited number of the studied samples.
Additionally, in this study, no significant correlation was found between the different drinking water sources and between any Blastocystis STs infection. This finding can be explained by the fact that most of our patients stated that they drink tap water, which is generally purified before being distributed to the residences and is in accordance with several previous studies which detected a negative association between Blastocystis STs and tap water as a drinking source [19, 53].
The pathogenic role of Blastocystis sp. in causing clinical symptoms remains a controversial issue due to its genetic diversity, inability to exclude any other intestinal parasites, bacteria, or virus causing the same digestive symptoms as well as the different immune responses and the composition of the intestinal microbiota of the host [39, 54, 55].
In this study, 56.9% of individuals infected with ST1 had various gastrointestinal symptoms; however, no significant correlation was found between the different symptoms. This finding disagrees with some previous studies that suggest that Blastocystis sp. ST1 may have a pathogenic effect and cause symptomatic infections [42, 56, 57] and is in line with previous data that did not find any statistically significant correlation between Blastocystis sp. infection and any gastrointestinal symptoms. It is worth mentioning that half of the samples ~55% in this study were infected with the different STs detected alone, while co-infection with other intestinal parasites were found in 45% of the samples, which leaves the question about the possible real pathogenic potential of this parasite still open [19, 58].
Furthermore, our data showed that females had a higher infection rate compared to males. Yet, no significant association was found between gender and Blastocystis infection (P = 0.872). This finding is consistent with several previous studies conducted in many countries [35, 59]. Moreover, the incidence of Blastocystis infection was relatively similar in all age groups. No association was detected with any particular ST. Our data comes in line with the study of Khaled et al. conducted on Syrian refugees living in North Lebanon [49], and with research from Qatar by Abu-Madi et al. where no difference was found between the prevalence of Blastocystis and between age groups [32]. However, our finding did not support previous reports indicating an association between age and infection being more common in young or adult patients [29, 36].
Conclusion
This study is the first report from the southern region of Syria to characterize and detect the prevalence of different Blastocystis sp. STs. Despite the limited number of the samples, this study showed the predominant distribution of ST1. However, further studies are needed on large samples (humans and animals) and in the different regions of Syria that may lead to a better knowledge of the Blastocystis sp. prevalence, transmission sources to humans, interaction with the host, and pathogenicity.
Acknowledgments
The authors gratefully acknowledge all the patients and their families for taking part in this study. We also thank Ms. Marah Marrawi for her assistance with statistical analyses and Dr Rasheed Abdul Hadi for proofreading.
Data Availability
All relevant data are within the manuscript.
Funding Statement
the authors received no specific funding for this work.
References
- 1.Osman M, El Safadi D, Cian A, Benamrouz S, Nourrisson C, Poirier P, et al. Prevalence and risk factors for intestinal protozoan infections with Cryptosporidium, Giardia, Blastocystis and Dientamoeba among schoolchildren in Tripoli, Lebanon. PLoS Negl Trop Dis. 2016. Mar 14. 10(3):e0004496. doi: 10.1371/journal.pntd.0004496 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Delshad A, Saraei M, Alizadeh SA, Niaraki SR, Alipour M, Hosseinbigi B, et al. Distribution and molecular analysis of Blastocystis subtypes from gastrointestinal symptomatic and asymptomatic patients in Iran. Afr Health Sci. 2020. Oct 7. 20(3):1179–89. doi: 10.4314/ahs.v20i3.21 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Al Nahhas S, Aboualchamat G. Investigation of parasitic contamination of salad vegetables sold by street vendors in city markets in Damascus, Syria. Food and Waterborne Parasitology. 2020. Dec 1;21:e00090. doi: 10.1016/j.fawpar.2020.e00090 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Belkhair J, Karrati I, Tarmidi M, El Mezouari M, Moutaj R. Blastocystis hominis microbiota: study of 13255 patients and review of the literature. J Microbiol Exp. 2021;9(2):29–32. doi: 10.15406/jmen.2021.09.00319 4. [DOI] [Google Scholar]
- 5.Verma R, Delfanian K. Blastocystis hominis associated acute urticaria. Am J Med Sci. 2013. Jul 1. 346(1):80–1. doi: 10.1097/MAJ.0b013e3182801478 [DOI] [PubMed] [Google Scholar]
- 6.Deng Y, Zhang S, Ning C, Zhou Y, Teng X, Wu X, et al. Molecular Epidemiology and Risk Factors of Blastocystis sp. Infections Among General Populations in Yunnan Province, Southwestern China. Risk Manag Health Policy. 2020. 13:1791. doi: 10.2147/RMHP.S269664 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Wawrzyniak I, Poirier P, Viscogliosi E, Dionigia M, Texier C, Delbac F. Blastocystis, an unrecognized parasite: an overview of pathogenesis and diagnosis. Ther Adv Infect Dis. 2013; 1 (5): 167–78. doi: 10.1177/2049936113504754 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Khademvatan S, Masjedizadeh R, Yousefi-Razin E, Mahbodfar H, Rahim F, Yousefi E, et al. PCR-based molecular characterization of Blastocystis hominis subtypes in southwest of Iran. J Infect Public Health. 2018. Jan 1; 11(1):43–7. doi: 10.1016/j.jiph.2017.03.009 [DOI] [PubMed] [Google Scholar]
- 9.Stensvold CR, Clark CG. Pre-empting Pandora’s box: Blastocystis subtypes revisited. Trends in parasitology. 2020. Mar 1;36(3):229–32. [DOI] [PubMed] [Google Scholar]
- 10.Baek S, Maloney JG, Molokin A, George NS, Cortés Vecino JA, Santin M. Diversity of Blastocystis subtypes in horses in Colombia and identification of two new subtypes. Microorganisms. 2022. Aug 24;10(9):1693 doi: 10.3390/microorganisms10091693 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Maloney JG, Molokin A, Seguí R, Maravilla P, Martínez-Hernández F, Villalobos G, et al. Identification and Molecular Characterization of Four New Blastocystis Subtypes Designated ST35-ST38. Microorganisms. 2022. Dec 23;11(1):46. doi: 10.3390/microorganisms11010046 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Alfellani MA, Stensvold CR, Vidal-Lapiedra A, Onuoha ES, Fagbenro-Beyioku AF, Clark CG. Variable geographic distribution of Blastocystis subtypes and its potential implications. Acta tropica. 2013. Apr 1;126(1):11–8 [DOI] [PubMed] [Google Scholar]
- 13.Khaled S, Gantois N, Ly AT, Senghor S, Even G, Dautel E, et al. Prevalence and subtype distribution of Blastocystis sp. in Senegalese school children. Microorganisms. 2020. Sep 12;8(9):1408 doi: 10.3390/microorganisms8091408 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Hubline JS, Maloney JG, Santin M. Blastocystis in domesticated and wild mammals and birds. Research in Veterinary Science. 2021. Mar 1;135:260–82 [DOI] [PubMed] [Google Scholar]
- 15.Abda IB, Maatoug N, Romdhane RB, Bouhelmi N, Zallegua N, Aoun K, et al. Prevalence and subtype identification of Blastocystis sp. in healthy individuals in the Tunis area, Tunisia. Am J Trop Med Hyg. 2017. Jan 11; 96(1):202. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Bahrami F, Haghighi A, Zamini G, Khademerfan M. Molecular evidence for zoonotic transmission of Blastocystis subtypes in Kurdistan province, West of Iran. Ann Parasitol. 2020. Jan 1; 66(1):19–25. doi: 10.17420/ap6601.234 [DOI] [PubMed] [Google Scholar]
- 17.Parkar U, Traub RJ, Kumar S, Mungthin M, Vitali S, Leelayoova S, et al. Direct characterization of Blastocystis from faeces by PCR and evidence of zoonotic potential. Parasitol. 2007. Mar; 134(3):359–67. doi: 10.1017/S0031182006001582 [DOI] [PubMed] [Google Scholar]
- 18.Özyurt M, Kurt Ö, Mølbak K, Nielsen HV, Haznedaroglu T, Stensvold CR. Molecular epidemiology of Blastocystis infections in Turkey. Parasitol Int. 2008. Sep 1; 57(3):300–6. [DOI] [PubMed] [Google Scholar]
- 19.Seyer A, Karasartova D, Ruh E, Güreser AS, Turgal E, Imir T, et al. Epidemiology and prevalence of Blastocystis spp. in North Cyprus. Am J Trop Med Hyg. 2017. May 3;96(5):1164. doi: 10.4269/ajtmh.16-0706 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Manser MM, Saez AC, Chiodini PL. Faecal parasitology: concentration methodology needs to be better standardised. Plos neglected tropical diseases. 2016. Apr 13;10(4): e0004579. doi: 10.1371/journal.pntd.0004579 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Speich B, Marti H, Ame SM, Ali SM, Bogoch II, Utzinger J, et al. Prevalence of intestinal protozoa infection among school-aged children on Pemba Island, Tanzania, and effect of single-dose albendazole, nitazoxanide and albendazole-nitazoxanide. Parasites & vectors. 2013. Dec;6(1):1–8. doi: 10.1186/1756-3305-6-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Rebih N, Boutaiba S, Aboualchamat G, Souttou K, Hakem A, Al Nahhas S. Molecular and epidemiological characterization of Giardia intestinalis assemblages detected in Djelfa, Algeria. J Parasit Dis. Official Organ of the Indian Society for Parasitology. 2020. Jun;44(2):281. doi: 10.1007/s12639-020-01206-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Stensvold R, Brillowska-Dabrowska A, Nielsen HV, Arendrup MC. Detection of Blastocystis hominis in unpreserved stool specimens by using polymerase chain reaction. J Parasitol. 2006. Oct;92(5):1081–7. doi: 10.1645/GE-840R.1 [DOI] [PubMed] [Google Scholar]
- 24.Yoshikawa H, Wu Z, Nagano I, Takahashi Y. Molecular comparative studies among Blastocystis isolates obtained from humans and animals. J Parasitol. 2003. Jun;89(3):585–94. doi: 10.1645/00223395(2003)089[0585:MCSABI]2.0.CO;2 [DOI] [PubMed] [Google Scholar]
- 25.Yakoob J, Jafri W, Beg MA, Abbas Z, Naz S, Islam M, et al. irritable bowel syndrome is it associated with genotypes of Blastocystis hominis. Parasitol Res. 2010. Apr;106(5):1033–8. doi: 10.1007/s00436-010-1761-x [DOI] [PubMed] [Google Scholar]
- 26.Mohamed RT, El-Bali MA, Mohamed AA, Abdel-Fatah MA, El-Malky MA, Mowafy NM, et al. Subtyping of Blastocystis sp. isolated from symptomatic and asymptomatic individuals in Makkah, Saudi Arabia. Parasites & vectors. 2017. Dec;10(1):1–7. doi: 10.1186/s13071-017-2114-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Asghari A, Hassanipour S, Hatam G. Comparative molecular prevalence and subtypes distribution of Blastocystis sp. a potentially zoonotic infection isolated from symptomatic and asymptomatic patients in Iran: a systematic review and meta-analysis. Acta Parasitologica. 2021. Sep;66(3):745–59. doi: 10.1007/s11686-021-00360-0 [DOI] [PubMed] [Google Scholar]
- 28.Niaraki SR, Hajialilo E, Delshad A, Alizadeh SA, Alipour M, Heydarian P, et al. Molecular epidemiology of Blastocystis spp. in children referred to Qods hospital in northwest of Iran. J Parasit Dis. 2020. Mar 44(1):151–8. doi: 10.1007/s12639-019-01177-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Salehi M, Mardaneh J, Niazkar HR, Minooeianhaghighi M, Arshad E, Soleimani F, et al. Prevalence and subtype analysis of Blastocystis hominis isolated from patients in the northeast of Iran. J Parasitol Res. 2021. Jan 13;2021. doi: 10.1155/2021/8821885 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Souppart L, Sanciu G, Cian A, Wawrzyniak I, Delbac F, Capron M, et al. Molecular epidemiology of human Blastocystis isolates in France. Parasitol Res. 2009. Jul;105(2):413–21. doi: 10.1007/s00436-009-1398-9 [DOI] [PubMed] [Google Scholar]
- 31.Popruk S, Pintong AR, Radomyos P. Diversity of Blastocystis subtypes in humans. J Trop Med Parasitol. 2013;36(2):88–97. [Google Scholar]
- 32.Abu-Madi M, Aly M, Behnke JM, Clark CG, Balkhy H. The distribution of Blastocystis subtypes in isolates from Qatar. Parasit. Vectors 2015, 8, 465 doi: 10.1186/s13071-015-1071-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.AbuOdeh R, Ezzedine S, Samie A, Stensvold CR, ElBakri A. Prevalence and subtype distribution of Blastocystis in healthy individuals in Sharjah, United Arab Emirates. Infect. Genet. Evol. 2016, 37, 158–162. [DOI] [PubMed] [Google Scholar]
- 34.Wakid MH, Aldahhasi WT, Alsulami MN, El-Kady AM, Elshabrawy HA. Identification and Genetic Characterization of Blastocystis Species in Patients from Makkah, Saudi Arabia. Infection and Drug Resistance. 2022;15:491. doi: 10.2147/IDR.S347220 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Abdulsalam AM, Ithoi I, Al-Mekhlafi HM, Al-Mekhlafi AM, Ahmed A, Surin J. Subtype distribution of Blastocystis isolates in Sebha, Libya. PLoS One. 2013. Dec 20;8(12):e84372 doi: 10.1371/journal.pone.0084372 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Ahmed SA, El-Mahallawy HS, Mohamed SF, Angelici MC, Hasapis K, Saber T, et al. Subtypes and phylogenetic analysis of Blastocystis sp. isolates from West Ismailia, Egypt. Scientific Reports. 2022. Nov 9;12(1):1–2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.El Safadi D, Meloni D, Poirier P, Osman M, Cian A, Gaayeb L, et al. Molecular epidemiology of Blastocystis in Lebanon and correlation between subtype 1 and gastrointestinal symptoms. Am. J. Trop. Med. Hyg. 2013, 88, 1203–1206. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Javanmard E, Niyyati M, Ghasemi E, Mirjalali H, Aghdaei HA, Zali MR. Impacts of human development index and climate conditions on prevalence of Blastocystis: a systematic review and meta-analysis. Acta tropica. 2018. Sep 1; 185:193–203. doi: 10.1016/j.actatropica.2018.05.014 [DOI] [PubMed] [Google Scholar]
- 39.Stensvold CR. Comparison of sequencing (barcode region) and sequence-tagged-site PCR for Blastocystis subtyping. J clin microbiol. 2013. Jan;51(1):190–4. doi: 10.1128/JCM.02541-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Clark CG, van der Giezen M, Alfellani MA, Stensvold CR. Recent developments in Blastocystis research. Adv. Parasitol. 2013, 82, 1–32. doi: 10.1016/B978-0-12-407706-5.00001-0 [DOI] [PubMed] [Google Scholar]
- 41.Stensvold CR, Clark CG. Current status of Blastocystis: a personal view. Parasitology international. 2016. Dec 1;65(6):763–71 [DOI] [PubMed] [Google Scholar]
- 42.Moosavi A, Haghighi A, Mojarad EN, Zayeri F, Alebouyeh M, Khazan H, et al. Genetic variability of Blastocystis sp. isolated from symptomatic and asymptomatic individuals in Iran. Parasitol Res. 2012. Dec;111(6):2311–5. [DOI] [PubMed] [Google Scholar]
- 43.Greige S, El Safadi D, Khaled S, Gantois N, Baydoun M, Chemaly M, et al. First report on the prevalence and subtype distribution of Blastocystis sp. in dairy cattle in Lebanon and assessment of zoonotic transmission. Acta Trop. 2019, 194, 23–29. [DOI] [PubMed] [Google Scholar]
- 44.Taghipour A, Javanmard E, Mirjalali H, Haghighi A, Tabarsi P, Sohrabi MR, et al. Blastocystis subtype 1 (allele 4); predominant subtype among tuberculosis patients in Iran. Comp Immunol Microbiol Infect Dis. 2019. Aug 1; 65:201–6. doi: 10.1016/j.cimid.2019.06.005 [DOI] [PubMed] [Google Scholar]
- 45.Eroglu F, Genc A, Elgun G, Koltas IS. Identification of Blastocystis hominis isolates from asymptomatic and symptomatic patients by PCR. Parasitol Res. 2009. Nov;105(6):1589–92 [DOI] [PubMed] [Google Scholar]
- 46.Malheiros AF, Stensvold CR, Clark CG, Braga GB, Shaw JJ. Molecular characterization of Blastocystis obtained from members of the indigenous Tapirapé ethnic group from the Brazilian Amazon region, Brazil. The American journal of tropical medicine and hygiene. 2011. Dec 12;85(6):1050. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Ascuña-Durand K, Salazar-Sánchez RS, Castillo-Neyra R, Ballón-Echegaray J. Relative Frequency of Blastocystis Subtypes 1, 2, and 3 in Urban and Periurban Human Populations of Arequipa, Peru. Trop Med Infect. 2020. Dec;5(4):178. doi: 10.3390/tropicalmed5040178 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Dogan N, Aydin M, Tuzemen NU, Dinleyici EC, Oguz I, Dogruman-Al F. Subtype distribution of Blastocystis spp. isolated from children in Eskisehir, Turkey. Parasitol Int. 2017. Feb 1;66(1):948–51. [DOI] [PubMed] [Google Scholar]
- 49.Khaled S, Gantois N, Ayoubi A, Even G, Sawant M, El Houmayraa J, et al. Blastocystis sp. prevalence and subtypes distribution amongst Syrian refugee communities living in North Lebanon. Microorganisms. 2021. Jan 16;9(1):184. doi: 10.3390/microorganisms9010184 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Li W, Liu X, Gu Y, Liu J, Luo J. Prevalence of Cryptosporidium, Giardia, Blastocystis, and trichomonads in domestic cats in East China. J Vet Med Sci. 2019:19–0111. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Mohammadpour I, Bozorg-Ghalati F, Gazzonis AL, Manfredi MT, Motazedian MH, Mohammadpour N. First molecular subtyping and phylogeny of Blastocystis sp. isolated from domestic and synanthropic animals (dogs, cats and brown rats) in southern Iran. Parasites & Vectors. 2020. Dec;13(1):1–1. 10.1186/s13071-020-04225-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Ruaux CG, Stang BV. Prevalence of Blastocystis in shelter-resident and client-owned companion animals in the US Pacific Northwest. PLoS One. 2014. Sep 16;9(9): e107496 doi: 10.1371/journal.pone.0107496 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Leelayoova S, Siripattanapipong S, Thathaisong U, Naaglor T, Taamasri P, Piyaraj P, et al. Drinking water: a possible source of Blastocystis spp. subtype 1 infection in schoolchildren of a rural community in Central Thailand. Am J Trop Med Hyg. 2008;79(3):401–6. [PubMed] [Google Scholar]
- 54.Tan KS. New insights on classification, identification, and clinical relevance of Blastocystis spp. Clinical microbiology reviews. 2008. Oct;21(4):639–65. doi: 10.1128/CMR.00022-08 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Audebert C, Even G, Cian A, Loywick A, Merlin S, Viscogliosi E, et al. Colonization with the enteric protozoa Blastocystis is associated with increased diversity of human gut bacterial microbiota. Scientific reports. 2016. May 5;6(1):1–1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Yoshikawa H, Wu Z, Kimata I, Iseki M, Ali IK, Hossain MB, et al. Polymerase chain reaction-based genotype classification among human Blastocystis hominis populations isolated from different countries. Parasitology research. 2004. Jan;92(1):22–9. doi: 10.1007/s00436-003-0995-2 [DOI] [PubMed] [Google Scholar]
- 57.Yan Y, Su S, Lai R, Liao H, Ye J, Li X, et al. Genetic variability of Blastocystis hominis isolates in China. Parasitol Res. 2006. Oct;99(5):597–601. [DOI] [PubMed] [Google Scholar]
- 58.Guilavogui T, Gantois N, Even G, Desramaut J, Dautel E, Denoyelle C, et al. Detection, Molecular Identification and Transmission of the Intestinal Protozoa Blastocystis sp. in Guinea from a Large-Scale Epidemiological Study Conducted in the Conakry Area. Microorganisms. 2022. Feb 15;10(2):446. doi: 10.3390/microorganisms10020446 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Li LH, Zhou XN, Du ZW, Wang XZ, Wang LB, Jiang JY, et al. Molecular epidemiology of human Blastocystis in a village in Yunnan province, China. Parasitol. Int. 2007. Dec 1;56(4):281–6. doi: 10.1016/j.parint.2007.06.001 [DOI] [PubMed] [Google Scholar]
