Skip to main content
Biomolecules logoLink to Biomolecules
. 2023 Mar 2;13(3):463. doi: 10.3390/biom13030463

I Choose You: Selecting Accurate Reference Genes for qPCR Expression Analysis in Reproductive Tissues in Arabidopsis thaliana

Maria João Ferreira 1,†, Jessy Silva 1,2,†, Sara Cristina Pinto 1, Sílvia Coimbra 1,*
Editor: Diego Hojsgaard
PMCID: PMC10046263  PMID: 36979397

Abstract

Quantitative real-time polymerase chain reaction (qPCR) is a widely used method to analyse the gene expression pattern in the reproductive tissues along with detecting gene levels in mutant backgrounds. This technique requires stable reference genes to normalise the expression level of target genes. Nonetheless, a considerable number of publications continue to present qPCR results normalised to a single reference gene and, to our knowledge, no comparative evaluation of multiple reference genes has been carried out in specific reproductive tissues of Arabidopsis thaliana. Herein, we assessed the expression stability levels of ten candidate reference genes (UBC9, ACT7, GAPC-2, RCE1, PP2AA3, TUA2, SAC52, YLS8, SAMDC and HIS3.3) in two conditional sets: one across flower development and the other using inflorescences from different genotypes. The stability analysis was performed using the RefFinder tool, which combines four statistical algorithms (geNorm, NormFinder, BestKeeper and the comparative ΔCt method). Our results showed that RCE1, SAC52 and TUA2 had the most stable expression in different flower developmental stages while YLS8, HIS3.3 and ACT7 were the top-ranking reference genes for normalisation in mutant studies. Furthermore, we validated our results by analysing the expression pattern of genes involved in reproduction and examining the expression of these genes in published mutant backgrounds. Overall, we provided a pool of appropriate reference genes for expression studies in reproductive tissues of A. thaliana, which will facilitate further gene expression studies in this context. More importantly, we presented a framework that will promote a consistent and accurate analysis of gene expression in any scientific field. Simultaneously, we highlighted the relevance of clearly defining and describing the experimental conditions associated with qPCR to improve scientific reproducibility.

Keywords: reference genes, reproductive tissues, expression analysis, normalisation, qPCR

1. Introduction

Arabidopsis thaliana, like all land plants, developed a life cycle that alternates between a haploid gametophytic generation and a diploid sporophytic generation [1]. The sporophyte generates two types of spores: microspores and megaspores, giving rise to the male and female gametophytes, respectively [2,3]. The male gametophyte, or pollen grain, comprises a vegetative cell that will develop into a pollen tube (PT), and a generative cell, which through a mitotic division, will form the two male gametes [4]. The female gametophyte, also known as embryo sac, exhibits a Polygonum-type pattern [5] composed of two synergid cells, a central cell, egg cell, and three antipodals [6,7]. When the pollen grain and embryo sac are mature, a unique process to Angiosperms occurs called double fertilisation. This event results in seed development and consists of the fusion of a male gamete with the egg cell, originating the diploid zygote, and the fusion of the other male gamete with the central cell, generating the triploid endosperm [8].

Several players have been reported to participate in the successful establishment of a new sporophytic generation, with many showing very specific spatiotemporal gene expression patterns [9]. This is the case of arabinogalactan proteins (AGPs), a protein family known for the high level of glycosylation in its members [10]. For example, AGP6 and AGP11, specifically expressed in the stamen and pollen, are thought to be involved in pollen grain release and PT endosome machinery, since knockout and knockdown mutations of these genes cause pollen abortion [11,12,13]. On the other hand, JAGGER, an AGP highly expressed in female tissues, was reported to be involved in the signalling pathway that blocks PT attraction once fertilisation occurs in jagger mutants, the persistent synergid does not degenerate after double fertilisation and continues to attract more PTs into the embryo sac (polytubey phenotype; [14]).

The study of plant reproduction is very important as it will provide knowledge to develop tools that will aid in maintaining successful fertilisation under stressful environmental conditions as well as in the production of resilient seeds. It is, therefore, necessary to discover all components underlying the pathways of seed formation and development. Monitoring gene expression levels on the different reproductive tissues (sporophytic and gametophytic), as well as in distinct genotypes [mutant (mt) versus wild type (wt)] is a common practice among plant reproduction studies. Spatiotemporal gene expression is preferably measured by quantitative polymerase chain reaction (qPCR) due to its sensitivity, accuracy, and cost-effectiveness [15]. Nevertheless, RNA purity, cDNA synthesis, primers efficiency, selection of internal controls, and statistical methods for analysis are variables inherent to qPCR technique that must be addressed [16,17]. The relative expression ratio [18], which compares the target gene transcripts to internal controls, is still considered the most adequate method for sample normalisation, minimizing the artefactual variability of total cDNA abundance among samples. Therefore, the choice of reference genes for experiments is fundamental in correctly interpreting the results [19]. A reference gene should be stably expressed on various cells/tissues under analysis as well as in different experimental conditions/treatments [16,19,20]. In the pre-genomic era, reference genes included families considered to be essential for a correct cell function, such as actin (ACT), ubiquitin (UBQ) and alpha-tubulin (TUA) [21,22,23]. However, this assumption was shown to be wrong for both animal and plant organisms [24,25,26,27]. For example, [28] time-course transcriptome analysis of Arabidopsis siliques showed ACT2, TUB2 and TUB6 as down-regulated genes in a mutant background, revealing that these genes were inappropriate internal controls for this specific qPCR experimental condition. To date, no validation of reference genes on A. thaliana reproductive tissues across different developmental stages has been described.

Here we report the expression stability of ten candidate reference genes [UBIQUITIN CONJUGATING ENZYME 9 (UBC9), ACTIN 7 (ACT7), GLYCERALDEHYDE-3-PHOSPHATE DEHYDROGENASE C2 (GAPC-2), RUB1 CONJUGATING ENZYME 1 (RCE1), PROTEIN PHOSPHATASE 2A SUBUNIT A3 (PP2AA3), TUBULIN ALPHA-2 CHAIN (TUA2), SUPPRESSOR OF ACAULIS 52 (SAC52), YELLOW-LEAF-SPECIFIC GENE 8 (YLS8), S-ADENOSYLMETHIONINE DECARBOXYLASE (SAMDC) and HISTONE 3.3 (HIS3.3)] in different reproductive tissues at different stages of development and with inflorescences of wt and mt of A. thaliana, using RefFinder [29] which integrates four statistical programs, namely geNorm [19], NormFinder [30], BestKeeper [31], and the comparative ΔCt method [32]. Previously reported genes involved in reproduction were used to validate the stability of the reference genes. Our study provides guidance to other scientists on how to choose reference genes for further studies using A. thaliana reproductive tissues.

2. Materials and Methods

2.1. Plant Material and Growth Conditions

Wild-type (wt) A. thaliana (L.), Heynh. Columbia-0 (Col-0), and Nossen-0 (No-0) seeds were obtained from Nottingham Arabidopsis Stock Centre (NASC). The jagger1-2 (GABI-Kat 134A10) in Col-0 background and agp6 agp11 (Ds54-4754-1 and Ds11-4025-1) in No-0 background mutant lines were previously characterised by [14] and [12], respectively. A. thaliana seeds were sown directly in soil (COMPO SANA®, COMPO, Münster, Germany) and kept for 48 h at 4 °C in the dark to induce stratification. Afterwards, all plants were grown under long-day conditions (16 h light at 22 °C and 8 h darkness at 18 °C) with 50–60% relative humidity and light intensity at 180 µmol m−2 s−1.

2.2. Selection of Candidate Reference Genes and Primer Design

A list of commonly used reference genes was obtained in a literature search. We analysed several published studies about the selection of reference genes for gene expression experiments using several tissues, conditions and plant species, besides A. thaliana. We then evaluated their expression on the A. thaliana reproductive tissues using the transcriptomic database EVOREPRO (https://evorepro.sbs.ntu.edu.sg/, accessed on 15 November 2021) [33], and selected ten genes from different functional classes that are essential to the correct function of a cell and which expression was high and stable across different tissues: male (microspore, bicellular pollen, tricellular pollen, mature pollen, pollen tube, generative cell, and sperm cell); female (ovary, ovule, and egg cell); flower (carpels, stigmatic tissue, stamen filaments, anthers, petals, sepals, flower buds, and receptacles); and seeds (endosperm, young seed, seed, and germinating seed) defined by [33] (Table S1).

The coding sequences of the candidate genes were retrieved from the National Center for Biotechnology Information (NCBI, http://www.ncbi.nlm.nih.gov/, accessed on 15 November 2021). The candidate reference genes were: UBC9 (AT4G27960), ACT7 (AT5G09810), GAPC-2 (AT1G13440), RCE1 (AT4G36800), PP2AA3 (AT1G13320), TUA2 (AT1G50010), SAC52 (AT1G14320), YLS8 (AT5G08290), SAMDC (AT3G02470) and HIS3.3 (AT4G40030). Primers were designed using Primer3 v.4.1.0 [34,35,36] according to the following parameters: annealing preferably on the 3′ of the transcript, primer length between 18–25 bp, GC content between 40–60%, melting temperature around 60 °C, and amplicon size between 70 and 150 bp. Structural aspects of the primers were also criterion of primer design: primers with G or C repeats longer than three bases, with more than two G or C in the last 5 bases at the 3′ end, and with long (>4) repeats of any nucleotide were avoided; primers with G and C at the ends were chosen when possible (Table 1).

Table 1.

List of candidate reference genes and primer sequences used in the qPCR analysis.

Locus Gene Symbol Gene Name Primer Sequences Forward and
Reverse (5′–3′)
Amplicon Length (bp)
AT4G27960 UBC9 UBIQUITIN CONJUGATING ENZYME 9 AGATGATCCTTTGGTCCCTGAG 114
CAGTATTTGTGTCAGCCCATGG
AT5G09810 ACT7 ACTIN 7 ATCAATCCTTGCATCCCTCAGC 72
GGACCTGACTCATCGTACTCAC
AT1G13440 GAPC-2 GLYCERALDEHYDE-3-PHOSPHATE DEHYDROGENASE C2 TGGGGTTACAGTTCTCGTGTC 83
ACCACACACAAACTCTCGCC
AT4G36800 RCE1 RUB1 CONJUGATING ENZYME 1 CGGTGGATATGTCGGTCAG 135
AACGAGGGTCCTTGAGAAAGAG
AT1G50010 TUA2 TUBULIN ALPHA-2 CHAIN CATTGAGAGACCCACCTACACC 78
AACCTCAGAGAAGCAGTCAAGG
AT1G13320 PP2AA3 PROTEIN PHOSPHATASE 2A SUBUNIT A3 TGTTCCAAACTCTTACCTGCGG 136
ATGGCCGTATCATGTTCTCCAC
AT1G14320 SAC52 SUPPRESSOR OF ACAULIS 52 CGTCGTGCTAAGTTCAAGTTCC 108
CTTCTCTTGCCTCAACTTGGTG
AT5G08290 YLS8 YELLOW-LEAF-SPECIFIC GENE 8 AAGATCAACTGGGCTCTCAAGG 141
TGGGAAGCTCGATTAGTAACGG
AT3G02470 SAMDC S-ADENOSYLMETHIONINE DECARBOXYLASE TTGGTAAGTACTGTGGATCGCC 101
CTGCTAGATTCCCTCGTCCTTC
AT4G40030 HIS3.3 HISTONE 3.3 ACCTTTGTGCCATTCATGCC 78
GTTCACCTCTGATACGACGAGC

The target genes AGP6, AGP11 and JAGGER and the respective qPCR primers were previously published [14,37] (Table S2). The specificity of the primers was confirmed by a conventional PCR and electrophoresis on 1% (w/v) agarose gel. The amplified products were purified using the GeneJET PCR Purification Kit (Thermo Fisher Scientific, Waltham, MA, USA) and sequenced by Eurofins Genomics (Ebersberg, Germany) to confirm the identity of the PCR product.

2.3. Sample Collection, RNA Isolation and cDNA Synthesis

A total of 33 samples for RNA extraction were collected from five-week-old plants, representing 11 tissues from three biological samples. Samples were independently prepared and divided into two experimental sets: flower development and genotype. The flower development group contained three biological replicates of seven different Col-0 reproductive structures, at different developmental stages according to [38]: flowers stage 1 to 6—at which flower primordium is formed; flowers stage 7 to 12—when both male and female gametophytes develop; flowers stage 13 to 14—during which double fertilisation occurs; flowers stage 15 to 16—when the zygote starts to develop within the seed; pistils from stage 12 flowers—as an example of a female tissue containing mature ovules; anthers from stage 12 flowers—as an example of a male tissue containing mature pollen grains; and siliques from stage 17—harbouring mature seeds, as an example of a post-fertilisation tissue [38,39]. Together, these corresponded to a total of 21 samples (Figure S1). The genotype set included three biological replicates of inflorescences—the most commonly used sample type in plant reproduction when confirming the expression of a mutated gene—from wt Col-0, wt No-0, agp6 agp11 and jagger, totalling 12 samples. Samples were immediately frozen in liquid nitrogen and stored at −80 °C for follow-up experiments. All images from the different stages of flower development and tissues of A. thaliana used in this study were acquired by a SMZ168 Stereo Zoom microscope (Motic, Barcelona, Spain) and images were captured using a Moticam 2500 (Motic, Barcelona, Spain) camera and the Motic Images Plus 2.0 (Motic) software. Total RNA was extracted using the RNeasy Plant Mini Kit (QIAGEN, Manchester, UK) as per the manufacturer’s protocol. RNA purity and concentration were measured using a spectrophotometer (DS-11 Series Spectrophotometer/Fluorometer, DeNovix, Wilmington, DE, USA). Only RNA samples with absorption ratios of 1.8–2.1 at 260/280 nm and around 2.0 for 260/230 nm were used for further analysis. RNA integrity was evaluated by checking the presence of the 25S and 18S ribosomal RNAs bands in a 1% (w/v) agarose gel electrophoresis. Following the manufacturer’s instructions, 150 ng or 1 μg of total RNA from reproductive structures or inflorescences, respectively, was treated with DNase I, RNase-free (Thermo Fisher Scientific, Waltham, MA, USA). cDNA was synthesized using SuperScript™ III First-Strand Synthesis System (Invitrogen, Waltham, MA, USA) and oligo(dT)20 primers to initiate the reactions, according to the manufacturer’s guidelines. The cDNA products of reproductive tissues and inflorescences were diluted at 1.25 ng/μL and 4 ng/μL, respectively, with nuclease-free water before qPCR.

2.4. qPCR Analysis

qPCR reactions were performed in a 10 µL final volume containing 5 µL of 2× SsoAdvancedTM Universal SYBR® Green Supermix (Bio-Rad, Hercules, CA, USA), 0.125 µL of each specific primer pair at 250 nM, 0.75 µL of nuclease-free water and 4 µL of diluted cDNA template. The reactions were performed in 96-well plates and run in a CFX96 Real-Time System (Bio-Rad, USA) with the following cycling conditions: initial denaturation at 95 °C for 30 s, followed by 40 cycles of 95 °C for 15 s, and 60 °C for 30 s, and any additional data acquisition step of 15 s at the optimal acquisition temperature. All reactions were run in three technical replicates and all assays included non-template controls (NTCs). Using three points of a tenfold dilution series (1:10, 1:100 and 1:1000) from pooled cDNA (wt inflorescences and siliques), a standard curve was generated to estimate the PCR efficiency of each primer pair using CFX Maestro software v. 2.0 (Bio-Rad, USA). The slope and the coefficient of determination (R2) were obtained from an equation of the linear regression line and the amplification efficiency (E) was calculated according to the formula E = (10−1/slope − 1) × 100%. The R2 value should be higher than 0.980 with the E value between 90% and 110%. After completion of the amplification reaction, melt curves were generated by increasing the temperature from 65 to 95 °C with fluorescence readings acquired at 0.5 °C increments. From the melt curve, the optimal temperature for data acquisition (3 °C below the melting temperature of the specific PCR product) was determined and the specificity of primers was confirmed. The sample maximization method was employed as the run layout strategy, in which all samples for each defined set were analysed in the same run and, thus, different genes were analysed in distinct runs [20]. The quantitative cycle (Cq), baseline correction, and threshold setting were automatically calculated by the CFX Maestro software v. 2.0 (Bio-Rad, Hercules, CA, USA). The products of qPCR were verified through 1% (w/v) agarose gels.

2.5. Expression Stability Analysis of Candidate Reference Genes

The mean Cq of ten potential reference genes in all 33 samples were introduced in the online software RefFinder (https://www.heartcure.com.au/reffinder/, accessed on 30 November 2021; [29]) to evaluate the gene expression stability. By integrating four different statistical algorithms, namely geNorm [19], NormFinder [30], BestKeeper [31] and the comparative ΔCt method [32], the software analyses the ranking of each algorithm for each gene and engenders an overall final ranking list of reference genes according to their stability. The geNorm algorithm calculates the expression stability value (M) of candidate reference genes, considering the average pairwise variation of each gene with all other control genes. A small M value indicates a more stable performance of the gene. The geNorm programme also calculates the pairwise variation (Vn/Vn+1, n represents the number of reference genes) to determine the optimal number of reference genes necessary for precise qPCR data normalisation. A Vn/Vn+1 value below 0.15 indicates that n is appropriate to normalise data and there is no need to include an additional reference gene [19]. NormFinder entails an ANOVA-based model to assess inter and intra-group variation, and the most stable gene possesses the lowest stability value [30]. As for BestKeeper, the programme investigates the candidate genes stability based on the standard deviation (SD) and coefficient of variation (CV) of the Cq values in a sample pool. The lower the SD ± CV, the more stable is the gene [31]. Finally, the comparative ΔCt method uses the SD to estimate the stability of all reference genes, with the most stable one having a lower SD [32]. Furthermore, RefFinder produces a comprehensive ranking of the expression stability of the candidate reference genes in the four different programs by calculating the geometric mean of their weights for the overall final ranking [29].

2.6. Validation of Reference Genes by Expression Analysis of AGP Genes

The reliability of the reference genes was validated using three target genes, namely AGP6, AGP11 and JAGGER. The expression levels of the target genes were quantified in all samples using the three most stable, the two most stable and the two least stable reference genes. The qPCR reactions were conducted as described above. The relative gene expression was calculated using the 2−ΔΔCt method [40]. Data were statistically treated using GraphPad Prism 8 software (www.graphpad.com, accessed on 15 December 2021). For each analysis, relative expression differences were compared using a two-way ANOVA followed by Dunnett’s multiple comparisons test. Statistical significance was considered at α = 0.05.

3. Results

3.1. Selection of Reference Genes

To identify the best reference genes for qPCR normalisation in gene expression studies regarding reproductive tissues, ten candidate reference genes (UBC9, ACT7, GAPC-2, RCE1, PP2AA3, TUA2, SAC52, YLS8, SAMDC and HIS3.3) were selected, based on previous reports of qPCR studies in plants [27,41,42,43,44,45,46,47]. The selected genes represent distinct biological pathways to avoid co-regulation. Involved in post-translational modifications, UBC9 is necessary for SUMOylation [48], PP2AA3 participates in phosphorylation [49] and RCE1 performs neddylation [50]. Other reference genes are constituents of the cytoskeleton [51] and microtubules [52], such as ACT7 and TUA2. Part of metabolic pathways, GAPC-2 is implicated in glycolysis [53] and SAMDC is part of the polyamine biosynthesis pathway [54]. Finally, chosen reference genes comprise ribosomal and nuclear proteins involved in DNA replication (YLS8) [55], gene regulation (HIS3.3) [56], and translation regulation (SAC52) [57].

The biological processes mentioned above are considered fundamental for the normal function of a cell, thus they should be highly expressed in all cells. Nonetheless, to confirm that the ten candidate reference genes were highly expressed on the reproductive tissues used in this study, we analysed their expression levels in the transcriptomic database EVOREPRO [33] (Table S1). Overall, the selected genes presented high expression values in the different tissues analysed.

3.2. PCR Amplification Efficiency and Specificity

The primers of each reference gene were tested in a conventional PCR and the amplicon lengths were checked in a 1% (w/v) agarose gel, which showed one single band with the expected fragment sizes (72–141 bp) (Table 1) and without primer dimers or any impurities. The amplified PCR products were sequenced to confirm the identity of the PCR amplicon. Standard curves for each primer pair were generated to confirm the specificity of primers. All products exhibited only a single amplification peak in the melt curve representative of a single product amplification (Figure S2). The R2 of the standard curves ranged from 0.989 for SAMDC to 1.000 for UBC9 (Table 2), demonstrating the linearity of the Cq values with the logarithmic of the starting quantity. The amplification E varied from 90% for YLS8 to 107.5% for SAMDC (Table 2).

Table 2.

Amplification efficiencies, correlation coefficients (R2), slope and melting temperature of qPCR primers of ten candidate reference genes.

Gene Symbol Efficiency (%) R2 Slope Melting Temperature (°C)
UBC9 91.2 1 −3.553 82.5
ACT7 105.6 0.997 −3.194 79
GAPC-2 93.7 0.999 −3.483 81.5
RCE1 96.6 0.999 −3.406 81
TUA2 104.4 0.999 −3.221 80.5
PP2AA3 100.3 0.998 −3.314 81.5
SAC52 96.8 0.999 −3.402 81.5
YLS8 90 0.996 −3.587 82.5
SAMDC 107.5 0.989 −3.155 82.5
HIS3.3 101.2 0.992 −3.293 81.5

3.3. Cq Value Distribution of the Candidate Reference Genes

The distribution of Cq values obtained in qPCR data of the ten candidate reference genes is shown in the box plots (Figure 1). The Cq values ranged from 19.22 to 27.66 in the flower development set (Figure 1A), and from 17.67 to 25.89 in the genotype set (Figure 1B). This demonstrates the narrow range of gene expression level across all samples. As the transcript levels are negatively correlated with Cq values, SAMDC revealed the highest expression, having the lowest mean Cq values in the flower development (19.22) and genotype (17.67) sets. GAPC-2, TUA2 and SAC52 displayed high expression in both biological sets. Regarding flower development set (Figure 1A), the median Cq values were 21.13, 21.64 and 21.68, respectively. In the genotype set, GAPC-2, TUA2 and SAC52 exhibited median Cq values of 18.74, 19.33 and 19.05, respectively (Figure 1B). On the other hand, PP2AA3 had the lowest relative expression both for flower development (mean Cq value of 25.55) and genotype set (mean Cq value of 23.14).

Figure 1.

Figure 1

Distribution of Cq values obtained from the ten candidate reference genes. (A) Cq values of the ten candidate reference genes in the flower development group which included 21 samples corresponding to flower (st 1–16), silique (st 17), pistil (st 12), and anther (st 12) samples. (B) Cq values of ten candidate reference genes in the genotype set that comprised 12 samples corresponding to wt Col-0, jagger, wt No-0 and agp6 agp11 samples. The solid line within each box represents the median Cq values and the boxes denote the 1st and 3rd quartiles.

3.4. Expression Stability Ranking of the Candidate Reference Genes

The analysis of the expression stability levels of the ten candidate reference genes was carried out using the RefFinder [29]. This tool integrates four different algorithms to calculate the stability levels of reference genes: geNorm [19], NormFinder [30], BestKeeper [31] and the comparative ΔCt method [32]. A top-ranking table of the most stable reference genes for each set of samples according to each statistical program is on Table S3. The analysis was performed in the two experimental sets, flower development and genotype, which included all 21 and 12 samples, respectively. Additionally, specific subsets of the flower development set were also analysed to study in more detailed tissues and developmental stages such as flower (st 1–16), that included flower st 1–6, flower st 7–12, flower st 13–14 and flower st 15–16, silique (st 17), pistil (st 12) and anther (st 12). Similarly, two subsets of the genotype set that represent different A. thaliana ecotypes were also analysed, namely wt Col-0 vs. jagger and wt No-0 vs. agp6 agp11.

In the geNorm analysis, the expression stability of the ten candidate reference genes was assessed by calculating the M value in the RefFinder tool (Figure 2). The M value is the mean variation of a gene relative to all other genes. The lower the M value, the more stable is the gene [19]. The ten reference genes across all experimental sets had M values below 0.8, suggesting that these genes were stable across all samples (Figure 2).

Figure 2.

Figure 2

Expression stability values (M) of the ten candidate reference genes calculated by geNorm in the RefFinder software. (A) M values of the ten candidate reference genes in the flower development group which included 21 samples corresponding to flower (st 1–16), silique (st 17), pistil (st 12), and anther (st 12) samples. (B) M values of the ten candidate reference genes in 12 flower (st 1–16) samples which included flower st 1–6, flower st 7–12, flower st 13–14, and flower st 15–16 samples. (C) M values of the ten candidate reference genes in the three silique (st 17) samples. (D) M values of the ten candidate reference genes in the three pistil (st 12) samples. (E) M values of the ten candidate reference genes in the three anther (st 12) samples. (F) M values of the ten candidate reference genes in the genotype set that comprised 12 samples corresponding to wt Col-0, jagger, wt No-0 and agp6 agp11 samples. (G) M values of the ten candidate reference genes in six wt Col-0 vs. jagger samples that included three wt Col-0 and three jagger samples. (H) M values of the ten candidate reference genes in six wt No-0 vs. agp6 agp11 samples which included three wt No-0 and three agp6 agp11 samples. The genes are arranged from the most to the least stable gene (from left to right). Abbreviations: Col-0, Columbia-0; No-0, Nossen-0; st, stage; wt, wild-type.

For the flower development set, TUA2 and RCE1 were the two most stable genes with a M value of 0.44, whilst SAMDC (0.74) was the least stable gene (Figure 2A). YLS8 and PP2AA3 (0.39) ranked the highest stability in flower (st 1–16) samples (Figure 2B), while TUA2, YLS8, PP2AA3, SAC52, HIS3.3 and ACT7 (0) were the most stable combination in silique (st 17) samples (Figure 2C). TUA2, RCE1, YLS8 and HIS3.3 (0) were the most stable genes in pistil samples (Figure 2D) and, when anther samples were considered, TUA2, RCE1, UBC9, YLS8, SAC52, SAMDC and ACT7 (0) were ranked as the most stable genes (Figure 2E). In contrast, UBC9 was the least stable gene in flower (st 1–16) (Figure 2B) and pistil (st 12) (Figure 2D) subsets, with a M value of 0.61 and 0.43, respectively. GAPC-2 was the least stable gene in silique (st 17) (Figure 2C) and anther (st 12) (Figure 2E) subsets, with a M value of 0.39 and 0.27, respectively (Figure 2A). YLS8 was one of the most stable genes across all subsets (Figure 2A).

In the genotype set, HIS3.3 and ACT7 were the two most stable genes with the lowest M value of 0.39, while GAPC-2 (0.56) was the least stably expressed gene (Figure 2F). In addition, HIS3.3 and SAMDC (0) were the most suitable genes in wt Col-0 vs. jagger samples (Figure 2G), whilst HIS3.3, YLS8 and GAPC-2 (0) were identified as the most stable reference genes in wt No-0 vs. agp6 agp11 samples (Figure 2H). GAPC-2 (0.57) and SAMDC (0.47) were the least stable genes in wt Col-0 vs. jagger (Figure 2G) and wt No-0 vs. agp6 agp11 (Figure 2H) subsets, respectively.

geNorm also calculates the optimal number of reference genes essential for accurate qPCR normalisation by calculating the pairwise variation (Vn/Vn+1, n represents the number of reference genes). For a Vn/Vn+1 value below 0.15, no additional reference gene is required to be included in the analysis [19]. All combinations of genes presented a V2/V3 below 0.15 in both sets and all subsets, indicating that two reference genes are adequate for normalisation of these datasets (Figure 3).

Figure 3.

Figure 3

Pairwise variation (Vn/Vn+1) of the ten candidate reference genes using geNorm. (A) Pairwise variation values of the ten candidate reference genes in the flower development group which included 21 samples corresponding to flower (st 1–16), silique (st 17), pistil (st 12), and anther (st 12) samples. (B) Pairwise variation values of the ten candidate reference genes in 12 flower (st 1–16) samples which included flower st 1–6, flower st 7–12, flower st 13–14, and flower st 15–16 samples. (C) Pairwise variation values of the ten candidate reference genes in the three silique (st 17) samples. (D) Pairwise variation values of the ten candidate reference genes in the three pistil (st 12) samples. (E) Pairwise variation values of the ten candidate reference genes in the three anther (st 12) samples. (F) Pairwise variation values of the ten candidate reference genes in the genotype set that comprised 12 samples corresponding to wt Col-0, jagger, wt No-0 and agp6 agp11 samples. (G) Pairwise variation values of the ten candidate reference genes in six wt Col-0 vs. jagger samples that included three wt Col-0 and three jagger samples. (H) Pairwise variation values of the ten candidate reference genes in six wt No-0 vs. agp6 agp11 samples which included three wt No-0 and three agp6 agp11 samples. The pointed line represents the cut-off value of 0.15. Abbreviations: Col-0, Columbia-0; No-0, Nossen-0; st, stage; wt, wild-type.

3.5. NormFinder

The expression stability values were calculated by NormFinder in the RefFinder software (Figure 4). The expression stability value is based on inter and intra-group variations and the lowest value indicates a more stable gene [30].

Figure 4.

Figure 4

Expression stability values of the ten candidate reference genes calculated by NormFinder in the RefFinder software. (A) Expression stability values of the ten candidate reference genes in the flower development group which included 21 samples corresponding to flower (st 1–16), silique (st 17), pistil (st 12), and anther (st 12) samples. (B) Expression stability values of the ten candidate reference genes in 12 flower (st 1–16) samples which included flower st 1–6, flower st 7–12, flower st 13–14, and flower st 15–16 samples. (C) Expression stability values of the ten candidate reference genes in the three silique (st 17) samples. (D) Expression stability values of the ten candidate reference genes in the three pistil (st 12) samples. (E) Expression stability values of the ten candidate reference genes in the three anther (st 12) samples. (F) Expression stability values of the ten candidate reference genes in the genotype set that comprised 12 samples corresponding to wt Col-0, jagger, wt No-0 and agp6 agp11 samples. (G) Expression stability values of the ten candidate reference genes in six wt Col-0 vs. jagger samples that included three wt Col-0 and three jagger samples. (H) Expression stability values of the ten candidate reference genes in six wt No-0 vs. agp6 agp11 samples which included three wt No-0 and three agp6 agp11 samples. The genes are arranged from the most to the least stable gene (from left to right). Abbreviations: Col-0, Columbia-0; No-0, Nossen-0; st, stage; wt, wild-type.

Among the flower development set, RCE1 and SAC52 were the top ranked genes with the lowest stability values of 0.32 and 0.36, respectively, while SAMDC (0.80) was the least stable gene (Figure 4A). YLS8 (0.27) and RCE1 (0.31) ranked the highest in flower (st 1–16) samples (Figure 4B), while SAC52, YLS8, TUA2, ACT7, HIS3.3 and PP2AA3 (0.12) were identified as the best reference genes in silique (st 17) samples (Figure 4C). Meanwhile, RCE1, SAC52, YLS8, TUA2 and SAMDC ranked highest in both pistil (st 12) (Figure 4D) and anther (st 12) (Figure 4E) subsets, with a stability value of 0.30 and 0.17, respectively (Figure 4A). Similarly, HIS3.3, PP2AA3, and GAPC-2 (0.30) were also the most stable genes in pistil (st 12) samples (Figure 4D), while ACT7 and UBC9 (0.17) were top ranked genes in anther (st 12) samples (Figure 4E). In contrast, UBC9 (0.63) was the most unstable gene in flower (st 1–16) (Figure 4B), while GAPC-2 (0.62) was the least stable gene in silique (st 17) samples (Figure 4C). UBC9 and ACT7 (0.54) were the least stable genes in the pistil (st 12) subset (Figure 4D), while GAPC-2, PP2AA3 and HIS3.3 (0.44) were the least stable genes in the anther (st 12) subset (Figure 4E).

Additionally, YLS8 and HIS3.3 were the two most stable reference genes in the genotype set, with the lowest stability values of 0.25 and 0.29, respectively, whilst GAPC-2 was the most unstable gene with the highest expression stability value of 0.50 (Figure 4F). HIS3.3 and SAMDC (0.25) were the most stable genes in wt Col-0 vs. jagger samples (Figure 4G), while HIS3.3, YLS8 and GAPC-2 (0.23) were the three most stable genes in wt No-0 vs. agp6 agp11 samples (Figure 4H). GAPC-2 (0.64) was the least stable gene in wt Col-0 vs. jagger subset (Figure 4G), and as for wt No-0 vs. agp6 agp11 subset, SAMDC (0.50) was the least stable gene (Figure 4H).

3.6. BestKeeper

BestKeeper programme was used to calculate the expression stability value by computing the SD of the mean Cq values (Figure 5). A lower SD reflects a more stable reference gene [31].

Figure 5.

Figure 5

Standard deviation (SD) of the Cq values of ten candidate reference genes calculated by BestKeeper in the RefFinder software. (A) SD values of the ten candidate reference genes in the flower development group which included 21 samples corresponding to flower (st 1–16), silique (st 17), pistil (st 12), and anther (st 12) samples. (B) SD values of the ten candidate reference genes in 12 flower (st 1–16) samples which included flower st 1–6, flower st 7–12, flower st 13–14, and flower st 15–16 samples. (C) SD values of the ten candidate reference genes in the three silique (st 17) samples. (D) SD values of the ten candidate reference genes in the three pistil (st 12) samples. (E) SD values of the ten candidate reference genes in the three anther (st 12) samples. (F) SD values of the ten candidate reference genes in the genotype set that comprised 12 samples corresponding to wt Col-0, jagger, wt No-0 and agp6 agp11 samples. (G) SD values of the ten candidate reference genes in six wt Col-0 vs. jagger samples that included three wt Col-0 and three jagger samples. (H) SD values of ten candidate reference genes in six wt No-0 vs. agp6 agp11 samples which included three wt No-0 and three agp6 agp11 samples. The genes are arranged from the most to the least stable gene (from left to right). Abbreviations: Col-0, Columbia-0; No-0, Nossen-0; st, stage; wt, wild-type.

In the flower development set, BestKeeper inferred that UBC9 and GAPC-2 were the most stable reference genes, with a SD value of 0.52 and 0.57, respectively, while SAMDC (1.02) was the least stable gene (Figure 5A). GAPC-2 (0.33) and UBC9 (0.56) were the most stable genes in flower (st 1–16) samples (Figure 5B), whilst UBC9 and RCE1 (0) were the most stable genes in silique (st 17) samples (Figure 5C). UBC9 (0.44) was the most stable gene in pistil (st 12) samples (Figure 5D) and, together with RCE1, TUA2, SAC52, YLS8, SAMDC and ACT7 (0) were found to be the most stable genes in anther (st 12) samples (Figure 5E). TUA2 (0.96) was the worst gene in flower (st 1–16) (Figure 5B), while GAPC-2 (0.67) was the least stable gene in silique (st 17) samples (Figure 5C). ACT7 (1.11) was the least stable gene in the pistil (st 12) subset (Figure 5D), while GAPC-2, PP2AA3 and HIS3.3 (0.44) were the least stable genes in the anther (st 12) subset (Figure 5E).

UBC9 and RCE1 were the most stable genes in the genotype set, with the lowest SD values of 0.65 and 0.75, respectively, while SAC52 (1.11) was the least stable gene (Figure 5F). The most stable genes in wt Col-0 vs. jagger samples were UBC9 (0.56) and GAPC-2 (0.67) (Figure 5G), and for wt No-0 vs. agp6 agp11 samples the programme identified YLS8, GAPC-2 and HIS3.3 (0.28) as the most stable ones (Figure 5H). SAC52 (1.22) was the least stable gene in wt Col-0 vs. jagger subset (Figure 5G), while SAC52 and SAMDC (0.67) were the least stable genes in wt No-0 vs. agp6 agp11 subset (Figure 5H).

3.7. ΔCt Method

The comparative ΔCt method calculates the average of SD to determine the expression stability of the reference genes (Figure 6). The most stable gene has the lower SD value [32].

Figure 6.

Figure 6

Average standard deviation (SD) of the ten candidate reference genes calculated by the ΔCt in the RefFinder software. (A) SD values of the ten candidate reference genes in the flower development group which included 21 samples corresponding to flower (st 1–16), silique (st 17), pistil (st 12), and anther (st 12) samples. (B) SD values of the ten candidate reference genes in 12 flower (st 1–16) samples which included flower st 1–6, flower st 7–12, flower st 13–14, and flower st 15–16 samples. (C) SD values of the ten candidate reference genes in the three silique (st 17) samples. (D) SD values of the ten candidate reference genes in the three pistil (st 12) samples. (E) SD values of the ten candidate reference genes in the three anther (st 12) samples. (F) SD values of the ten candidate reference genes in the genotype set that comprised 12 samples corresponding to wt Col-0, jagger, wt No-0 and agp6 agp11 samples. (G) SD values of the ten candidate reference genes in six wt Col-0 vs. jagger samples that included three wt Col-0 and three jagger samples. (H) SD values of ten candidate reference genes in six wt No-0 vs. agp6 agp11 samples which included three wt No-0 and three agp6 agp11 samples. The genes are arranged from the most to the least stable gene (from left to right). Abbreviations: Col-0, Columbia-0; No-0, Nossen-0; st, stage; wt, wild-type.

Among the flower development group, RCE1 and SAC52 were the top two ranked genes, with an average SD of 0.63 and 0.64, while SAMDC (0.92) was the least stable gene (Figure 6A). YLS8 (0.52) and RCE1 (0.54) were the most stable genes in flower (st 1–16) samples (Figure 6B), while YLS8, SAC52, TUA2, HIS3.3, PP2AA3 and ACT7 (0.26) were the most stable genes in silique (st 17) samples (Figure 6C). YLS8, SAC52, TUA2, HIS3.3, PP2AA3, GAPC-2, RCE1 and SAMDC (0.38) were the most stable genes in pistil (st 12) samples (Figure 6D), whilst YLS8, SAC52, TUA2, RCE1, SAMDC, ACT7 and UBC9 (0.19) were the most stable genes in anther (st 12) samples (Figure 6E). UBC9 (0.75) was the worst gene in flower (st 1–16), while GAPC-2 (0.67) was the least stable gene in silique (st 17) samples (Figure 6C). UBC9 and ACT7 (0.62) were the least stable genes in the pistil (st 12) subset (Figure 6D), while GAPC-2, PP2AA3 and HIS3.3 (0.45) were the least stable genes in the anther (st 12) subset (Figure 6E).

YLS8 and HIS3.3 were the most stable genes in the genotype set, with the expression stability value of 0.48 and 0.50, respectively, while GAPC-2 (0.62) was the most unstable one (Figure 6F). HIS3.3 and SAMDC (0.47) were the most stable genes in wt Col-0 vs. jagger samples (Figure 6G), while YLS8, GAPC-2 and HIS3.3 (0.37) the most stable genes in wt No-0 vs. agp6 agp11 samples (Figure 6H). GAPC-2 (0.73) was the least stable gene in wt Col-0 vs. jagger subset (Figure 6G), while SAMDC (0.59) was the most unstable gene in wt No-0 vs. agp6 agp11 subset (Figure 6H).

3.8. Comprehensive Ranking of the Candidate Reference Genes

Finally, the RefFinder software also performs a comprehensive gene stability analysis by ranking the reference genes according to the geometric mean of the ranking values obtained for each of the four different programmes (geNorm, NormFinder, BestKeeper and ΔCt) (Figure 7).

Figure 7.

Figure 7

Comprehensive ranking values of the candidate reference genes obtained from geNorm, NormFinder, BestKeeper and ΔCt. (A) Ranking values of the ten candidate reference genes in the flower development group which included 21 samples corresponding to flower (st 1–16), silique (st 17), pistil (st 12), and anther (st 12) samples. (B) Ranking values of the ten candidate reference genes in 12 flower (st 1–16) samples which included flower st 1-6, flower st 7–12, flower st 13–14 and flower st 15–16 samples. (C) Ranking values of the ten candidate reference genes in the three silique (st 17) samples. (D) Ranking values of the ten candidate reference genes in thethree pistil (st 12) samples. (E) Ranking values of the ten candidate reference genes in the three anther (st 12) samples. (F) Ranking values of ten candidate reference genes in the genotype set that comprised 12 samples corresponding to wt Col-0, jagger, wt No-0 and agp6 agp11 samples. (G) Ranking values of the ten candidate reference genes in six wt Col-0 vs. jagger samples that included three wt Col-0 and three jagger samples. (H) Ranking values of the ten candidate reference genes in six wt No-0 vs. agp6 agp11 samples which included three wt No-0 and three agp6 agp11 samples. The genes are arranged from the most to the least stable gene (from left to right). Abbreviations: Col-0, Columbia-0; No-0, Nossen-0; st, stage; wt, wild-type.

According to the analysis, RCE1 (1.50), SAC52 (3.13) and TUA2 (3.46) were the most stable genes in the flower development set, while SAMDC (10.00) was the most unstable gene (Figure 7A). YLS8 (1.50), RCE1 (2.91) and PP2AA3 (3.46) were the top 3 ranked genes in the flower (st 1–16) subset (Figure 7B), while TUA2 (1.86), PP2AA3 (3.31) and HIS3.3 (1.86) were the most stable genes in silique (st 17) samples (Figure 7C). As for pistil samples, the best option of reference genes was RCE1 (2.11) and GAPC-2 (2.55) (Figure 7D), while UBC9 (1.32) and RCE1 (2.78) were the most stable genes in anther (st 12) subgroup (Figure 7E). TUA2 (7.04) was the least stable gene in the flower (st 1–16) samples (Figure 7B), and GAPC-2 (10) was more unstable in silique (st 17) subgroup (Figure 7C). ACT7 (9.74) was the most unstable gene in pistil (st 12) samples (Figure 7D), while HIS3.3 (9.46) was the least stable gene in anther (st 12) subset (Figure 7E).

Among the genotype set, YLS8 (1.73), HIS3.3 (2.45) and ACT7 (2.91) were the most stable genes, while GAPC-2 (9.15) was the most unstable gene (Figure 7F). HIS3.3 (1.68) and SAMDC (2.30) were the most stable genes in wt Col-0 vs. jagger samples (Figure 7G), while YLS8 (1.00) and GAPC-2 (2.21) were the most stable genes in wt No-0 vs. agp6 agp11 samples (Figure 7H). SAC52 (9.24) was the least stable gene in wt Col-0 vs. jagger subset (Figure 7G), while SAMDC (10.00) was the most unstable gene in wt No-0 vs. agp6 agp11 subset (Figure 7H).

3.9. Validation of the Selected Reference Genes

In this study, to validate the reference genes, the relative expression levels of three target genes, AGP6, AGP11 and JAGGER were quantified and normalised using the three most stable, the two most stable and two least stable reference genes for both experimental sets (Figure 8).

Figure 8.

Figure 8

Relative expression levels of AGP6, AGP11 and JAGGER normalised by the three most stable reference genes (green bars), the two most stable reference genes (orange bars) and the two least stable reference genes (red bars) combinations. Relative expression levels of AGP6 (A), AGP11 (B) and JAGGER (C) in the flower development subsets, namely flower (st 1–6), flower (st 7–12), flower (st 13–14), flower (st 15–16), anther (st 12), pistil (st 12) and silique (st 17). The data correspond to the ratio of the expression compared with the silique (st 17). Relative expression levels of AGP6 (D) and AGP11 (E) in the wt No-0 vs. agp6 agp11 subset and JAGGER (F) in the wt Col-0 vs. jagger subset. The data correspond to the ratio of the expression compared with the wt No-0 for AGP6 and AGP11 or wt Col-0 for JAGGER. Error bars represent the standard error of the mean of three independent biological replicates, each with three technical replicates. Statistical analyses were performed using a two-way ANOVA followed by Dunnett’s multiple comparisons test. Asterisks represent statistically significant differences (α < 0.05) between the three different combinations of reference genes in each sample. Abbreviations: Col-0, Columbia-0; No-0, Nossen-0; st, stage; wt, wild-type.

Regarding the flower development subsets, the results showed that similar to previous phenotypic and expression pattern studies, the AGP6 and AGP11 gene expression level was higher in samples containing male structures (Figure 8A and B, respectively). Concomitantly, the JAGGER expression level was higher on samples which included female structures (Figure 8C). The analysis showed that when the three most stable genes (RCE1, SAC52 and TUA2) were employed for AGP6, AGP11 and JAGGER normalisation, statistically significant differences were detected on the expression pattern of at least one of the subsets when compared to the normalisation with the two least stable reference genes (HIS3.3 and SAMDC) (Figure 8A, B and C, respectively). Moreover, the use of two most stable genes (RCE1, SAC52) for AGP6 normalisation on anthers (st 12) presented statistically significant differences to the use of three most stable genes (Figure 8A). These findings suggest that the use of reliable reference genes is important for an accurate normalisation of target genes for reproductive tissues. Regarding the expression of AGPs in the respective mutant backgrounds, as foreseeable, AGP6 and AGP11 were downregulated in agp6 agp11 mutants compared to wt No-0 (Figure 8D and 8E, respectively). Likewise, the expression of JAGGER was downregulated in the jagger mutants (Figure 8F). However, no differences were detected when the three different gene combinations were used for normalisation, indicating that any of these genes may be used for normalisation in expression analysis studies on the genotype set.

4. Discussion

In gene expression studies, qPCR remains the most reliable method to quantify the abundance of a target gene. A key step in this technique is the normalisation of samples using appropriate reference genes as internal controls to correct the variability of RNA extraction and reverse-transcription yield and efficiency of amplification, thus allowing the comparison between different samples leading to accurate conclusions [16]. Reference genes are genes stably expressed in all samples in a given study, unaffected by experimental factors and with the same kinetics as the target genes during a qPCR [16,19,20]. Traditionally, reference genes are metabolic genes, involved in processes essential for the survival of cells such as carbon metabolism, cellular structure maintenance and protein translation, that are ubiquitously expressed in a stable and nonregulated constant level, such as actin, tubulin, GAPDH, cyclophilin, elongation factor 1α or ubiquitin [15,58,59]. However, previous studies, with both animal and plant organisms, evidenced that traditional reference genes may not be stably expressed between cell types and within cells under different conditions [24,25,26,28,59,60,61,62,63,64]. Therefore, it is important to select appropriate reference genes under specific experimental conditions.

The most universally accepted and appropriated method is to normalise against three or more validated reference genes [19,65]. Vandesompele [19] showed that normalisation with a single reference gene resulted in a inaccurate normalisation process with errors up to 3.0- and 6.4-fold in 25% and 10% of the results, respectively. Additionally, Guénin [66] showed that only 3.2% of 188 papers published in the three leading plant science journals had reference genes correctly validated in the same study or in a previous study whereas in the other 96.8% of publications, the genes were merely putatively stably expressed. Unfortunately, regardless of the increased awareness for the importance of the process of selection of the optimal number and validation of reference genes, nowadays, there is still a huge quantity of publications with qPCR experiments normalised using a single reference gene. A pilot experiment with representative samples should be performed to select stably expressed reference genes. Nevertheless, the expression stability of the selected reference genes must be evaluated in the final experiment [65,67]. In fact, the publication of the Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) guidelines was an attempt to guarantee and encourage the integrity, consistency and transparency of qPCR experiments, leading to more reliable, comparable, and unambiguous results [16]. However, Bustin [68] even the enrolled two surveys covering 1700 publications with qPCR experiments that still exposed a lack of transparency on reporting essential technical and quality-control information, leading to inaccurate biological results.

In the plant reproduction field, qPCR is a widely performed technique, using templates for biological samples from different flower structures and/or developmental stages. However, there is still a literature gap concerning reference gene validation for these types of biological samples. We are aware that different reproductive structures involve specific developmental processes, which, in turn, require dynamical expression patterns [69,70,71]. These distinct expression profiles elevate the importance of choosing and validating the reference genes that better suit the biological groups under analysis. To our knowledge, in the A. thaliana, refs. [27,60,63,72] are the only studies to appropriate validate candidate reference genes for qPCR analysis in heat stress, various conditions (such as developmental series, shoot and root abiotic stress series, biotic stress series, photomorphogenic light series, and hormone series), metal exposure and seed samples.

In the present study, ten candidate reference genes (UBC9, ACT7, GAPC-2, RCE1, PP2AA3, TUA2, SAC52, YLS8, SAMDC and HIS3.3) were selected for fu rther validation in several biological samples containing different flower structures and stages and for a comparison between genotypes. To the best of our knowledge, this is the first analysis to select and validate suitable reference genes for expression analysis on reproductive tissues of A. thaliana. For the ranking of the best reference genes, four statistical algorithms (geNorm, NormFinder, BestKeeper and ΔCt method) were used. Since the output information between the different software may not be consistent, we used RefFinder, which combines the four algorithms and gives a final output of the more stable reference genes [29].

According to RefFinder, which combines the four different software outcomes, the three most stable genes found were RCE1, SAC52 and TUA2 for flower development and YLS8, HIS3.3 and ACT7 for genotype set. It is worth noting that these two sets encompassed different developmental stages and/or tissues, showing a higher heterogeneity when compared to the subsets. Therefore, the most stable gene ranking of each subset is slightly different from the correspondent set: YLS8, RCE1, and PP2AA3 for flower (st 1–16) subset; TUA2, PP2AA3, and HIS3.3 for silique (st 17) subset; RCE1, GAPC-2 and TUA2 for pistil (st 12) samples; UBC9, RCE1, and SAMDC for anther (st 12) subset; HIS3.3, SAMDC, and YLS8 for wt Col-0 vs. jagger samples and finally, YLS8, GAPC-2, and HIS3.3 for wt No-0 vs. agp6 agp11 samples. From this analysis we can also inferred if a gene is stable in a specific organ or across a more variable group. The top-ranking genes for the flower development set and flower (st 1–16) subset would be more stably expressed across different tissues and developmental stages compared to the ones that only appeared when a specific organ, such as silique (st 17), pistil (st 12), or anther (st 12) was used. From the genotype set results, we can conclude that the most stable genes are not being affected by the absence of the three AGP genes. When several algorithms are employed in a stability analysis, the output can significantly vary due to different assumptions and computations. An integration of the information for different rankings may be difficult, as each software has its strengths, weaknesses, and suitable application conditions [73]. This may be done with complementary tools that merge all the results of different algorithms into a comprehensive ranking, such as RefFinder [29]. This tool calculates the geometric mean of the ranking values of the four programmes for one final overall ranking [29]. In RefFinder, the input is the raw Cq values, assuming for all genes a 100% PCR efficiency. Since the PCR efficiencies for each gene are not taken into account, the RefFinder outputs may be biased and have an impact on the expression stability ranking of the reference genes. It is the user’s responsibility to assure that the primer design is correct in order to obtain efficiencies that vary no more than 10% from the optimal 100% efficiency [73], as the ones we obtained in the present study.

In our study case, the differences between the underlying algorithms were minimal since both geNorm, NormFinder, and ΔCt identified at least the same gene as being the most stable one for each analysed situation. Only the ranking given by BestKeeper presented a different output, for instance, this algorithm identified UBC9 as an appropriate reference gene for flower (st 1–16) subset, while this gene was identified on the other software as one of the least stable ones. Previous studies have reported such disparities between BestKeeper and the other algorithms [74,75,76,77] and the reason might be associated with the algorithm configuration itself.

GeNorm algorithm is also able to define an optimal number of reference genes to be used for qPCR normalisation by calculating a pairwise variation value [19]. For all the analysis conducted, the V2/V3 were below the acceptable threshold value of 0.15, meaning that two of the ten candidate genes would be sufficient to accurately normalise our samples. This result was expected and shows the effectiveness of our experimental design, specifically in trying to avoid as much external variation that could affect the experiment, such as RNA/cDNA quality and concentration, primer design, and efficiency. Hence, the Cq values of the ten candidate genes did not show a wide variation whereby geNorm revealed the necessity of only two reference genes. Nevertheless, a visual interpretation of the pairwise variations can also be informative. In our case, the analysis suggests that both sets and subsets would benefit from using three reference genes for normalisation, since the V3/V4 is smaller than V2/V3.

Finally, in order to validate the selected reference genes for each situation, the expression levels of AGP6, AGP11 and JAGGER were analysed. These three genes were selected due to their expression patterns in the reproductive tissues: AGP6 and AGP11, which are present mainly in the male tissues [11,12,13], while JAGGER shows a higher expression in the female tissues [14]. Indeed, our results from the flower development set are in accordance with these expression patterns. However, the statistical analysis detected significant differences when different combinations of reference genes were applied to the tissues where AGP6, AGP11 and JAGGER are mostly expressed. These findings corroborate with the importance of selecting a reliable number of reference genes, particularly when different types of tissues are under the same gene expression analysis. The differences between the genotypes were less sensitive to the choice of the set of reference genes than the tissue-specific differences. The fact that choosing the two least stably expressed genes as reference genes yielded virtually identical results as choosing the three most stably expressed genes means that any combination of at least two of our ten candidate genes may be safely used as reference genes for comparisons across genotypes.

5. Conclusions

We have evaluated ten candidate reference genes to normalise gene expression using qPCR in different reproductive tissues in A. thaliana. The findings of this study, using geNorm, NormFinder, BestKeeper and ΔCt method on RefFinder tool, indicate that RCE1, SAC52 and TUA2 are appropriate reference genes for comparing gene expression across a set of flower development samples, whilst YLS8, HIS3.3 and ACT7 are a proper combination of reference genes for a genotype situation. For the first time, a study was conducted to assess the stability of candidate reference genes in different reproductive tissues in A. thaliana, providing a framework that will contribute to the consistency and accuracy of transcripts quantification. Indeed, these principles extend to any field of work and to any other candidates for reference genes. Furthermore, our results will enable researchers to save time and costs when performing gene expression studies with qPCR. Nevertheless, we recommend the re-validation of the reference genes whenever a new study is performed.

Supplementary Materials

The following are available online at https://www.mdpi.com/article/10.3390/biom13030463/s1, Figure S1: Stages of flower development and tissues of A. thaliana used in this study. Figure S2: Melt curves of ten candidate reference genes (UBC9, ACT7, GAPC-2, RCE1, PP2AA3, TUA2, SAC52, YLS8, SAMDC and HIS3.3) showing the specificity of qPCR amplification. Table S1: Expression values on EVOREPRO [33]. Table S2: List of target genes and primer sequences used to validate the reference genes. Table S3: List of the most stable reference genes for each set and subset of samples according to geNorm, NormFinder, BestKeeper, ΔCt method and RefFinder.

Author Contributions

M.J.F.: Conceptualisation, Validation, Formal analysis, Investigation, Writing—Original Draft, Visualisation, Funding acquisition. J.S.: Conceptualisation, Validation, Formal analysis, Investigation, Writing—Original Draft, Visualisation, Funding acquisition. S.C.P.: Validation, Writing—Review & Editing, Visualisation, Funding acquisition. S.C.: Writing—Review & Editing, Supervision, Funding acquisition. All authors have read and agreed to the published version of the manuscript.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All data are contained within the manuscript and Supplementary Materials.

Conflicts of Interest

The authors declare no conflict of interest.

Funding Statement

This work received financial support from PT national funds (FCT/MCTES, Fundação para a Ciência e Tecnologia and Ministério da Ciência, Tecnologia e Ensino Superior) through the project UIDB/50006/2020 and SeedWheels project POCI-01-0145-FEDER-027839. This research was supported by EU project 101086293—CRISPit, funded by HORIZON-TMA-MSCA-SE. M.J.F.’s research was supported by an FCT PhD grant, SFRH/BD/143579/2019. J.S. has received funding from “la Caixa” Foundation (ID 100010434), under the agreement LCF/BQ/DR20/11790010. S.C.P.’s research was supported by an FCT PhD grant, SFRH/BD/137304/2018.

Footnotes

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

References

  • 1.Lora J., Herrero M., Tucker M.R., Hormaza J.I. The Transition from Somatic to Germline Identity Shows Conserved and Specialized Features during Angiosperm Evolution. New Phytol. 2017;216:495–509. doi: 10.1111/nph.14330. [DOI] [PubMed] [Google Scholar]
  • 2.Ma H., Sundaresan V. Current Topics in Developmental Biology. Volume 91. Academic Press Inc.; Cambridge, MA, USA: 2010. Development of Flowering Plant Gametophytes; pp. 379–412. [DOI] [PubMed] [Google Scholar]
  • 3.Yadegari R., Drews G.N. Female Gametophyte Development. Plant Cell. 2004;16:S133–S141. doi: 10.1105/tpc.018192. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Hafidh S., Honys D. Reproduction Multitasking: The Male Gametophyte. Annu. Rev. Plant Biol. 2021;72:581–614. doi: 10.1146/annurev-arplant-080620-021907. [DOI] [PubMed] [Google Scholar]
  • 5.Maheshwari P. An Introduction to the Embryology of Angiosperms. 1st ed. McGraw-Hill; New York, NY, USA: 1950. [Google Scholar]
  • 6.Schneitz K., Hulskamp M., Pruitt R.E. Wild-Type Ovule Development in Arabidopsis Thaliana: A Light Microscope Study of Cleared Whole-Mount Tissue. Plant J. 1995;7:731–749. doi: 10.1046/j.1365-313X.1995.07050731.x. [DOI] [Google Scholar]
  • 7.Hater F., Nakel T., Groß-Hardt R. Reproductive Multitasking: The Female Gametophyte. Annu. Rev. Plant Biol. 2020;71:517–546. doi: 10.1146/annurev-arplant-081519-035943. [DOI] [PubMed] [Google Scholar]
  • 8.Hamamura Y., Saito C., Awai C., Kurihara D., Miyawaki A., Nakagawa T., Kanaoka M.M., Sasaki N., Nakano A., Berger F., et al. Live-Cell Imaging Reveals the Dynamics of Two Sperm Cells during Double Fertilization in Arabidopsis Thaliana. Curr. Biol. 2011;21:497–502. doi: 10.1016/j.cub.2011.02.013. [DOI] [PubMed] [Google Scholar]
  • 9.Lopes A.L., Moreira D., Ferreira M.J., Pereira A.M., Coimbra S. Insights into Secrets along the Pollen Tube Pathway in Need to Be Discovered. J. Exp. Bot. 2019;70:2979–2992. doi: 10.1093/jxb/erz087. [DOI] [PubMed] [Google Scholar]
  • 10.Silva J., Ferraz R., Dupree P., Showalter A.M., Coimbra S. Three Decades of Advances in Arabinogalactan-Protein Biosynthesis. Front. Plant Sci. 2020;11:2014. doi: 10.3389/fpls.2020.610377. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Levitin B., Richter D., Markovich I., Zik M. Arabinogalactan Proteins 6 and 11 Are Required for Stamen and Pollen Function in Arabidopsis. Plant J. 2008;56:351–363. doi: 10.1111/j.1365-313X.2008.03607.x. [DOI] [PubMed] [Google Scholar]
  • 12.Coimbra S., Costa M., Jones B., Mendes M.A., Pereira L.G. Pollen Grain Development Is Compromised in Arabidopsis Agp6 Agp11 Null Mutants. J. Exp. Bot. 2009;60:3133–3142. doi: 10.1093/jxb/erp148. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Costa M., Nobre M.S., Becker J.D., Masiero S., Amorim M.I., Pereira L.G., Coimbra S. Expression-Based and Co-Localization Detection of Arabinogalactan Protein 6 and Arabinogalactan Protein 11 Interactors in Arabidopsis Pollen and Pollen Tubes. BMC Plant Biol. 2013;13:1–19. doi: 10.1186/1471-2229-13-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Pereira A.M., Nobre M.S., Pinto S.C., Lopes A.L., Costa M.L., Masiero S., Coimbra S. “Love Is Strong, and You’re so Sweet”: JAGGER Is Essential for Persistent Synergid Degeneration and Polytubey Block in Arabidopsis Thaliana. Mol. Plant. 2016;9:601–614. doi: 10.1016/j.molp.2016.01.002. [DOI] [PubMed] [Google Scholar]
  • 15.VanGuilder H.D., Vrana K.E., Freeman W.M. Twenty-Five Years of Quantitative PCR for Gene Expression Analysis. Biotechniques. 2008;44:619–626. doi: 10.2144/000112776. [DOI] [PubMed] [Google Scholar]
  • 16.Bustin S.A., Benes V., Garson J.A., Hellemans J., Huggett J., Kubista M., Mueller R., Nolan T., Pfaffl M.W., Shipley G.L., et al. The MIQE Guidelines: Minimum Information for Publication of Quantitative Real-Time PCR Experiments. Clin. Chem. 2009;55:611–622. doi: 10.1373/clinchem.2008.112797. [DOI] [PubMed] [Google Scholar]
  • 17.Taylor S.C., Nadeau K., Abbasi M., Lachance C., Nguyen M., Fenrich J. The Ultimate QPCR Experiment: Producing Publication Quality, Reproducible Data the First Time. Trends Biotechnol. 2019;37:761–774. doi: 10.1016/j.tibtech.2018.12.002. [DOI] [PubMed] [Google Scholar]
  • 18.Pfaffl M.W. A New Mathematical Model for Relative Quantification in Real-Time RT-PCR. Nucleic Acids Res. 2001;29:e45. doi: 10.1093/nar/29.9.e45. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Vandesompele J., De Preter K., Pattyn F., Poppe B., Van Roy N., De Paepe A., Speleman F. Accurate Normalization of Real-Time Quantitative RT-PCR Data by Geometric Averaging of Multiple Internal Control Genes. Genome Biol. 2002;3:1–12. doi: 10.1186/gb-2002-3-7-research0034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Hellemans J., Mortier G., De Paepe A., Speleman F., Vandesompele J. QBase Relative Quantification Framework and Software for Management and Automated Analysis of Real-Time Quantitative PCR Data. Genome Biol. 2007;8:1–14. doi: 10.1186/gb-2007-8-2-r19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Czechowski T., Bari R.P., Stitt M., Scheible W.R., Udvardi M.K. Real-Time RT-PCR Profiling of over 1400 Arabidopsis Transcription Factors: Unprecedented Sensitivity Reveals Novel Root- and Shoot-Specific Genes. Plant J. 2004;38:366–379. doi: 10.1111/j.1365-313X.2004.02051.x. [DOI] [PubMed] [Google Scholar]
  • 22.Dheda K., Huggett J.F., Bustin S.A., Johnson M.A., Rook G., Zumla A. Validation of Housekeeping Genes for Normalizing RNA Expression in Real-Time PCR. Biotechniques. 2004;37:112–119. doi: 10.2144/04371RR03. [DOI] [PubMed] [Google Scholar]
  • 23.Kim B.R., Nam H.Y., Kim S.U., Kim S.I., Chang Y.J. Normalization of Reverse Transcription Quantitative-PCR with Housekeeping Genes in Rice. Biotechnol. Lett. 2003;25:1869–1872. doi: 10.1023/A:1026298032009. [DOI] [PubMed] [Google Scholar]
  • 24.Knopkiewicz M., Wojtaszek P. Validation of Reference Genes for Gene Expression Analysis Using Quantitative Polymerase Chain Reaction in Pea Lines (Pisum sativum) with Different Lodging Susceptibility. Ann. Appl. Biol. 2019;174:86–91. doi: 10.1111/aab.12475. [DOI] [Google Scholar]
  • 25.Lü J., Chen S., Guo M., Ye C., Qiu B., Wu J., Yang C., Pan H. Selection and Validation of Reference Genes for RT-QPCR Analysis of the Ladybird Beetle Henosepilachna Vigintioctomaculata. Front. Physiol. 2018;9:1614. doi: 10.3389/fphys.2018.01614. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Sandercock D.A., Coe J.E., Di Giminiani P., Edwards S.A. Determination of Stable Reference Genes for RT-QPCR Expression Data in Mechanistic Pain Studies on Pig Dorsal Root Ganglia and Spinal Cord. Res. Vet. Sci. 2017;114:493–501. doi: 10.1016/j.rvsc.2017.09.025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Czechowski T., Stitt M., Altmann T., Udvardi M.K., Scheible W.R. Genome-Wide Identification and Testing of Superior Reference Genes for Transcript Normalization in Arabidopsis. Plant Physiol. 2005;139:5–17. doi: 10.1104/pp.105.063743. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Mizzotti C., Rotasperti L., Moretto M., Tadini L., Resentini F., Galliani B.M., Galbiati M., Engelen K., Pesaresi P., Masiero S. Time-Course Transcriptome Analysis of Arabidopsis Siliques Discloses Genes Essential for Fruit Development and Maturation. Plant Physiol. 2018;178:1249–1268. doi: 10.1104/pp.18.00727. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Xie F., Xiao P., Chen D., Xu L., Zhang B. MiRDeepFinder: A MiRNA Analysis Tool for Deep Sequencing of Plant Small RNAs. Plant Mol. Biol. 2012;80:75–84. doi: 10.1007/s11103-012-9885-2. [DOI] [PubMed] [Google Scholar]
  • 30.Andersen C.L., Jensen J.L., Ørntoft T.F. Normalization of Real-Time Quantitative Reverse Transcription-PCR Data: A Model-Based Variance Estimation Approach to Identify Genes Suited for Normalization, Applied to Bladder and Colon Cancer Data Sets. Cancer Res. 2004;64:5245–5250. doi: 10.1158/0008-5472.CAN-04-0496. [DOI] [PubMed] [Google Scholar]
  • 31.Pfaffl M.W., Tichopad A., Prgomet C., Neuvians T.P. Determination of Stable Housekeeping Genes, Differentially Regulated Target Genes and Sample Integrity: BestKeeper-Excel-Based Tool Using Pair-Wise Correlations. Biotechnol. Lett. 2004;26:509–515. doi: 10.1023/B:BILE.0000019559.84305.47. [DOI] [PubMed] [Google Scholar]
  • 32.Silver N., Best S., Jiang J., Thein S.L. Selection of Housekeeping Genes for Gene Expression Studies in Human Reticulocytes Using Real-Time PCR. BMC Mol. Biol. 2006;7:33. doi: 10.1186/1471-2199-7-33. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Julca I., Ferrari C., Flores-Tornero M., Proost S., Lindner A.C., Hackenberg D., Steinbachová L., Michaelidis C., Gomes Pereira S., Misra C.S., et al. Comparative Transcriptomic Analysis Reveals Conserved Programmes Underpinning Organogenesis and Reproduction in Land Plants. Nat. Plants. 2021;7:1143–1159. doi: 10.1038/s41477-021-00958-2. [DOI] [PubMed] [Google Scholar]
  • 34.Kõressaar T., Lepamets M., Kaplinski L., Raime K., Andreson R., Remm M. Primer3-Masker: Integrating Masking of Template Sequence with Primer Design Software. Bioinformatics. 2018;34:1937–1938. doi: 10.1093/bioinformatics/bty036. [DOI] [PubMed] [Google Scholar]
  • 35.Untergasser A., Cutcutache I., Koressaar T., Ye J., Faircloth B.C., Remm M., Rozen S.G. Primer3-New Capabilities and Interfaces. Nucleic Acids Res. 2012;40:e115. doi: 10.1093/nar/gks596. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Koressaar T., Remm M. Enhancements and Modifications of Primer Design Program Primer3. Bioinformatics. 2007;23:1289–1291. doi: 10.1093/bioinformatics/btm091. [DOI] [PubMed] [Google Scholar]
  • 37.Costa M., Silva J., Coimbra S. Arabidopsis Thaliana Pollen Tube Culture for Multi-Omics Studies. In: Geitmann A., editor. The Pollen Tube: Methods and Protocols. Springer; New York, NY, USA: 2019. [DOI] [PubMed] [Google Scholar]
  • 38.Smyth D.R., Bowman J.L., Meyerowitz E.M. Early Flower Development in Arabidopsis. Plant Cell. 1990;2:755–767. doi: 10.1105/tpc.2.8.755. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Alvarez-Buylla E.R., Benítez M., Corvera-Poiré A., Cador C., de Folter S., de Buen A.G., Garay-Arroyo A., García-Ponce B., Jaimes-Miranda F., Pérez-Ruiz R.V., et al. Flower Development. Arab. Book/Am. Soc. Plant Biol. 2010;8:e0127. doi: 10.1199/tab.0127. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Livak K.J., Schmittgen T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2-ΔΔCT Method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  • 41.Mafra V., Kubo K.S., Alves-Ferreira M., Ribeiro-Alves M., Stuart R.M., Boava L.P., Rodrigues C.M., Machado M.A. Reference Genes for Accurate Transcript Normalization in Citrus Genotypes under Different Experimental Conditions. PLoS ONE. 2012;7:e31263. doi: 10.1371/journal.pone.0031263. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Sgamma T., Pape J., Massiah A., Jackson S. Selection of Reference Genes for Diurnal and Developmental Time-Course Real-Time PCR Expression Analyses in Lettuce. Plant Methods. 2016;12:1–9. doi: 10.1186/s13007-016-0121-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Chen X., Mao Y., Huang S., Ni J., Lu W., Hou J., Wang Y., Zhao W., Li M., Wang Q., et al. Selection of Suitable Reference Genes for Quantitative Real-Time PCR in Sapium Sebiferum. Front. Plant Sci. 2017;8:637. doi: 10.3389/fpls.2017.00637. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Wang J.J., Han S., Yin W., Xia X., Liu C. Comparison of Reliable Reference Genes Following Different Hormone Treatments by Various Algorithms for QRT-PCR Analysis of Metasequoia. Int. J. Mol. Sci. 2018;20:34. doi: 10.3390/ijms20010034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Pu Q., Li Z., Nie G., Zhou J., Liu L., Peng Y. Selection and Validation of Reference Genes for Quantitative Real-Time PCR in White Clover (Trifolium repens L.) Involved in Five Abiotic Stresses. Plants. 2020;9:996. doi: 10.3390/plants9080996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Zhang J., Xie W., Yu X., Zhang Z., Zhao Y., Wang N., Wang Y. Selection of Suitable Reference Genes for RT-QPCR Gene Expression Analysis in Siberian Wild Rye (Elymus sibiricus) under Different Experimental Conditions. Genes. 2019;10:451. doi: 10.3390/genes10060451. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Kindgren P., Kremnev D., Blanco N.E., de Dios Barajas López J., Fernández A.P., Tellgren-Roth C., Small I., Strand Å. The Plastid Redox Insensitive 2 Mutant of Arabidopsis Is Impaired in PEP Activity and High Light-Dependent Plastid Redox Signalling to the Nucleus. Plant J. 2012;70:279–291. doi: 10.1111/j.1365-313X.2011.04865.x. [DOI] [PubMed] [Google Scholar]
  • 48.Park H.J., Kim W.Y., Park H.C., Lee S.Y., Bohnert H.J., Yun D.J. SUMO and SUMOylation in Plants. Mol. Cells. 2011;32:305–316. doi: 10.1007/s10059-011-0122-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Zhou H.W., Nussbaumer C., Chao Y., DeLong A. Disparate Roles for the Regulatory A Subunit Isoforms in Arabidopsis Protein Phosphatase 2A. Plant Cell. 2004;16:709–722. doi: 10.1105/tpc.018994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Dharmasiri S., Dharmasiri N., Hellmann H., Estelle M. The RUB/Nedd8 Conjugation Pathway Is Required for Early Development in Arabidopsis. EMBO J. 2003;22:1762–1770. doi: 10.1093/emboj/cdg190. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Gilliland L.U., Pawloski L.C., Kandasamy M.K., Meagher R.B. Arabidopsis Actin Gene ACT7 Plays an Essential Role in Germination and Root Growth. Plant J. 2003;33:319–328. doi: 10.1046/j.1365-313X.2003.01626.x. [DOI] [PubMed] [Google Scholar]
  • 52.Kopczak S.D., Haas N.A., Hussey P.J., Silflow C.D., Snustad D.P. The Small Genome of Arabidopsis Contains at Least Six Expressed Alpha-Tubulin Genes. Plant Cell. 1992;4:539–547. doi: 10.1105/tpc.4.5.539. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Rius S.P., Casati P., Iglesias A.A., Gomez-Casati D.F. Characterization of Arabidopsis Lines Deficient in GAPC-1, a Cytosolic NAD-Dependent Glyceraldehyde-3-Phosphate Dehydrogenase. Plant Physiol. 2008;148:1655. doi: 10.1104/pp.108.128769. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Majumdar R., Shao L., Turlapati S.A., Minocha S.C. Polyamines in the Life of Arabidopsis: Profiling the Expression of S-Adenosylmethionine Decarboxylase (SAMDC) Gene Family during Its Life Cycle. BMC Plant Biol. 2017;17:1–20. doi: 10.1186/s12870-017-1208-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Yoshida S., Ito M., Nishida I., Watanabe A. Isolation and RNA Gel Blot Analysis of Genes That Could Serve as Potential Molecular Markers for Leaf Senescence in Arabidopsis Thaliana. Plant Cell Physiol. 2001;42:170–178. doi: 10.1093/pcp/pce021. [DOI] [PubMed] [Google Scholar]
  • 56.Wollmann H., Stroud H., Yelagandula R., Tarutani Y., Jiang D., Jing L., Jamge B., Takeuchi H., Holec S., Nie X., et al. The Histone H3 Variant H3.3 Regulates Gene Body DNA Methylation in Arabidopsis Thaliana. Genome Biol. 2017;18:1–10. doi: 10.1186/s13059-017-1221-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Imai A., Komura M., Kawano E., Kuwashiro Y., Takahashi T. A Semi-Dominant Mutation in the Ribosomal Protein L10 Gene Suppresses the Dwarf Phenotype of the Acl5 Mutant in Arabidopsis Thaliana. Plant J. 2008;56:881–890. doi: 10.1111/j.1365-313X.2008.03647.x. [DOI] [PubMed] [Google Scholar]
  • 58.Kozera B., Rapacz M. Reference Genes in Real-Time PCR. J. Appl. Genet. 2013;54:391. doi: 10.1007/s13353-013-0173-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Gutierrez L., Mauriat M., Guénin S., Pelloux J., Lefebvre J., Louvet R., Rusterucci C., Moritz T., Guerineau F., Bellini C., et al. The Lack of a Systematic Validation of Reference Genes: A Serious Pitfall Undervalued in Reverse Transcription-Polymerase Chain Reaction (RT-PCR) Analysis in Plants. Plant Biotechnol. J. 2008;6:609–618. doi: 10.1111/j.1467-7652.2008.00346.x. [DOI] [PubMed] [Google Scholar]
  • 60.Volkov R.A., Panchuk I.I., Schöffl F. Heat-stress-dependency and Developmental Modulation of Gene Expression: The Potential of House-keeping Genes as Internal Standards in MRNA Expression Profiling Using Real-time RT-PCR. J. Exp. Bot. 2003;54:2343–2349. doi: 10.1093/jxb/erg244. [DOI] [PubMed] [Google Scholar]
  • 61.Nicot N., Hausman J.-F., Hoffmann L., Evers D. Housekeeping Gene Selection for Real-Time RT-PCR Normalization in Potato during Biotic and Abiotic Stress. J. Exp. Bot. 2005;56:2907–2914. doi: 10.1093/jxb/eri285. [DOI] [PubMed] [Google Scholar]
  • 62.Waxman S., Wurmbach E. De-Regulation of Common Housekeeping Genes in Hepatocellular Carcinoma. BMC Genom. 2007;8:1–9. doi: 10.1186/1471-2164-8-243. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Remans T., Smeets K., Opdenakker K., Mathijsen D., Vangronsveld J., Cuypers A. Normalisation of Real-Time RT-PCR Gene Expression Measurements in Arabidopsis Thaliana Exposed to Increased Metal Concentrations. Planta. 2008;227:1343–1349. doi: 10.1007/s00425-008-0706-4. [DOI] [PubMed] [Google Scholar]
  • 64.Wan Q., Chen S., Shan Z., Yang Z., Chen L., Zhang C., Yuan S., Hao Q., Zhang X., Qiu D., et al. Stability Evaluation of Reference Genes for Gene Expression Analysis by RT-QPCR in Soybean under Different Conditions. PLoS ONE. 2017;12:e0189405. doi: 10.1371/journal.pone.0189405. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Derveaux S., Vandesompele J., Hellemans J. How to Do Successful Gene Expression Analysis Using Real-Time PCR. Methods. 2010;50:227–230. doi: 10.1016/j.ymeth.2009.11.001. [DOI] [PubMed] [Google Scholar]
  • 66.Guénin S., Mauriat M., Pelloux J., Van Wuytswinkel O., Bellini C., Gutierrez L. Normalization of QRT-PCR Data: The Necessity of Adopting a Systematic, Experimental Conditions-Specific, Validation of References. J. Exp. Bot. 2009;60:487–493. doi: 10.1093/jxb/ern305. [DOI] [PubMed] [Google Scholar]
  • 67.Bustin S.A., Beaulieu J.-F., Huggett J., Jaggi R., Kibenge F.S., Olsvik P.A., Penning L.C., Toegel S. MIQE Précis: Practical Implementation of Minimum Standard Guidelines for Fluorescence-Based Quantitative Real-Time PCR Experiments. BMC Mol. Biol. 2010;11:1–5. doi: 10.1186/1471-2199-11-74. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Bustin S.A., Benes V., Garson J., Hellemans J., Huggett J., Kubista M., Mueller R., Nolan T., Pfaffl M.W., Shipley G., et al. The Need for Transparency and Good Practices in the QPCR Literature. Nat. Methods. 2013;10:1063–1067. doi: 10.1038/nmeth.2697. [DOI] [PubMed] [Google Scholar]
  • 69.Ma L., Sun N., Liu X., Jiao Y., Zhao H., Deng X.W. Organ-Specific Expression of Arabidopsis Genome during Development. Plant Physiol. 2005;138:80–91. doi: 10.1104/pp.104.054783. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Mergner J., Frejno M., Messerer M., Lang D., Samaras P., Wilhelm M., Mayer K.F.X., Schwechheimer C., Kuster B. Proteomic and Transcriptomic Profiling of Aerial Organ Development in Arabidopsis. Sci. Data. 2020;7:1–11. doi: 10.1038/s41597-020-00678-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Becker J.D., Boavida L.C., Carneiro J., Haury M., Feijó J.A. Transcriptional Profiling of Arabidopsis Tissues Reveals the Unique Characteristics of the Pollen Transcriptome. Plant Physiol. 2003;133:713–725. doi: 10.1104/pp.103.028241. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72.Dekkers B.J.W., Willems L., Bassel G.W., van Bolderen-Veldkamp R.P., Ligterink W., Hilhorst H.W.M., Bentsink L. Identification of Reference Genes for RT–QPCR Expression Analysis in Arabidopsis and Tomato Seeds. Plant Cell Physiol. 2012;53:28–37. doi: 10.1093/pcp/pcr113. [DOI] [PubMed] [Google Scholar]
  • 73.De Spiegelaere W., Dern-Wieloch J., Weigel R., Schumacher V., Schorle H., Nettersheim D., Bergmann M., Brehm R., Kliesch S., Vandekerckhove L., et al. Reference Gene Validation for RT-QPCR, a Note on Different Available Software Packages. PLoS ONE. 2015;10:e0122515. doi: 10.1371/journal.pone.0122515. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 74.Kałużna M., Kuras A., Puławska J. Validation of Reference Genes for the Normalization of the RT-QPCR Gene Expression of Virulence Genes of Erwinia Amylovora in Apple Shoots. Sci. Rep. 2017;7:1–9. doi: 10.1038/s41598-017-02078-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 75.Petriccione M., Mastrobuoni F., Zampella L., Scortichini M. Reference Gene Selection for Normalization of RT-QPCR Gene Expression Data from Actinidia Deliciosa Leaves Infected with Pseudomonas Syringae Pv. Actinidiae. Sci. Rep. 2015;5:1–12. doi: 10.1038/srep16961. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76.Liu D., Shi L., Han C., Yu J., Li D., Zhang Y. Validation of Reference Genes for Gene Expression Studies in Virus-Infected Nicotiana Benthamiana Using Quantitative Real-Time PCR. PLoS ONE. 2012;7:e46451. doi: 10.1371/journal.pone.0046451. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 77.Köhsler M., Leitsch D., Müller N., Walochnik J. Validation of Reference Genes for the Normalization of RT-QPCR Gene Expression in Acanthamoeba Spp. Sci. Rep. 2020;10:1–12. doi: 10.1038/s41598-020-67035-0. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Data Availability Statement

All data are contained within the manuscript and Supplementary Materials.


Articles from Biomolecules are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES