Skip to main content
PLOS Neglected Tropical Diseases logoLink to PLOS Neglected Tropical Diseases
. 2023 Mar 9;17(3):e0011121. doi: 10.1371/journal.pntd.0011121

Co-infection of tick-borne bacterial pathogens in ticks in Inner Mongolia, China

Dan Liu 1,#, Wulantuya 1,#, Hongxia Fan 1, Xiaona Li 1, Fangchao Li 1, Ting Gao 1, Xuhong Yin 1, Zitong Zhang 1, Minzhi Cao 1, Hiroki Kawabata 2, Kozue Sato 2, Norio Ohashi 3, Shuji Ando 4, Gaowa 1,*
Editor: Johan Van Weyenbergh5
PMCID: PMC10030021  PMID: 36893172

Abstract

Tick-borne infectious diseases pose a serious health threat in certain regions of the world. Emerging infectious diseases caused by novel tick-borne pathogens have been reported that are causing particular concern. Several tick-borne diseases often coexist in the same foci, and a single vector tick can transmit two or more pathogens at the same time, which greatly increases the probability of co-infection in host animals and humans and can lead to an epidemic of tick-borne disease. The lack of epidemiological data and information on the specific clinical symptoms related to co-infection with tick-borne pathogens means that it is not currently possible to accurately and rapidly distinguish between a single pathogen infection and co-infection with multiple pathogens, which can have serious consequences. Inner Mongolia in the north of China is endemic for tick-borne infectious diseases, especially in the eastern forest region. Previous studies have found that more than 10% of co-infections were in host-seeking ticks. However, the lack of data on the specific types of co-infection with pathogens makes clinical treatment difficult. In our study, we present data on the co-infection types and the differences in co-infection among different ecological regions through genetic analysis of tick samples collected throughout Inner Mongolia. Our findings may aid clinicians in the diagnosis of concomitant tick-borne infectious diseases.

Author summary

Ticks carry and transmit a variety of pathogens, and their host animals are widely distributed in nature with diverse epidemic links, so that several tick-borne diseases can coexist in the same foci, and even one type of tick or one tick can carry a variety of pathogens at the same time, these factors pose a serious public health threat. In our study, we summarized the regional differences in tick infection and co-infection rates outcomes in all Inner Mongolia of China, and found that pathogen diversity varied with ecogeographic differences such as gobi desert, grassland and forest. A variety of tick-borne bacterial pathogens were identified, with an overall high prevalence rate (61.4% of ticks infected), among infected ticks, 24.3% were co-infected. An unexpected high infection and co-infection rates of ticks collected from the Forest region of eastern Inner Mongolia (sample area 1) was detected. Geographical differences affect tick species and tick-borne pathogens, so the potential threat to humans or animals is also different. In particular, that that knowledge of co-infections is important as they do not just present diagnostic challenges, but the pathogens might play different roles within their respective hosts, thus modulating disease severity.

Introduction

Tick-borne pathogens are transmitted via hematophagous blood-sucking ticks to hosts (including humans), in which they may cause infectious disease. In some cases, ticks harbor multiple pathogens, which can result in co-infection. The two forms of co-infection are interspecific infection and intraspecific infection with different genospecies, and regional differences between these two types of infection have been reported [13]. Distinct environmental conditions provide the habitat for specific tick species and several tick-borne diseases often coexist in the same foci, which defines their geographical distribution and, consequently, the areas of risk for human tick-borne infections [46]. In these areas, the probability of co-infection of host animals and humans is greatly increased, leading to an epidemic of tick-borne disease.

During the 20th century, Mitchell and colleagues proposed serological evidence of co-infection with Borrelia burgdorferi, Babesia, and human granulocytic Ehrlichia species in residents of Wisconsin and Minnesota in the USA [7]. In a 4-year prospective study conducted in Germany and Latvia, 75 of 192 patients (39%) were co-infected with tick-borne pathogens, and 61 of the 75 patients were co-infected with B. burgdorferi and Babesia, with a co-infection rate of 81% in Ixodes ricinus ticks [8]. Dibernardo and colleagues reported co-infection of B. burgdorferi and Anaplasma phagocytophilum in Ixodes scapularis ticks collected in Canada [9]. These studies suggested that co-infection of B. burgdorferi with Babesia is common in both patients and tick samples. Lu and coworkers also found Candidatus R. tarasevichiae infection in patients with severe fever that were also infected with thrombocytopenia syndrome virus, with a co-infection rate of 9.4% (77/823) in China [10]. The results of laboratory examination and clinical manifestations suggested that the co-infection group included more severe cases than the single infection group. Furthermore, the course of disease was longer, the recovery of laboratory indicators was slower, and fatalities were reported among the co-infection group [10,11].

Located on the border of China and Russia, the Greater Hinggan Mountains in the eastern part of Inner Mongolia are rich in wildlife and have a diverse ecosystem. This region is one of the major epidemic areas of tick-borne infectious diseases in China because its unique geographical and ecological features make it an ideal habitat for ticks [3,1214]. In Inner Mongolia, and elsewhere in China and the rest of the world, limited research has been carried out on the occurrence of different genospecies in co-infections in host-questing ticks, despite progress on tick-borne infections. Indeed, most studies have focused on the identification of diversity in a single or a few pathogens, or on the prevalence of pathogen species [15,16]. Our present study aimed to detect the co-infection rates and co-infection diversity of tick-borne pathogens in questing ticks collected from three different ecological sites in Inner Mongolia.

Materials and methods

Ethics statement

The collection of ticks from the body surface of cattle, goats, and horses in this study was verbally approved by the animal owners and performed in strict accordance with the National Guidelines for Experimental Animal Welfare of China (2006–398). In addition, it has been applied and reviewed by the Animal Experimental Ethics Committee of the Medical Department of Hetao College, and it has been put on record in accordance with the "Animal Experimental Ethics Review Measures of Hetao College" ([2022] No. 112).

Study area and tick sampling sites

Inner Mongolia Autonomous Region is located in the northern frontier of China (97°E–126°E; 37°N–53°N), bordering Mongolia and Russia 4200 km to the north. The natural grassland in Inner Mongolia is vast and broad, with the total area ranking highest among the five grasslands in China, and it is an important region for livestock production. The topography of Inner Mongolia comprises mainly the Mongolian plateau, which is complex and diverse in form, with an average elevation of about 1000 m and a temperature that changes greatly between winter and summer. The sampling sites for this study were distributed across 103 counties (banners) of 12 league sites, covering three ecologically and geographically distinct areas of Inner Mongolia (Fig 1).

Fig 1. Sampling areas.

Fig 1

Geographical areas used for sampling were located in the north of China, and were divided mainly on the basis of different ecological and environmental characteristics. Sampling area 1 was a mainly forested habitat, sampling area 2 was a grassland habitat, and sampling area 3 was the semi-desertification steppe / Gobi Desert. The tick sampling collection period was from May 2015 until June 2019. ①—Sampling area 1 covering two leagues: Hulunbuir and Hinggan. ②—Sampling area 2 including Hohhot, Ulanqab and Xilin Gol, Tongliao and Chifeng. ③—Sampling area 3 including Baotou, Wuhai, Ordos, Bayan Nur, and Alxa. Map source: National Earth System Science Data Center (http://www.geodata.cn/data/datadetails.html?dataguid=223718677040067&docid=4590).

From March to September of each year from 2015 to 2019, ticks were collected from vegetation in the forest by the lab-cloth flagging method from area 1, and exoparasitic ticks were collected from cattle, goat, sheep, camel and horse by the animal physical examination method in area 2 and 3. Each area represented a distinct habitat. In sampling area 1, a forested area in the north-eastern part of Inner Mongolia, the main habitat was primeval forest at an altitude of 250–1745 m, with an average annual temperature of ˗3.5°C, and annual precipitation of 300–450 mm. In sampling area 2, a grassland area in central Inner Mongolia, the habitat is considered a frigid temperate zone of semi damp grassland with monsoonal conditions, at an altitude of 800–1200 m, and with annual precipitation of 150–400 mm. In sampling area 3, an area encompassing the Gobi Desert and the semi-desertification steppe of the western part of Inner Mongolia, the land is arid, at an altitude of 800–1500 m, and with annual precipitation of 40–240 mm (Fig 1).

Land cover data of Inner Mongolia were obtained free from the National Earth System Science Data Sharing Infrastructure (http://www.geodata.cn). ArcGIS 10.2 software was used for visualization.

Tick species identification, DNA extraction, and detection

Ticks were identified by morphological characteristics combined with tick mt-rrs gene identification method [17]. The ticks were soaked with sodium hypophosphite, 75% ethanol, and iodophor for 5 min, then washed with sterile water, dried naturally, and DNA was extracted using a genomic extraction kit (Qiagen, Hilden, Germany). Extracted DNA was stored at ˗20°C before use.

Detection of co-infections with other tick-borne pathogens

PCR was used for detection of the citrate synthase gene (gltA) in spotted fever group rickettsiae (SFGR). The gltA-positive samples were classified, and representative samples were sequenced according to the tick species and regional distribution. The Rickettsia outer membrane protein A gene (rOmpA) was also amplified for confirmation of the gltA PCR [18]. The outer membrane protein-1 gene (p28/omp-1) of Ehrlichia and the major surface protein-2 gene (p44/msp2) of Anaplasma were detected by nested PCR [12,19]. Targeting the 16S rRNA gene for borreliae, DNA primers and Taqman probes were designed from conserved sequences. Specific DNA probes were labeled with two types of fluorescent dyes, 6-carboxyfluorescein (FAM) and 4,7,2′-trichloro-7′-phenyl-6-carboxyfluorescein (VIC), and were conjugated with the non-fluorescent quencher (NFQ) and minor groove-binder architectural protein (MGB) according to a report by Barbour and colleagues (Table 1) [20]. Multiplex PCR was performed by real-time PCR according to a previously described protocol [17]. The 16S rRNA PCR-positive samples were classified, and conventional PCRs based on the borrelial flagellin (flaB) gene or the glycerophosphodiester phosphodiesterase (glpQ) gene were performed for confirmation of the real-time PCR results [21]. The PCR-specific primers and reaction conditions were derived from our previous studies [12,1821], and the primers used in these experiments were synthesized by Nanjing Kingsley Biotechnology Company (Nanjing, China).

Table 1. DNA primers used in this study.

Target group Target gene Primer Sequences(5’→3’) Reference
SFGR*1 gltA gltA-F CGAACTTACCGCTATTAGAATG [17]
gltA-R CTTTAAGAGCGATAGCTTCAAG
rOmpA rOmpA-F TGGTGGAGCTCATAAGTTACA [12]
rOmpA-R AGTTACATTTCCTGCACCTAC
Ehrlichia P28/omp1 conP28-F1 AT[C/T]AGTG[G/C]AAA[A/G]TA[T/C][A/G]T[G/A]CCAA [18]
conP28-R1 CAATGG[A/G][T/A]GG[T/C]CC[A/C]AGA[A/G]TAG
conP28-F2 TTA[G/A]AA[A/G]G[C/T]AAA[C/T]CT[T/G]CCTCC
conP28-R2 TTCC[T/C]TG[A/G]TA[A/G]G[A/C]AA[T/G]TTTAGG
Anaplasma P44/msp2 p3726 GCTAAGGAGTTAGCTTATGA [18]
p3761 CTGCTCT[T/G]GCCAA(AG)ACCTC
p4183 CAATAGT[C/T]TTAGCTAGTAACC
p4257 AGAAGATCATAACAAGCATTG
Borrelia flaB flaB-F GCTGAAGAGCTTGGAATGCAACC [19]
flaB-R TGATCAGTTATCATTCTAATAGCA
glpQ glpQ-F CATACGCTTATGCYTTRGGMGCTGA
glpQ-R GCAACCTCTGYCATACCTTCTTSTG
16S rRNA 16S_RT_F GCTGTAAACGATGCACACTTGGT [20]
16S _RT_R GGCGGCACACTTAACACGTTAG
BB_FAM FAM-TTCGGTACTAACTTTTAGTTAA-NFQ-MGB
BM_VIC VIC-CGGTACTAACCTTTCGATTA-NFQ-MGB

*1: SFGR (Spotted fever group rickettsiae).

PCR product purification and sequence analysis

The obtained PCR products of Anaplasma and Ehrlichia were gel-purified and cloned into a pCR2.1 vector using a TA Cloning kit (Thermo Fisher Scientific, Waltham, MA, USA). Escherichia coli DH5α (TOYOBO, Osaka, Japan) was transformed with the recombinant plasmids. Ten clones were selected randomly for each PCR product and the insert DNA of each clone was sequenced. Other PCR products were purified and sequenced directly. All obtained sequences were assembled and translated into protein sequences using the Sequencher program (Gene Codes Corp., Ann Arbor, MI, USA). Homology searches and species identification were performed using blastn or blastp (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Phylogenetic analysis of the flaB, glpQ, gltA, p28/omp-1, and p44/msp2 sequences were performed using MEGA 7 with 1000 bootstrap replicates [22].

Statistical analysis

Excel software was used to establish the database and IBM SPSS Statistics version 19 (IBM R Corporation, Chicago, IL, USA) was used for data analysis. Data counts were described by the number of cases (percentage), and the chi-square test (χ2) was performed on data relating to the tick infection ratio of geographic groups. A P-value was determined to be statistically significant when P < 0.05.

Results

Tick collection

During the spring to summer seasons (April to July) of 2015 to 2019, a total of 6456 adult tick samples belonging to eight species and five genera were collected in three different ecological environment sampling areas in Inner Mongolia. In sampling area 1, a total of 2949 ticks from five species were collected, of which 75.8% (2234/2949) were Ixodes persulcatus, followed by Haemaphysalis concinna (15.0%, 441/2949), Haemaphysalis douglasi (4.5%, 134/2949), Dermacentor nuttalli (4.1%, 120/2949), and Dermacentor silvarum (0.7%, 20/2949). In sampling area 2, a total of 1334 ticks from three species were collected, of which 68.9% (919/1334) were D. nuttalli, followed by Hyalomma asiaticum (28.6%, 381/1334), and Hyalomma marginatum (5.7%, 76/1334). In sampling area 3, a total of 2173 ticks from four species were collected, of which 50.5% (1097/2173) were D. nuttalli, followed by Hy. asiaticum (35.3%, 766/2173), Hy. marginatum (12.3%, 268/2173), and Rhipicephalus turanicus (1.9%, 42/2173) (Table 2 and Fig 1).

Table 2. Tick Collection and co-infections.

Sample Area Tick species Tick collection (%) Number of infections (%) Number of co-infections (%)
Male Female All Male Female All Male Female All
Sample area 1 Ha. concinna 333 (21.3) 108 (7.8) 441 (15) 319 (95.6) 13 (12) 332 (75.3) 5 (1.6) 3 (23.1) 8 (2.4)
Ha. douglasi 21 (1.3) 113 (8.2) 134 (4.5) 19 (90.5) 35 (31) 54 (40.3) 0 2 (5.7) 2 (3.7)
D. nuttalli 85 (5.4) 35 (2.5) 120 (4.1) 75 (88.2) 34 (97.1) 109 (90.8) 0 0 0
D. silvarum 1 (0.1) 19 (1.4) 20 (0.7) 1 (100) 11 (57.9) 12 (60) 0 0 0
I. persulcatus 1125 (71.9) 1109 (80.1) 2234 (75.8) 735 (65.3) 679 (61.2) 1414 (63.3) 371 (50.5) 450 (66.3) 821 (58.1)
Subtotal 1565 (53.1) 1384 (46.9) 2949 1149 (73.4) 772 (55.8) 1921 (65.1) 376 (32.7) 455 (58.9) 831 (43.3)
Sample area 2 Hy. asiaticum 217 (30.6) 164 (26.2) 381 (28.6) 104 (47.9) 119 (72.6) 223 (58.5) 0 11 (9.2) 11 (4.9)
Hy. marginatum 33 (4.7) 43 (6.9) 76 (5.7) 13 (39.4) 27 (62.8) 40 (52.6) 0 0 0
D. nuttalli 459 (64.7) 418 (66.9) 919 (68.9) 306 (66.7) 187 (44.7) 493 (53.6) 31 (10.1) 16 (8.6) 47 (9.5)
Subtotal 709 (53.1) 625 (46.9) 1334 423 (59.7) 333 (53.3) 756 (56.7) 31 (7.2) 27 (8.1) 58 (7.6)
Sample area 3 Hy. asiaticum 490 (38.1) 276 (31.2) 766 (35.3) 223 (45.5) 106 (38.4) 329 (43) 0 0 0
Hy. marginatum 96 (7.5) 172 (19.4) 268 (12.3) 90 (93.8) 159 (92.4) 249 (92.9) 0 0 0
D. nuttalli 685 (53.2) 412 (46.5) 1097 (50.5) 411 (60) 293 (71.1) 704 (64.2) 38 (9.2) 35 (11.9) 73 (10.4)
R. turanicus 16 (1.2) 26 (2.9) 42 (1.9) 4 (25.0) 3 (11.5) 7 (16.7) 0 0 0
Subtotal 1287 (59.2) 886 (40.8) 2173 728 (56.6) 561 (63.3) 1289 (59.3) 38 (5.2) 35 (6.2) 73 (5.7)
Total 3561 (55.2) 2895 (44.8) 6456 2300 (64.6) 1666 (57.6) 3966 (61.4) 445 (19.3) 517 (31) 962 (24.2)

Prevalence of tick-borne pathogens in ticks

As shown in Table 2, tick-borne pathogens were detected in 61.4% (3966/6456) of all ticks collected from all sampling sites. The infection frequencies for male and female ticks were 64.6% (2300/3561) and 57.6% (1666/2895), respectively (Table 2). In sampling area 1, of the 2949 ticks collected, 1921 were infected, with an infection rate of 65.1% (1921/2949). The infection rates for different tick species varied greatly. D. nuttalli had the highest infection rate of 90.8% (109/120), followed by Ha. concinna, I. persulcatus, and D. silvarum with 75.3% (332/441), 63.3% (1414/2234), and 60.0% (12/20) infection rates, respectively. Ha. douglasi showed the lowest infection rate of 40.3% (54/134) compared with the other tick species (χ2 = 94.867, P < 0.001). In sampling area 2, of the 1334 ticks collected, 756 were PCR-positive, with an infection rate of 56.7% (756/1334). The infection rates of Hy. asiaticum, D. nuttalli, and Hy. marginatum were 58.5% (223/381), 53.6% (493/919), and 52.6% (40/76), respectively (χ2 = 2.770, P = 0.250). In sampling area 3, of the 2173 ticks collected, 1289 were PCR-positive, with an infection rate of 59.3% (1289/2173). The infection rate for different tick species varied greatly. Hy. marginatum had the highest infection rate of 92.9% (249/268), followed by D. nuttalli and Hy. asiaticum with infection rates of 64.2% (704/1097) and 43.0% (329/766), respectively. R. turanicus had the lowest infection rate of 16.7% (7/42) (χ2 = 252.747, P < 0.001) (Table 2 and Fig 1).

Sequencing of the PCR products revealed that the SFGR gltA gene shared 100% identity with Rickettsia raoultii (accession no. DQ365803), Candidatus R. tarasevichiae (accession no. MN450397), and Rickettsia sp. strain YN02 (accession no. KY411135). We performed rOmpA PCR of the gltA PCR-positive samples and confirmed that the results were consistent. Ehrlichial p28/omp-1 multigenes were detected in E. chaffeensis (accession no. CP007480) (62.5%–100%), E. ewingii (accession no. AF287964) (65.5%–100%), E. muris (accession no. AB178807) (72.5%–100%), and Ehrlichia sp. strain HF565 (accession no. AB178803) (67.5%–100%). Anaplasma p44/msp2 multigenes were detected in Anaplasma phagocytophilum (accession no. BAN28309) (67.5%–100%). The borrelial flaB and glpQ genes shared 100% identity with Borrelia afzelii strain HLJ01 (accession no. CP003882), Borrelia garinii strain NMJW1 (accession no. CP003866), Borrelia sp. HFW-21 (accession no. LC170020), and B. miyamotoi strain HT31 (accession no. AB900798). A recent study identified and reclassified B. garinii strain NMJW1 as B. bavariensis by whole genome sequencing and multilocus sequence typing (https://pubmlst.org/organisms/borrelia-spp). However, we did not perform either of these techniques in this study to further classify the Borrelia species detected from ticks. Thus, we temporally used the designation ‘Borrelia sp.’, which was identical to B. garinii strain NMJW1, to represent the B. garinii-complex in this study.

Co-infections

Among the 6456 collected ticks, the overall prevalence of tick-borne pathogens was 61.4% (3966/6456), and the co-infection rate of the 3 regions was significantly different.

In sample area 1, of the 1921 infected ticks, co-infections were identified in 43.3% (831/1921). Among them, co-infection of I. persulcatus accounted for the majority of cases. In sample area 2, of the 756 infected ticks, co-infections were identified in 7.6% (58/756). Among them, co-infection of D. nuttalli and Hy. asiaticum accounted for 81.0% (47/58) and 19.0% (11/58) of cases, respectively. In sample area 3, of the 1289 infected ticks, all co-infections were detected with D. nuttalli, and the co-infection rate was 5.7% (73/1289). The co-infection rate in sample area 1 was significantly higher than that in sample areas 2 (χ2 = 317.145, P < 0.001) and 3 (χ2 = 530.261, P < 0.001) (Table 2).

Pathogen detection and identification in co-infections

SFGR, Ehrlichia, Anaplasma, and Borrelia were detected in co-infections in all sampling sites. In sampling area 1, of the 831 co-infected ticks, most carried C. R. tarasevichiae, accounting for 86.2% (716/831), followed by the B. garinii-complex (including B. bavariensis and B. garinii), with a DNA-positive rate of 59.8% (497/831). In sampling area 2, of the 58 co-infected ticks, all carried the B. garinii-complex, followed by R. raoultii, at a rate of 72.4% (42/58). In sampling area 3, of the 73 co-infected ticks, all carried R. raoultii, followed by the B. garinii-complex, at a rate of 84.9% (62/73) (Table 3).

Table 3. Pathogen identified in co-infected Tick samples.

Bacterial species Co-infected tick (%)
Sample area 1:
831 ticks
Sample area 2:
58 ticks
Sample area 3:
73 ticks
SFGR*1 R. raoultii 62 (7.5) 42 (72.4) 73 (100)
C. R. tarasevichiae 716 (86.2)
Rickettsia sp. YN02 16 (27.6)
Ehrlichia E. chaffeensis 4 (0.5)
E. ewingii 27 (3.2)
E. muris 141 (17) 3 (8.3)
Ehrlichia sp. HF565 23 (2.7)
Anaplasma A. phagocytophilum 231 (27.1)
Borrelia B. afzelii 2 (0.2) 10 (13.7)
B. miyamotoi 179 (21.5) 1 (1.4)
B. garinii-complex 497 (59.8) 58 (100) 62 (84.9)
Borrelia sp. HFW-21 7 (0.8)

*1: SFGR (Spotted fever group rickettsiae).

Co-infection between different pathogen types

In sampling area 1, co-infection between C. R. tarasevichiae and the B. garinii-complex was the most common, with a co-infection rate of 4.6% (297/6456), followed by C. R. tarasevichiae and A. phagocytophilum (1.7%; 108/6456). In sample areas 2 and 3, co-infection was most frequent for R. raoultii and the B. garinii-complex (39/6456; 0.6% and 63/6456; 1.0%, respectively) (Table 4).

Table 4. Pathogen co-infection type in Tick samples.

Pathogen associations Sample area 1 Sample area 2 Sample area 3 Total No.
M*1 F*2 Total M F Total M F Total M F Total
R. raooltii+E. muris 3 3 3 3
R. raooltii+A. phagocytophilum 7 1 8 7 1 8
R. raooltii+B. garinii-complex 10 20 30 27 12 39 28 35 63 65 67 132
R. raooltii+B. miyamotoi 1 1 1 1
R. raooltii+B. afzelii 10 0 10 10 10
Rickettsia sp.+B. garinii-complex 2 14 16 2 14 16
C. R. tarasevichiae+E. muris 29 21 50 29 21 50
C. R. tarasevichiae+E. chaffeensis 1 3 4 1 3 4
C. R. tarasevichiae+E. ewingii 1 2 3 1 2 3
C. R. tarasevichiae+A. phagocytophilum 62 46 108 62 46 108
C. R. tarasevichiae+B. garinii-complex 107 190 297 119 178 297
C. R. tarasevichiae+B. miyamotoi 35 29 64 35 29 64
E. muris+A. phagocytophilum 3 3 6 3 3 6
E. muris+B. garinii-complex 1 1 2 1 1 2
E. muris+B. miyamotoi 4 3 7 4 3 7
E. ewingii+B. garinii-complex 7 7 7 7
A. phagocytophilum+B. garinii-complex 3 3 6 3 3 6
A. phagocytophilum+B. miyamotoi 2 3 5 2 3 5
B. garinii-complex+B. miyamotoi 3 2 5 3 2 5
B. miyamotoi+B. afzelii 0 2 2 0 2 2
B. miyamotoi+Borrelia sp. 3 4 7 3 4 7
R. raooltii+E. muris+A. phagocytophilum 1 1 1 1
R. raooltii+E. muris+B. garinii-complex 2 4 6 2 1 3 4 5 9
R. raooltii+A. phagocytophilum+B. miyamotoi 1 8 9 1 8 9
R. raooltii+B. garinii-complex+B. miyamotoi 1 2 3 1 2 3
C. R. tarasevichiae+E. muris+A. phagocytophilum 9 8 17 9 8 17
C. R. tarasevichiae+E. muris+B. garinii-complex 15 15 30 15 15 30
C. R. tarasevichiae+E. muris+B. miyamotoi 3 1 4 3 1 4
C. R. tarasevichiae+E. ewingii+A. phagocytophilum 1 1 1 1
C. R. tarasevichiae+E. ewingii+B. garinii-complex 4 7 11 4 7 11
C. R. tarasevichiae+Ehrlichia sp.+B. garinii-complex 6 7 13 6 7 13
C. R. tarasevichiae+Ehrlichia sp.+B. miyamotoi 4 5 9 4 5 9
C. R. tarasevichiae+A. phagocytophilum+B. garinii-complex 8 17 25 8 17 25
C. R. tarasevichiae+A. phagocytophilum+B. miyamotoi 6 13 19 6 13 19
C. R. tarasevichiae+B. garinii-complex+B. miyamotoi 14 22 36 14 22 36
E. ewingii+A. phagocytophilum+B. garinii-complex 2 2 0 2 2
E. ewingii+B. garinii-complex+B. miyamotoi 2 2 2 2
A. phagocytophilum+B. garinii-complex+B. miyamotoi 1 1 2 1 1 2
R. raooltii+E. muris+A. phagocytophilum+B. miyamotoi 1 1 0 1 1
C. R. tarasevichiae+E. muris+A. phagocytophilum+B. garinii-complex 1 1 1 1
C. R. tarasevichiae+E. muris+A. phagocytophilum+B. miyamotoi 3 1 4 3 1 4
C. R. tarasevichiae+E. muris+B. garinii-complex+B. miyamotoi 5 3 8 5 3 8
C. R. tarasevichiae+A. phagocytophilum+B. garinii-complex+B. miyamotoi 4 4 8 4 4 8
C. R. tarasevichiae+E. ewingii+A. phagocytophilum+B. garinii-complex 1 1 2 1 1 2
C. R. tarasevichiae+Ehrlichia sp.+A. phagocytophilum+B. miyamotoi 1 1 1 0 1
C. R. tarasevichiae+E. muris+A. phagocytophilum+B. garinii-complex+B. miyamotoi 1 1 1 0 1
Total 376 455 831 31 27 58 38 35 73 445 517 962

*1: Male ticks, *2: Female ticks.

In sampling area 1, triple pathogen co-infection was identified in 190 ticks, 36 of which were infected with C. R. tarasevichiae, the B. garinii-complex, and B. miyamotoi (36/6456; 0.6%), followed by C. R. tarasevichiae, E. muris, and the B. garinii-complex (30/6456; 0.5%). In sampling area 2, only three ticks showed triple pathogen co-infection, comprising R. raoultii, E. muris, and the B. garinii-complex. In sampling area 3, no ticks were found to be co-infected with three different pathogens (Table 4).

In sampling area 1, 25 ticks were detected to be co-infected with four different pathogens, eight of which were infected with C. R. tarasevichiae, E. muris, the B. garinii-complex, and B. miyamotoi, and eight were infected with C. R. tarasevichiae, A. phagocytophilum, the B. garinii-complex, and B. miyamotoi. In sampling areas 2 and 3, no ticks were found to be co-infected with four different pathogens (Table 4).

Only in sampling area 1, was one tick found to be co-infected with five different pathogens, namely C. R. tarasevichiae, E. muris, A. phagocytophilum, the B. garinii-complex, and B. miyamotoi (Table 4).

Discussion

Co-infection with tick-borne pathogens has been suggested to reflect the fact that ticks can carry and transmit multiple pathogens and the need for ticks to switch to different hosts to complete their entire growth process, thereby increasing the likelihood of acquiring different pathogens from different hosts [23,24]. Co-infection can occur when a livestock tick carrying multiple pathogens or multiple ticks carrying multiple pathogens bite a person in succession [25].

In this study, a comprehensive investigation of the epidemiological status of 12 tick-borne bacterial pathogens of four genera was performed in co-infected ticks isolated in northern China. The important findings of our study were as follows. (1) The identification of a variety of tick-borne bacterial pathogens, with an overall high prevalence rate (61.4% of ticks infected). (2) The frequency of co-infection. Among infected ticks, 24.2% were co-infected, with co-infection of C. R. tarasevichiae and the B. garinii-complex being the most common. (3) The unexpected high infection and co-infection rates of ticks collected from the forest region of eastern Inner Mongolia (sample area 1). (4) The significant changes in the ecological and geographical distribution of the main dominant tick species, and the corresponding increase in pathogen diversity between the Gobi Desert and the semi-desertification steppe, and the grasslands and forest. Together, these results indicate the significant potential threat to public health of tick-borne pathogens.

In this study, we detected the B. garinii-complex in ticks. In a previous study, B. garinii, comprising of the formerly designated B. garinii and B. bavariensis, was reported to be distributed across China [26]. Although these two Borrelia spp. are distinguishable by multi-locus sequence typing [27], they cannot be distinguished by flaB-sequencing because of its low resolution. Therefore, it is highly probable that both the former B. garinii and B. bavariensis have previously been designated as B. garinii.

Inner Mongolia covers a wide geographic area from east to west, and the ecological environments across this region are therefore quite distinct. The vegetation that constitutes the tick habitat changes from east to west, from forests to grasslands to semi-desert grasslands to deserts. The distribution of tick species is closely related to host species and the ecological environment and, consequently, the risk of human tick-borne infection varies from region to region [46]. I. persulcatus was the dominant tick species in the eastern forest region (sample area 1). I. persulcatus is a typical forest tick species, which is dominant in conifer and broadleaved mixed forest, and its host range is wide, including domestic or wild medium and small mammals. The distribution of I. persulcatus covers Inner Mongolia [13,14], mainland China [28], and more specifically the southwest and northeast of China [2932], among other places. D. nuttalli was the dominant tick species in the central and western grasslands (sample areas 2 and 3). D. nuttalli inhabits the arid semi-desert steppe regions, mainly parasitizing livestock and humans. The distribution of D. nuttalli covers Inner Mongolia [12,14], Gansu [33], and the southwest and northeast of China [29,31,32], among other places.

In sample area 1, C. R. tarasevichiae was found to reside with other pathogens in 23 co-infection patterns, accounting for 81.7% of co-infections. Among them, the co-infection of C. R. tarasevichiae and the B. garinii-complex was most common, followed by C. R. tarasevichiae and A. phagocytophilum. C. R. tarasevichiae was first identified in I. persulcatus ticks from various sites in Russia in 2001 [34]. Human infection with C. R. tarasevichiae was first reported in northeastern China in 2012 [35] and is widely distributed in eastern and northeastern China [11,36,37]. The forest region in northeast China is close to Russia in terms of geography. With the development of tourism, animal husbandry, and logging, human activities have increased the opportunity for humans, livestock, and ticks to come into contact, possibly creating conditions for the spread of C. R. tarasevichiae. A previous study found that B. burgdorferi sensu lato infection in ticks and mice in the Greater Khingan Mountains forest region of Inner Mongolia is mainly caused by B. garinii [38]. Pan and colleagues [39] also found that the co-infection rate of C. R. tarasevichiae and B. burgdorferi sensu lato was high (20%) in I. persulcatus in Heilongjiang Province. Co-infection with C. R. tarasevichiae has been reported to aggravate disease symptoms and has been linked with mortality [11]. Our results suggest that C. R. tarasevichiae has a high rate of co-infection with other pathogens, which highlights the importance of considering C. R. tarasevichiae in the differential diagnosis of other tick-borne pathogens in endemic regions. In sample areas 2 and 3, the most frequent genospecies association was between R. raoultii and B. garinii. Co-infection with B. garinii is relatively common [1,40]. R. raoultii is widely distributed in the steppe of central and western Inner Mongolia, and D. nuttalli is the main vector and host. In central and western Inner Mongolia, the grassland is arid and the vegetation coverage rate is low, but the parasitism rate of D. nuttalli remains high in spring and summer, which seriously affects local livestock production. The infection and co-infection rates in ticks from sample area 1 (deciduous and mixed forest vegetation) were the most serious, thus highlighting a significant disease risk in this area, a heavily frequented recreational area and tourist hotspot. In addition, the detection rate of Rickettsia and Borrelia was high in ticks in this study, indicating an increased probability of their co-infection with other pathogens.

In this study, the predominant host among co-infection cases was I. persulcatus, accounting for more than 85% of co-infections. It has been confirmed that I. persulcatus can be naturally infected with a variety of pathogens. Fu and colleagues [41] found that at least 40% of I. persulcatus individuals were co-infected, including both double and triple infections.

Co-infections might have consequences in terms of pathogen co-transmission [24], and the high co-infection rate among ticks poses a health threat to humans and livestock [3,42]. The clinical presentation of tick-borne-associated bacterial infections is similar, therefore, diagnosis is challenging and co-infection can be easily missed. The co-infecting pathogens might play different roles within their respective host, thus modulating disease severity [43,44].

Ecological changes and social development may have contributed to the emergence of the tick-borne diseases by placing people in increasing contact with ticks and potential animal reservoirs. Therefore, medical personnel should be trained in identified tick-borne disease hotspots (sample area 1), to improve the detection and identification of TBRD and treatment strategies to reduce the fatality rate linked to co-infection. Disease control and prevention personnel should also be trained to conduct epidemiological investigations and to control the spread and prevalence of outbreaks.

Our findings highlight the severity of tick-borne pathogen infections in the eastern forest region through the collection of field data across all regions of Inner Mongolia from 2015 to 2019. In response, it is hoped that relevant departments can pay increased attention to the co-infection of tick-borne pathogens, and conduct timely screening and clinical treatment for common co-infection patterns to avoid the occurrence of more serious complications.

In this study, sequencing was performed on some samples and R. raoultii was detected from D. nuttalli and C. R. tarasevichiae from I. persulcatus. Data from neighboring countries showed the presence of Rickettsia helvetica [45], but we failed to detect it within the scope of this investigation. Therefore, the genotypes of rickettsiae may be incomplete, and we will continue to expand the sample size to be sequenced for verification.

Acknowledgments

We are grateful to Prof. Hiroki Kawabatato for improving the English of our manuscript. We also thank Liwen Bianji (Edanz) (https://www.liwenbianji.cn) for editing the language of a draft of this manuscript. Acknowledgment for the data support from "National Earth System Science Data Center, National Science & Technology Infrastructure of China (http://www.geodata.cn)"

Data Availability

All relevant data are within the manuscript.

Funding Statement

The research was supported by the following grants: Science and Technology Program of Inner Mongolia (to Gaowa); The Natural Science Foundation of Inner Mongolia (No. 2021MS03029 to Wulantuya); Bayan Nur Doctoral Scientific Research Station (No. BKZ2016 to Gaowa); The Grassland Elite Program of Inner Mongolia (to Gaowa); The Hetao Elite Program of Bayan Nur (to Gaowa); Inner Mongolia Higher Education Science and Technology Research Project (No. NJZY21185 to DL). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Raileanu C, Moutailler S, Pavel I, Porea D, Mihalca AD, Savuta G, Vayssier-Taussat M. Borrelia Diversity and Co-infection with Other Tick Borne Pathogens in Ticks. Front Cell Infect Microbiol. 2017;7:36. doi: 10.3389/fcimb.2017.00036 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Blazejak K, Raulf MK, Janecek E, Jordan D, Fingerle V, Strube C. Shifts in Borrelia burgdorferi (s.l.) geno-species infections in Ixodes ricinus over a 10-year surveillance period in the city of Hanover (Germany) and Borrelia miyamotoi-specific Reverse Line Blot detection. Parasit Vectors. 2018;11(1):304. doi: 10.1186/s13071-018-2882-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Chen X, Li F, Yin Q, Liu W, Fu S, He Y, Lei W, Xu S, Liang G, Wang S, Yang G, Qi X, Wang H. Epidemiology of tick-borne encephalitis in China, 2007–2018. PLoS One. 2019;14(12):e0226712. doi: 10.1371/journal.pone.0226712 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Li Y, Wang J, Gao M, Fang L, Liu C, Lyu X, Bai Y, Zhao Q, Li H, Yu H, Cao W, Feng L, Wang Y, Zhang B. Geographical Environment Factors and Risk Assessment of Tick-Borne Encephalitis in Hulunbuir, Northeastern China. Int J Environ Res Public Health. 2017;14(6):569. doi: 10.3390/ijerph14060569 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Fang LQ, Liu K, Li XL, Liang S, Yang Y, Yao HW, Sun RX, Sun Y, Chen WJ, Zuo SQ, Ma MJ, Li H, Jiang JF, Liu W, Yang XF, Gray GC, Krause PJ, Cao WC. Emerging tick-borne infections in mainland China: an increasing public health threat. Lancet Infect Dis. 2015;15(12):1467–1479. doi: 10.1016/S1473-3099(15)00177-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Kilpatrick AM, Randolph SE. Drivers, dynamics, and control of emerging vector-borne zoonotic diseases. Lancet. 2012;380(9857):1946–55. doi: 10.1016/S0140-6736(12)61151-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Mitchell PD, Reed KD, Hofkes JM. Immunoserologic evidence of coinfection with Borrelia burgdorferi, Babesia microti, and human granulocytic Ehrlichia species in residents of Wisconsin and Minnesota. J Clin Microbiol. 1996;34(3):724–7. doi: 10.1128/jcm.34.3.724–727.1996 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Süss J, Schrader C, Abel U, Bormane A, Duks A, Kalnina V. Characterization of tick-borne encephalitis (TBE) foci in Germany and Latvia (1997–2000). Int J Med Microbiol. 2002;291 Suppl 33:34–42. doi: 10.1016/s1438-4221(02)80007-8 [DOI] [PubMed] [Google Scholar]
  • 9.Dibernardo A, Cote T, Ogden NH, Lindsay LR. The prevalence of Borrelia miyamotoi infection, and co-infections with other Borrelia spp. in Ixodes scapularis ticks collected in Canada. Parasit Vectors. 2014;7:183. doi: 10.1186/1756-3305-7-183 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Lu QB, Li H, Zhang PH, Cui N, Yang ZD, Fan YD, Cui XM, Hu JG, Guo CT, Zhang XA, Liu W, Cao WC. Severe Fever with Thrombocytopenia Syndrome Complicated by Co-infection with Spotted Fever Group Rickettsiae, China. Emerg Infect Dis. 2016;22(11):1957–1960. doi: 10.3201/eid2211.161021 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Liu W, Li H, Lu QB, Cui N, Yang ZD, Hu JG, Fan YD, Guo CT, Li XK, Wang YW, Liu K, Zhang XA, Yuan L, Zhao PY, Qin SL, Cao WC. Candidatus Rickettsia tarasevichiae Infection in Eastern Central China: A Case Series. Ann Intern Med. 2016;164(10):641–8. doi: 10.7326/M15-2572 [DOI] [PubMed] [Google Scholar]
  • 12.Gaowa Wulantuya, Yin X, Cao M, Guo S, Ding C, Lu Y, Luo J, Kawabata H, Ando S, Su H, Shimada M, Takamoto N, Shimamura Y, Masuda S, Ohashi N. Case of Human Infection with Anaplasma phagocytophilum in Inner Mongolia, China. Jpn J Infect Dis. 2018;71(2):155–157. doi: 10.7883/yoken.JJID.2017.450 [DOI] [PubMed] [Google Scholar]
  • 13.Gaowa Wulantuya, Sato K, Liu D, Cui Y, Yin X, Zhang L, Li H, Wang T, Liu R, Wu L, Lu S, Gao T, Zhang Z, Cao M, Wang G, Li C, Yan D, Ohashi N, Ando S, Kawabata H. Surveillance of Borrelia miyamotoi-carrying ticks and genomic analysis of isolates in Inner Mongolia, China. Parasit Vectors. 2021;14(1):368. doi: 10.1186/s13071-021-04809-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Gao Y, Lv XL, Han SZ, Wang W, Liu Q, Song M. First detection of Borrelia miyamotoi infections in ticks and humans from the northeast of Inner Mongolia, China. Acta Trop. 2021;217:105857. doi: 10.1016/j.actatropica.2021.105857 [DOI] [PubMed] [Google Scholar]
  • 15.Razanske I, Rosef O, Radzijevskaja J, Bratchikov M, Griciuviene L, Paulauskas A. Prevalence and co-infection with tick-borne Anaplasma phagocytophilum and Babesia spp. in red deer (Cervus elaphus) and roe deer (Capreolus capreolus) in Southern Norway. Int J Parasitol Parasites Wildl. 2019;8:127–134. doi: 10.1016/j.ijppaw.2019.01.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Bursakov SA, Kovalchuk SN. Co-infection with tick-borne disease agents in cattle in Russia. Ticks Tick Borne Dis. 2019;10(3):709–713. doi: 10.1016/j.ttbdis.2019.03.004 [DOI] [PubMed] [Google Scholar]
  • 17.Takano A, Fujita H, Kawabata H, et al. Construction of a DNA database for ticks collected in Japan: application of molecular identification based on the mitochondrial 16S rDNA gene. Medical Entomology and Zoology. 2014;65(1):13–21. doi: 10.7601/mez.65.13 [DOI] [Google Scholar]
  • 18.Gaowa, Ohashi N, Aochi M, Wuritu D, Wu, Yoshikawa Y, Kawamori F, Honda T, Fujita H, Takada N, Oikawa Y, Kawabata H, Ando S, Kishimoto T. Rickettsiae in ticks, Japan, 2007–2011. Emerg Infect Dis. 2013;19(2):338–40. doi: 10.3201/eid1902.120856 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Gaowa, Yin X, Guo S, Ding C, Cao M, Kawabata H, Sato K, Ando S, Fujita H, Kawamori F, Su H, Shimada M, Shimamura Y, Masuda S, Ohashi N. Spotted Fever Group Rickettsiae in Inner Mongolia, China, 2015–2016. Emerg Infect Dis. 2018;24(11):2105–2107. doi: 10.3201/eid2411.162094 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Barbour AG, Bunikis J, Travinsky B, Hoen AG, Diuk-Wasser MA, Fish D, Tsao JI. Niche partitioning of Borrelia burgdorferi and Borrelia miyamotoi in the same tick vector and mammalian reservoir species. Am J Trop Med Hyg. 2009;81(6):1120–31. doi: 10.4269/ajtmh.2009.09–0208 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Takano A, Toyomane K, Konnai S, Ohashi K, Nakao M, Ito T, Andoh M, Maeda K, Watarai M, Sato K, Kawabata H. Tick Surveillance for Relapsing Fever Spirochete Borrelia miyamotoi in Hokkaido, Japan. PLoS One. 2014;9(8): e104532. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Kumar S, Stecher G,Tamura K. MEGA7: Molecular evolutionary geneticsanalysis version 7.0 for bigger datasets. Mol Biol Evol. 2016;33(7):1870–4. doi: 10.1093/molbev/msw054 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Chen Z, Liu Q, Liu JQ, Xu BL, Lv S, Xia S, Zhou XN. Tick-borne pathogens and associated co-infections in ticks collected from domestic animals in central China. Parasit Vectors. 2014;7:237. doi: 10.1186/1756-3305-7-237 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Pettersson J. The Origin of the Genus Flavivirus and the Ecology of Tick-Borne Pathogens. Biological Sciences. 2013. ISBN 978-91-554-8814-7. [Google Scholar]
  • 25.Moutailler S, Valiente Moro C, Vaumourin E, Michelet L, Tran FH, Devillers E, Cosson JF, Gasqui P, Van VT, Mavingui P, Vourc’h G, Vayssier-Taussat M. Co-infection of Ticks: The Rule Rather Than the Exception. PLoS Negl Trop Dis. 2016;10(3):e0004539. doi: 10.1371/journal.pntd.0004539 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Takano A, Nakao M, Masuzawa T, Takada N, Yano Y, Ishiguro F, Fujita H, Ito T, Ma X, Oikawa Y, Kawamori F, Kumagai K, Mikami T, Hanaoka N, Ando S, Honda N, Taylor K, Tsubota T, Konnai S, Watanabe H, Ohnishi M, Kawabata H. Multilocus sequence typing implicates rodents as the main reservoir host of human-pathogenic Borrelia garinii in Japan. J Clin Microbiol. 2011;49(5):2035–9. doi: 10.1128/JCM.02544-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Margos G, Wilske B, Sing A, Hizo-Teufel C, Cao WC, Chu C, Scholz H, Straubinger RK, Fingerle V. Borrelia bavariensis sp. nov. is widely distributed in Europe and Asia. Int J Syst Evol Microbiol. 2013;63(11):4284–4288. doi: 10.1099/ijs.0.052001–0 [DOI] [PubMed] [Google Scholar]
  • 28.Sun RX, Lai SJ, Yang Y, Li XL, Liu K, Yao HW, Zhou H, Li Y, Wang LP, Mu D, Yin WW, Fang LQ, Yu HJ, Cao WC. Mapping the distribution of tick-borne encephalitis in mainland China. Ticks Tick Borne Dis. 2017;8(4):631–639. doi: 10.1016/j.ttbdis.2017.04.009 [DOI] [PubMed] [Google Scholar]
  • 29.Liu H, Liang X, Wang H, Sun X, Bai X, Hu B, Shi N, Wang N, Zhang X, Huang L, Liao J, Huang F, Zhang H, Si X, Huang S, Jin N, Liu Q, Li L. Molecular evidence of the spotted fever group Rickettsiae in ticks from Yunnan Province, Southwest China. Exp Appl Acarol. 2020;80(3):339–348. doi: 10.1007/s10493-020-00467-5 [DOI] [PubMed] [Google Scholar]
  • 30.Shao JW, Zhang XL, Li WJ, Huang HL, Yan J. Distribution and molecular characterization of rickettsiae in ticks in Harbin area of Northeastern China. PLoS Negl Trop Dis. 2020;14(6):e0008342. doi: 10.1371/journal.pntd.0008342 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Zhang XC, Yang ZN, Lu B, Ma XF, Zhang CX, Xu HJ. The composition and transmission of microbiome in hard tick, Ixodes persulcatus, during blood meal. Ticks Tick Borne Dis. 2014;5(6):864–70. doi: 10.1016/j.ttbdis.2014.07.009 [DOI] [PubMed] [Google Scholar]
  • 32.Wei F, Song M, Liu H, Wang B, Wang S, Wang Z, Ma H, Li Z, Zeng Z, Qian J, Liu Q. Molecular Detection and Characterization of Zoonotic and Veterinary Pathogens in Ticks from Northeastern China. Front Microbiol. 2016;7:1913. doi: 10.3389/fmicb.2016.01913 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Liu Z, Shi S, Wang D, Yang Y, Luo Y. Infection rates of Borrelia burgdorferi in ticks in Gansu, China. Systematic and Applied Acarology. 1997;2:241. doi: 10.11158/15684 [DOI] [Google Scholar]
  • 34.Shpynov S, Fournier PE, Rudakov N, Raoult D. "Candidatus Rickettsia tarasevichiae" in Ixodes persulcatus ticks collected in Russia. Ann N Y Acad Sci. 2003;990:162–72. doi: 10.1111/j.1749-6632 [DOI] [PubMed] [Google Scholar]
  • 35.Jia N, Zheng YC, Jiang JF, Ma L, Cao WC. Human infection with Candidatus Rickettsia tarasevichiae. N Engl J Med. 2013;369(12):1178–80. doi: 10.1056/NEJMc1303004 [DOI] [PubMed] [Google Scholar]
  • 36.Yi S, Hongrong J, Wuchun C, Weiming F, Wendong J, Xin W. Prevalence of Candidatus Rickettsia tarasevichiae-Like Bacteria in Ixodid Ticks at 13 Sites on the Chinese-Russian Border. J Med Entomol. 2014;51(6):1304–7. doi: 10.1603/ME13189 [DOI] [PubMed] [Google Scholar]
  • 37.Yuan TT, Ma L, Jiang BG, Fu WM, Sun Y, Jia N, Jiang JF. First Confirmed Infection of Candidatus Rickettsia Tarasevichiae in Rodents Collected from Northeastern China. Vector Borne Zoonotic Dis. 2020;20(2):88–92. doi: 10.1089/vbz.2019.2443 [DOI] [PubMed] [Google Scholar]
  • 38.Chu CY, He J, Wang JB, Hasen GW, Zhang PH, Wu XM, Zhao QM, Jiang BG, Gao Y, Cao WC. Investigation on Borrelia burgdorferi sensu lato in ticks and rodents collected in Da Xing-An Mountains Forest areas of China. Zhonghua Liu Xing Bing Xue Za Zhi. 2006;27(8):681–4. . [PubMed] [Google Scholar]
  • 39.Pan YP, Yan JF, Niu QL, Mirza OA, Zhai BT, Zeng QY, Hong Y. Study on Borrelia burgdorferi sensu lato and spotted fever group Rickettsia in Ixodes persulcatus in Heilongjiang Province. Chinese Veterinary Science, 2017;47(1):31–37.doi: CNKI:SUN:ZGSY.0.2017-01-005. [Google Scholar]
  • 40.Jiao J, Lu Z, Yu Y, Ou Y, Fu M, Zhao Y, Wu N, Zhao M, Liu Y, Sun Y, Wen B, Zhou D, Yuan Q, Xiong X. Identification of tick-borne pathogens by metagenomic next-generation sequencing in Dermacentor nuttalli and Ixodes persulcatus in Inner Mongolia, China. Parasit Vectors. 2021;14(1):287. doi: 10.1186/s13071-021-04740-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Fu FX, Guo W, Zhang Y, et al. Advances in epidemiological reseach on tick borme infectious diseases. International Journal of Epidemiology and Infectious Diseases. 2012;39(4):285–288. doi: 10.3760/cma.j.issn.1673-4149.2012.04.020 [DOI] [Google Scholar]
  • 42.Baneth G. Tick-borne infections of animals and humans: a common ground. Int J Parasitol. 2014;44(9):591–6. doi: 10.1016/j.ijpara.2014.03.011 [DOI] [PubMed] [Google Scholar]
  • 43.Diuk-Wasser MA, Vannier E, Krause PJ. Coinfection by Ixodes Tick-Borne Pathogens: Ecological, Epidemiological, and Clinical Consequences. Trends Parasitol. 2016;32(1):30–42. doi: 10.1016/j.pt.2015.09.008 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.States SL, Huang CI, Davis S, Tufts DM, Diuk-Wasser MA. Co-feeding transmission facilitates strain coexistence in Borrelia burgdorferi, the Lyme disease agent. Epidemics. 2017;19:33–42. doi: 10.1016/j.epidem.2016.12.002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Kartashov MY, Glushkova LI, Mikryukova TP, Korabelnikov IV, Egorova YI, Tupota NL, Protopopova EV, Konovalova SN, Ternovoi VA, Loktev VB. Detection of Rickettsia helvetica and Candidatus R. tarasevichiae DNA in Ixodes persulcatus ticks collected in Northeastern European Russia (Komi Republic). Ticks Tick Borne Dis. 2017;8(4):588–592. doi: 10.1016/j.ttbdis.2017.04.001 [DOI] [PubMed] [Google Scholar]
PLoS Negl Trop Dis. doi: 10.1371/journal.pntd.0011121.r001

Decision Letter 0

Peter J Krause, Johan Van Weyenbergh

23 Aug 2022

Dear Dr. Gaowa,

Thank you very much for submitting your manuscript "Tick-borne bacterial pathogens in ticks collected in Inner Mongolia, China" for consideration at PLOS Neglected Tropical Diseases. As with all papers reviewed by the journal, your manuscript was reviewed by members of the editorial board and by several independent reviewers. In light of the reviews (below this email), we would like to invite the resubmission of a significantly-revised version that takes into account the reviewers' comments.

We cannot make any decision about publication until we have seen the revised manuscript and your response to the reviewers' comments. Your revised manuscript is also likely to be sent to reviewers for further evaluation.

When you are ready to resubmit, please upload the following:

[1] A letter containing a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

[2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file).

Important additional instructions are given below your reviewer comments.

Please prepare and submit your revised manuscript within 60 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email. Please note that revised manuscripts received after the 60-day due date may require evaluation and peer review similar to newly submitted manuscripts.

Thank you again for your submission. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.

Sincerely,

Johan Van Weyenbergh

Academic Editor

PLOS Neglected Tropical Diseases

Peter Krause

Section Editor

PLOS Neglected Tropical Diseases

***********************

Reviewer's Responses to Questions

Key Review Criteria Required for Acceptance?

As you describe the new analyses required for acceptance, please consider the following:

Methods

-Are the objectives of the study clearly articulated with a clear testable hypothesis stated?

-Is the study design appropriate to address the stated objectives?

-Is the population clearly described and appropriate for the hypothesis being tested?

-Is the sample size sufficient to ensure adequate power to address the hypothesis being tested?

-Were correct statistical analysis used to support conclusions?

-Are there concerns about ethical or regulatory requirements being met?

Reviewer #1: Multivariate analysis would be better to add for analysis of co-infection.

Reviewer #2: -Please verify that only verbal consent is needed/required from the animal owners (no written consent).

-Please state the types of livestock involved.

-Please elaborate on the "animal physical examination method".

-Please include the taxonomic keys used for tick species identification.

-Please clarify the reference(s) for PCR protocol/gene used in the study and cite accordingly.

-Re-check whether the procedure for sequence analysis has been described adequately/thoroughly.

Reviewer #3: Objective:

The authors aimed to identify various bacterial pathogens in ticks in different ecological settings of Inner Mongolia.

Overall, the authors obtained a substantial amount of data over the duration of 4 years from various locations across Mongolia. These could complement the existing literature on co-infections in other regions (for example : A study in France done by Moutailler et al. 2016. “Co-infection of Ticks: The Rule Rather Than the Exception”).

Is the study design appropriate to address the stated objectives:

The samples were taken from life stock, yet the introduction and discussion only refer to co-infections in human patients. I am assuming the authors are using the results to extrapolate them to humans, however, the authors did not discuss the implications (for example those tick species would need to also affect humans) and potential limitations for this (different biting rates, level of coinfections, how could the result differ depending on the host organism?). This to me is a discrepancy between the objective and study design.

The population was clearly described.

Is the sample size sufficient:

It is stated that sample area 1 has the highest tick infections and coinfections. However, sample area 1 has also by far the highest tick numbers collected. This could potentially attribute to a more likely detection of infection and co-infections (sample effect) compared to for example sample area 2.

Statistical analysis:

Chi2 ok.

ethical requirements:

The authors mentioned that consent for animal owners was verbally obtained. However, it is not clear whether/how this information was recorded.

--------------------

Results

-Does the analysis presented match the analysis plan?

-Are the results clearly and completely presented?

-Are the figures (Tables, Images) of sufficient quality for clarity?

Reviewer #1: (No Response)

Reviewer #2: -Please verify whether only adult ticks analysed (or were there any immatures included).

-What are the differences observed between male and female ticks in terms of infection and co-infections. Please discuss.

Reviewer #3: The manuscript suffers from poor grammar throughout the manuscript to the point where sentences become unreadable, and the meaning gets lost.

The results are clearly presented in the tables, however there is a discrepancy between the results and the discussion.

In the results section the overall infection rate is 61.4%, in the discussion it is 69.8%.

The figures and tables are of sufficient clarity.

--------------------

Conclusions

-Are the conclusions supported by the data presented?

-Are the limitations of analysis clearly described?

-Do the authors discuss how these data can be helpful to advance our understanding of the topic under study?

-Is public health relevance addressed?

Reviewer #1: (No Response)

Reviewer #2: -Please explain more on how clinicians can used the information for the purpose of diagnosis and treatment. Is there a need for them to keep the ticks for species identification?

-Are the tick-borne diseases can be treated in a similar manner or using similar drugs?

-What about the clinical presentations between the different types of pathogens? Any particular sign or symptoms to look for?

Reviewer #3: Are the conclusions supported by the data presented/ are there limitations:

Partially, as mentioned before it would be interesting to know whether those tick species found on cattle are the same ones that infect humans.

Further, it would be also interesting to know whether there was a change in the number of tick species/ coinfections over time (the study period was 4 years) and if yes, what impact this could have.

Understanding of the topic and impact on public health:

The authors found a high infection rate and coinfection rates in particular in one sample area, which consists mainly of forest areas. The authors did mention that knowledge of co-infections is important as they do not just present diagnostic challenges, but the pathogens might play different roles within their respective hosts, thus modulating disease severity.

--------------------

Editorial and Data Presentation Modifications?

Use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity. If the only modifications needed are minor and/or editorial, you may wish to recommend “Minor Revision” or “Accept”.

Reviewer #1: (No Response)

Reviewer #2: It is better for the manuscript to be checked for typing and spacing errors. A proofread by a native speaker may be useful too.

Reviewer #3: (No Response)

--------------------

Summary and General Comments

Use this section to provide overall comments, discuss strengths/weaknesses of the study, novelty, significance, general execution and scholarship. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. If requesting major revision, please articulate the new experiments that are needed.

Reviewer #1: Liu et al analyzed a mount of ticks samples collected from vegetation or animals.

Main comments.

1, ticks from vegetation and animals should be analyzed separately.

2, The result of co-infection was so confusing. please analyze it by Multivariate analysis.

3, Please re-write the purpose of introduction. Because authors did not analyze the genotype diversity in this MS.

Minor comment

1, Title would be better to change, for focusing the co-infection.

2, Please add more information of each detected pathogens

3, please indicate the tick stages

Reviewer #2: Great and interesting findings.

Reviewer #3: Summary:

In this manuscript, the authors identified various bacterial pathogens in ticks in different ecological settings of Inner Mongolia. They found a high infection rate and coinfection rates in particular in one sample area, which consists mainly of forest areas. Knowledge of co-infections is important as they do not just present diagnostic challenges, but the pathogens might play different roles within their respective hosts, thus modulating disease severity.

Overall, the authors obtained a substantial amount of data over the duration of 4 years from various locations across Mongolia. These could complement the existing literature on co-infections in other regions (for example: A study in France done by Moutailler et al. 2016. “Co-infection of Ticks: The Rule Rather Than the Exception”). However, unfortunately, the manuscript suffers from poor grammar throughout the manuscript to the point where sentences become unreadable, and the meaning gets lost.

Therefore, unless the grammar is significantly improved I do not recommend the manuscript for publication.

Further general comments:

1. Extrapolation of results:

The samples were taken from life stock, yet the introduction and discussion only refer to co-infections in human patients. I am assuming the authors are using the results to extrapolate them to humans, however, the authors did not discuss the implications (for example those tick species would need to also affect humans) and potential limitations for this (different biting rates, level of coinfections, how could the result differ depending on the host organism?).

2. Discrepancy between results and discussion:

In the results section the overall infection rate is 61.4%, in the discussion it is 69.8%.

3. As mentioned the overall grammar is poor (switch between past and present tense, singular and plural). Examples include:

Line 47-49- “Tick borne pathogen is transmitted from hematophagous ticks, and the tick sometimes harbored multiple pathogens, blood sucking host (including human) is infectious to pathogens”

Line 49- “When tick carries plural kinds of pathogen, co-infection often occurred.”

Line 55- At the same time, which greatly increases the probability of co-infection of host animals and humans, leading to the epidemic of tick-borne diseases

4. The language is informal and below publication standard for a Scientific Journal (for example authors are named by first name in Line 63 “Antonia”)

5. Simple errors were made that look like the paper was not proof-red – for example lack of spacing “Prevalenceof tick-borne pathogens inticks”

6. In the abstract it is highlighted first what could not be shown before the actual results are presented:

“Due to the lack of epidemiological data and specific clinical symptoms related to co-infection of tick-borne pathogens, we couldn't accurately and rapidly distinguish between a single pathogen infection and multiple pathogens co-infection, resulting in negligence of co-infection and even serious consequences. In our study, we summarized the possible co-infection types and the differences of coinfection among different ecological regions through the tick collection, experiment, sequencing, comparison and analysis of tick samples collected from all Inner Mongolia.”

7. It is stated that area 1 has the highest tick infections and coinfections. However, sample area 1 has also by far the highest tick numbers collected, could this not also attribute to a more likely detection of infection and co-infections (sample effect?) compared to for example sample area 2?

Other specific comments:

Line 51- Why are these regional differences so “obvious”? Delete the word “obvious”.

Line 62 – What are those other tick-borne pathogens if they are not B. burgdorferi and Babesia?

Line 67- This assumes the reader knows that Candidatus Rickettsia tarasevichiae is transmitted via ticks.

Line 87- 81- I do not understand the authors argument here. Do you mean that the focus has been too much on one type of tick-borne infection?

Line 83- What are superficial co-infections and how does it differ from your work? Is it because you are collecting data from 3 different sites?

Line 98-99- ample sunshine is not a scientific term

Line 155- How many/ what tick species are there?

Line 140-148- Why did you need to clone the PCR products into plasmids first before sequencing? Was the yield too low?

Line 169 – check the spacing of words

Line 188-191- Do you mean it could be any of those species and a further distinction is impossible?

Line 188-198- It looks like the analysis was done for particular genes that identify a particular set of species. However, what is that selection based on? Are those genes only present in those particular species or is it based on percentage of sequence identity? Can you combine the scores for various genes to narrow down the potential infected species?

Line 253- this study was about lifestock ticks, so it may be good to adjust this sentence accordingly

Line 259- in the results section the overall infection rate is 61.4% rather than 69.8%.

Line 262- Do you have an explanation of the high infection rate? Also the infection rate is higher than sample area 2 and 3, but is it high compared to other areas that have previously been studied?

Line 267- This argument needs to be expanded. Why is this a threat? For whom (livestock, humans or both?) Is it meant to get worse? Data were collected over 4 years, did the authors see a change in time?

Line 307- specify the disease

Line 329- and lifestock?

Line 551-552- The title of Tables 3 and 4 is more or less the same.

--------

Figure Files:

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.

Data Requirements:

Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example see here: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5.

Reproducibility:

To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols

PLoS Negl Trop Dis. doi: 10.1371/journal.pntd.0011121.r003

Decision Letter 1

Peter J Krause, Johan Van Weyenbergh

27 Dec 2022

Dear Dr. _,

Thank you very much for submitting your manuscript "Co-infection of tick-borne bacterial pathogens in ticks in Inner Mongolia, China" for consideration at PLOS Neglected Tropical Diseases. As with all papers reviewed by the journal, your manuscript was reviewed by members of the editorial board and by several independent reviewers. The reviewers appreciated the attention to an important topic. Based on the reviews, we are likely to accept this manuscript for publication, providing that you modify the manuscript according to the review recommendations.

Please prepare and submit your revised manuscript within 30 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email.

When you are ready to resubmit, please upload the following:

[1] A letter containing a detailed list of your responses to all review comments, and a description of the changes you have made in the manuscript.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out

[2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file).

Important additional instructions are given below your reviewer comments.

Thank you again for your submission to our journal. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.

Sincerely,

Peter J. Krause

Section Editor

PLOS Neglected Tropical Diseases

Peter Krause

Section Editor

PLOS Neglected Tropical Diseases

***********************

Reviewer's Responses to Questions

Key Review Criteria Required for Acceptance?

As you describe the new analyses required for acceptance, please consider the following:

Methods

-Are the objectives of the study clearly articulated with a clear testable hypothesis stated?

-Is the study design appropriate to address the stated objectives?

-Is the population clearly described and appropriate for the hypothesis being tested?

-Is the sample size sufficient to ensure adequate power to address the hypothesis being tested?

-Were correct statistical analysis used to support conclusions?

-Are there concerns about ethical or regulatory requirements being met?

Reviewer #2: Please state your reference for taxonomic keys/identification of the ticks using morphological characteristics.

Please state in the manuscript the types of livestock as you responded in your responses to reviewers/editor (i.e. cattle, goat, sheep, camel and horse).

Reviewer #3: It should be made clear in the text that ticks collected from area 1 were collected from vegetation in the forest,

ticks collected from area 2 and area 3 were all collected from animal body surface. This is not stated in the methods section.

--------------------

Results

-Does the analysis presented match the analysis plan?

-Are the results clearly and completely presented?

-Are the figures (Tables, Images) of sufficient quality for clarity?

Reviewer #2: (No Response)

Reviewer #3: The overall infection rates have been corrected and both the results and discussion now state the 61.4% overall infection rate.

However, I am not sure that referring to the overall co-infection rate of 24.2% is that useful because of the large variation between the three sample areas. I also agree with the other reviewer that those results from sample area 1 should be regarded separately from sample area 2 and 3 due to the different collection method. Co-infection rates in sample area 2 and 3 could be for example lower because they are collected on livestock (which is a fairly homogenous group, so exposure to other hosts might be limited). In the forest ticks were collected in the vegetation, these ticks may encounter different types of hosts much more thus they are more exposed to other pathogens).

--------------------

Conclusions

-Are the conclusions supported by the data presented?

-Are the limitations of analysis clearly described?

-Do the authors discuss how these data can be helpful to advance our understanding of the topic under study?

-Is public health relevance addressed?

Reviewer #2: Line 358 - Can you provide some examples of "relevant departments" and state these in your manuscript.

Reviewer #3: See comments in the results

--------------------

Editorial and Data Presentation Modifications?

Use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity. If the only modifications needed are minor and/or editorial, you may wish to recommend “Minor Revision” or “Accept”.

Reviewer #2: The map (figure 1) can be more clearer/sharper. I recommend minor revision.

Reviewer #3: Line 103 and Line 104 specify “it”

--------------------

Summary and General Comments

Use this section to provide overall comments, discuss strengths/weaknesses of the study, novelty, significance, general execution and scholarship. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. If requesting major revision, please articulate the new experiments that are needed.

Reviewer #2: (No Response)

Reviewer #3: I think the authors have improved the manuscript significantly and answered my previous comments sufficiently. However, more detailed information in the methods section about the tick sampling method in the different areas is needed.

--------------------

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #2: Yes: Dr. Aishah Hani Azil

Reviewer #3: No

Figure Files:

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.

Data Requirements:

Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example see here: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5.

Reproducibility:

To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols

References

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article's retracted status in the References list and also include a citation and full reference for the retraction notice.

PLoS Negl Trop Dis. doi: 10.1371/journal.pntd.0011121.r005

Decision Letter 2

Peter J Krause, Johan Van Weyenbergh

27 Jan 2023

Dear Dr. _,

We are pleased to inform you that your manuscript 'Co-infection of tick-borne bacterial pathogens in ticks in Inner Mongolia, China' has been provisionally accepted for publication in PLOS Neglected Tropical Diseases.

Before your manuscript can be formally accepted you will need to complete some formatting changes, which you will receive in a follow up email. A member of our team will be in touch with a set of requests.

Please note that your manuscript will not be scheduled for publication until you have made the required changes, so a swift response is appreciated.

IMPORTANT: The editorial review process is now complete. PLOS will only permit corrections to spelling, formatting or significant scientific errors from this point onwards. Requests for major changes, or any which affect the scientific understanding of your work, will cause delays to the publication date of your manuscript.

Should you, your institution's press office or the journal office choose to press release your paper, you will automatically be opted out of early publication. We ask that you notify us now if you or your institution is planning to press release the article. All press must be co-ordinated with PLOS.

Thank you again for supporting Open Access publishing; we are looking forward to publishing your work in PLOS Neglected Tropical Diseases.

Best regards,

Peter J. Krause

Section Editor

PLOS Neglected Tropical Diseases

Peter Krause

Section Editor

PLOS Neglected Tropical Diseases

***********************************************************

PLoS Negl Trop Dis. doi: 10.1371/journal.pntd.0011121.r006

Acceptance letter

Peter J Krause, Johan Van Weyenbergh

3 Mar 2023

Dear Dr. _,

We are delighted to inform you that your manuscript, "Co-infection of tick-borne bacterial pathogens in ticks in Inner Mongolia, China," has been formally accepted for publication in PLOS Neglected Tropical Diseases.

We have now passed your article onto the PLOS Production Department who will complete the rest of the publication process. All authors will receive a confirmation email upon publication.

The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any scientific or type-setting errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript. Note: Proofs for Front Matter articles (Editorial, Viewpoint, Symposium, Review, etc...) are generated on a different schedule and may not be made available as quickly.

Soon after your final files are uploaded, the early version of your manuscript will be published online unless you opted out of this process. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.

Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Neglected Tropical Diseases.

Best regards,

Shaden Kamhawi

co-Editor-in-Chief

PLOS Neglected Tropical Diseases

Paul Brindley

co-Editor-in-Chief

PLOS Neglected Tropical Diseases

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    Attachment

    Submitted filename: Response to Reviewers.docx

    Attachment

    Submitted filename: Response to Reviewers.docx

    Data Availability Statement

    All relevant data are within the manuscript.


    Articles from PLOS Neglected Tropical Diseases are provided here courtesy of PLOS

    RESOURCES