Comparison of physicochemical properties of sorghum extract by ethanol concentration and its anti-adipogenic effect in 3T3-L1 cells

Abstract

Sorghum is a vital cereal source that has various phenolic compounds and potential health-promoting benefits. This study evaluated the phenolic content, antioxidant and anti-obesity effects of sorghum extract (SE) prepared using three solvent systems: 50% (SE50), 80% (SE80), and 100% (SE100) ethanol. The results showed that SE50 exhibited the highest total polyphenol and flavonoid content among the sorghum extracts using different ethanol concentrations as extraction solvents. In addition, SE50 showed significantly higher antioxidant capacity than the other extracts. Interestingly, SE50 significantly inhibited lipid accumulation in 3T3-L1 adipocytes; however, SE80 and SE100 had no beneficial effects. Moreover, SE50 significantly downregulated the mRNA expression levels of adipogenic genes (Cebpα, Pparγ, and Fabp4) and lipogenic genes (Srebp1c, Fas, and Scd1). These results suggest that SE50 is superior to other ethanol extracts in phenolic contents, antioxidant and anti-obesity activities, and it could be used as a nutraceutical for anti-obesity.

Introduction

Obesity is defined as excessive accumulation of body fat due to an imbalance in the body's caloric metabolism (Seidell and Flegal, 1997). It poses a significant threat to public health due to being a major cause of chronic diseases, such as hypertension, type 2 diabetes, arthritis, and cancer (El-Shiekh et al., 2019; Park et al., 2011). According to the reports published by the World Health Organization (WHO), 13% of adults aged 18 and over were obese, and 39% were overweight, and the prevalence of obesity is increasing in many countries (WHO, 2021). Because of this trend, it has become an important social problem to reduce obesity. However, anti-obesity drugs exhibit various side effects, including nausea, dizziness, and gastrointestinal disorders (Huang et al,. 2020). Therefore, recent research has focused on safe and effective anti-obesity drugs derived from natural products.

Oxidative stress can cause diseases by excessive reactive oxygen species production and an imbalance in biological antioxidant systems (Sies, 1997). Chronic oxidative stress is strongly associated with obesity. Obesity commonly causes oxidative stress, but antioxidants have not yet been proven effective in treating obesity (Savini et al., 2013). However, according to recent studies, polyphenols, such as resveratrol, which has antioxidant activity, may help prevent obesity (Wang et al., 2014). In addition, some dietary phytochemicals have been documented as anti-obesity agents because they may stimulate and inhibit the differentiation of preadipocytes, thereby reducing adipose tissue mass (Azlan et al., 2022). Taken together, natural antioxidants high in phytochemicals can promote anti-obesity effects.

Sorghum (Sorghum bicolor L.), the fifth most produced grain globally, is a rich source of nutrients and bioactive compounds (Hou et al., 2016). Previous studies have shown that sorghum contains abundant phenolic compounds, such as phenolic acid, 3-deoxyanthocyanins, flavonoids, and tannins (De Morais Cardoso et al., 2017). Moreover, previous studies have reported various physiological functions of sorghum extracts, such as antioxidant, anti-inflammatory, antidiabetic, antibacterial, and anticancer activities (Chung et al., 2011; Gilchrist et al., 2020; Smolensky et al., 2018). In addition, a few animal studies on the anti-obesity effects of sorghum have been conducted using sorghum bran or its pigment (De Sousa et al., 2018; Wu et al., 2019). A previous study reported that 3-deoxyanthocyanidins such as luteolinidine and 5-methoxyluteliolinidin apigenidine in sorghum could be effective to modulate adiposity in obese rats (Arbex et al., 2018). However, to our knowledge, the anti-obesity effects of sorghum extract in 3T3-L1 preadipocytes have not yet been identified.

We hypothesized that sorghum extract (SE) would exert anti-obesity effects in 3T3-L1 preadipocytes. This study aimed to examine the total polyphenol and flavonoid contents, and antioxidant capacity of SE depending on solvent concentration. We further investigated how different SE influenced adipogenesis and lipid accumulation in 3T3-L1 cells by staining for lipids and measuring gene expression.

Materials and methods

Materials

Sorghum (Sorghum bicolor L., Miryang 22ho) harvested in 2020 was provided by the National Institute of Crop Science (Rural Development Administration, Miryang, Korea). 3T3-L1 preadipocytes were purchased from the Korean Cell Line Bank (Seoul, Korea). Dulbecco's modified Eagle’s medium (DMEM) and phosphate-buffered saline (PBS) were purchased from Welgene Inc. (Seoul, Korea). Fetal bovine serum (FBS) was purchased from AB Frontier Co. (Seoul, Korea). Penicillin/streptomycin (PS) and bovine calf serum (BCS) were purchased from Gibco (Carlsbad, CA, USA). 3-(4,5-dimethylthiazol-2yl)-2,5-diphenyltetrazolium bromide (MTT), 2,2-diphenyl-1-picrylhydrazyl (DPPH), 2,4,6-Tirs(2-pyridyl)-s-triazine (TPTZ), 3-isobutyl-1methylxanthine (IBMX), dexamethasone (DEX), insulin, and all other analytical solvents were purchased from Sigma-Aldrich Co. (St. Louis, MO, USA).

Sample preparation

The sorghum grains were extracted using three solvent systems: 50% (SE50), 80% (SE80), and 100% (SE100) ethanol. Sorghum was ground into a fine powder using a blender. Sorghum powder (100 g) and 50, 80, and 100% ethanol (1 L) were mixed and stirred overnight at room temperature (20–25 °C) and filtered through filter paper (Whatman No. 1, Whatman, Maidstone, England). The filtered solution was concentrated using a rotary evaporator (Eyela, Tokyo, Japan) at 50 °C. SE was obtained by lyophilization and dissolved in DMSO to a concentration of 250 mg/mL. The samples were stored at − 20 °C for further analysis.

Quantification of phenolic compound

Measurement of total polyphenol content (TPC)

Quantification of TPC within SE was determined using Folin–Ciocalteu’s reagent as previously reported with some modifications (Aryal et al., 2019). Briefly, 500 μL of 10% 2 N Folin–Ciocalteu reagent was added to 200 μL of SE and allowed to react for 5 min. Then, 500 μL of 7.5% Na₂CO₃ was added and allowed to react at 50 °C for 10 min. The absorbance was measured at 760 nm using a microplate reader (Bio Tek, Winooski, VT, USA). The TPC was expressed as mg gallic acid equivalent per 1 g SE (mg GAE/g) using a standard curve of gallic acid.

Measurement of total flavonoid content (TFC)

The TFC was estimated using an AlCl₃ reagent according to a previously reported study (Zhishen et al., 1999). SE (100 μL) was added to 400 μL of distilled water, and 30 μL of 5% NaNO₂ and 30 μL of 10% AlCl₃ were mixed. After 5 min, 200 μL of 1 M NaOH was added, and the total volume was made up to 1 mL using distilled water. Absorbance was measured at 415 nm using a microplate reader (Bio Tek). The TFC was expressed as mg quercetin equivalent per 1 g SE (mg QE/g) using a standard curve of quercetin.

Antioxidant capacity

2,2-Diphenyl-1-picrylhydrazyl (DPPH) radical scavenging assay

The radical scavenging activity of SE was assessed using DPPH free radicals, and Trolox was used as a positive control. A 20 μL sample and blank were plated with 180 μL of 0.4 mM DPPH solution in a 96-well plate. After the reaction for 45 min at room temperature, the absorbance was measured at 517 nm using a microplate reader (Bio Tek). The scavenging activity of the extract was calculated using the following equation, and the data represent the IC₅₀ value. The IC₅₀ value is defined as the amount of antioxidants required to reduce the initial DPPH concentration by 50%.

$$\text{DPPH radical scavenging activity}\left(\text{\%}\right)==\frac{\left(\text{Absorbance}\text{of}\text{control}-\left(\text{Absorbance}\text{of}\text{sample}-\text{Absorbance}\text{of}\text{blank}\right)\right)}{\text{Absorbance}\text{of}\text{control}}\times 100$$ 1

Ferric reducing antioxidant power (FRAP) assay

The FRAP reagent was freshly prepared for each experiment by dissolving 300 mM acetate buffer (pH 3.6), 10 mM TPTZ in 40 mM HCl, and 20 mM FeCl₃ to obtain a 10:1:1 (v/v/v) ratio. FRAP reagent was preheated at 37 °C for 15 min before use. Then, 50 μL of SE at various concentrations was mixed with 150 μL of FRAP reagent and allowed to react at room temperature for 4 min. The absorbance of the mixture was measured at 595 nm using a microplate reader (Bio Tek). The reducing power was expressed as µM Trolox using a standard curve.

Cell culture

3T3-L1 preadipocytes were seeded at 3.0 × 10⁴ cells/well in a 12-well plate and cultured in DMEM containing 10% BCS and 1% PS at 37 °C and 5% CO₂. When the cells were confluent (0 days), the medium was changed to the differentiation medium containing DMEM, 10% FBS, IBMX (0.5 mM), DEX (1 µM), and insulin (10 µg/mL). After 2 days, the medium was replaced with fresh FBS/DMEM containing 10 µg/mL insulin for 6 days. The medium was replaced every 2 days. The cells were treated with SE (0–100 µg/mL) for 10 days to confirm the inhibitory effect on lipid accumulation. The cells were harvested after 10 days of differentiation to determine lipid accumulation.

Cytotoxicity

Cell viability was evaluated using the MTT assay. 3T3-L1 preadipocytes were cultured in a 96-well plate at 1.0 × 10⁵ cells/well for 24 h and then treated for 24 h with 0, 25, 50, 100, and 200 µg/mL SE. Then, 20 μL of MTT solution freshly prepared at 5 mg/mL in PBS was added to each well and incubated at 37 °C for a further 4 h. After incubation, the supernatant was discarded, and DMSO was added to completely solubilize the purple formazan crystals. Absorbance was measured at 540 nm using microplate reader (Bio Tek). The cell viability data were presented as percentages of the control.

Oil red O staining

Lipid accumulation in 3T3-L1 preadipocytes was determined using Oil Red O staining. The Oil Red O stock solution was dissolved in 100% isopropanol at a concentration of 3 mg/mL and diluted with distilled water in a 3:2 volume ratio to prepare a working solution. Cells were washed twice with PBS and fixed with 10% formalin for 1 h. The cells were washed with 60% isopropanol for 5 min and stained with Oil Red O working solution for 10 min. After the cells were rinsed twice with distilled water, the stained lipid droplets were eluted with 100% isopropanol and the suspensions were centrifuged at 14,881×g for 2 min. The absorbance of the supernatant was measured at 480 nm using a microplate reader (Bio Tek).

Real-time PCR

3T3-L1 cells were lysed to obtain total mRNA, followed by the NucleoSpin® RNA Plus isolation kit (Macherey–Nagel, Dueren, Germany). The integrity, purity, and quantity of the isolated mRNAs were measured using a NanoDrop spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA), and the concentrations were normalized. Subsequently, total mRNA was reverse transcribed to cDNA according to the instructions of the PrimeScript™ RT reagent kit (Takara, Shiga, Japan). Following the manufacturer’s instructions, a reaction mixture (10 μL) including 3.5 μL of mix reagent and 6 μL of total RNA were prepared. Next, mRNA expression reaction was prepared as follows: 2 µL of synthesized cDNA was mixed with 10 µL of SYBR Green Supermix, 3.2 µL of primer pair set, and 6 µL of RNase-free H₂O. The mRNA expression analysis was performed using a CFX96TM RT-PCR detection system (Bio-Rad, Hercules, CA, USA). The relative expression levels were calculated with 36b4 as the reference gene using the delta-delta threshold cycle (ΔΔCt) method. The primer sequences for PCR are listed in Table 1.

Table 1.

Sequences of real-time PCR primer used in gene expression analysis

Target	Forward primer (5′–3′)	Reverse primer (5′–3′)
36b4	TCTAGGACCCGAGAAGACCTC	GTTGTCAAACACCTGCTGGAT
Cebpα	TTACAACAGGCCAGGTTTCC	GGCTGGCGACATACAGTACA
Pparɣ	CGCTGATGCACTGCCTATGA	AGAGGTCCACAGAGCTGATTCC
Fabp4	AAGAAGTGGGAGTGGGCTTTG	CTGTCGTCTGCGGTGATTTC
Srebp1c	GAACAGACACTGGCCGAGAT	GAGGCCAGAGAAGCAGAAGAG
Fas	AGCACTGCCTTCGGTTCAGTC	AAGAGCTGTGGAGGCCACTTG
Scd1	CATCGCCTGCTCTACCCTTT	GAACTGCGCTTGGAAACCTG

Statistical analysis

Data are expressed as the mean ± standard error of the mean (SEM). All statistical analyses were performed using GraphPad Prism version 7 (GraphPad Software, La Jolla, CA, USA) using one-way analysis of variance (ANOVA) followed by the least significant difference (LSD) test. Differences were considered statistically significant at p < 0.05.

Results and discussion

Extraction yield, TPC, and TFC of SE

In general, the higher the polarity of the solvent, the better physicochemical properties of the sorghum, as reported in previous studies (Hong et al., 2020). A previous study compared ethanol and methanol extracts of sorghum grains which confirmed that the ethanol extract includes more substances such as anthocyanins, 3-deoxyanthocyanidins, flavonoids, and tannins, and improved physical and chemical properties (Dia et al., 2016). Furthermore, 50–100% (v/v) ethanol combined with water is used to extract more phenolic compounds from plant materials (Zhang et al., 2019). Therefore, we assessed three different solvents 50, 80, and 100% (v/v) ethanol.

The effects of 50, 80, and 100% ethanol on the yields, TPC, and TFC of SE are listed in Table 2. The extraction yield, affected by different ratios of ethanol/water as the extraction solvent, was the highest at SE50 (3.72%), followed by SE100 (3.57%) and SE80 (2.36%). The TPC of SE extracted using different solvent compositions was increased with decreasing ethanol concentration. The SE50 (199.0 mg GAE/g) was significantly (p < 0.05) higher than those of 144.8 mg GAE/g of the SE80 and 119.0 mg GAE/g of the SE100. These results were similar to the reported TPC of 150.1 mg GAE/g in 60% ethanol extract in sorghum grain was higher than in other ethanolic extractions (Han et al., 2020). In addition, the results of the TFC showed a similar trend to that of the TPC. As a result of TFC, the SE50 showed 321.60 mg QE/g, the SE80 showed 243.80 mg QE/g, and the SE100 showed 188.00 mg QE/g. SE50 showed significantly (p < 0.05) larger values than SE80 and SE100.

Table 2.

Extraction yield, total polyphenol content, and total flavonoid content of SE at different ethanol concentrations

Group	Extraction yield (%)	TPC (mg GAE/g)	TFC (mg QE/g)
SE50	3.72	199.0 ± 5.7a	321.6 ± 7.0a
SE80	2.36	144.8 ± 2.8b	243.8 ± 3.2b
SE100	3.57	119.0 ± 1.5c	188.0 ± 3.5c

Data are expressed as mean ± standard error of the mean (SEM). Means with different letters (a‒c) are significantly different (p < 0.05). SE50, 50% ethanol extract; SE80, 80% ethanol extract; SE100, 100% ethanol extract

TPC total polyphenol content, TFC total flavonoid content, GAE gallic acid equivalent, QE quercetin equivalent

These observations of the various extraction concentrations were consistent with a previous study affecting the yield and phenolic compounds (Spigno et al., 2007). In addition, these results are comparable to previous research in which sorghum bran was effective for extracting the phenolic compounds at 50% ethanolic extraction (Luo et al., 2018). Moreover, Luo et al. reported that 53% ethanol concentration was confirmed as the optimized ethanol concentration by response surface methodology to obtain high total polyphenol content in sorghum extract 30–70% ethanol concentration. The results could be related to the solvent polarity and the solubility of polyphenolic compounds in sorghum (Ozbek et al., 2020). Likewise, our results indicate that 50% ethanol is the best solvent for the extraction of polyphenolic compounds.

Antioxidant capacity of SE

The antioxidant capacity of SE was assessed using DPPH and FRAP assays (Table 3). The IC50 value SE50 (133.9 µg/mL) was significantly (p < 0.05) lower than SE80 (182.7 µg/mL) and SE100 (285.7 μg/mL). The lower IC50 values indicate higher antioxidant capacity, and radical scavenging was the highest in SE50. In contrast to a previous study, the IC50 values reported here are significantly lower (Ofosu et al., 2020). As with the DPPH assay, the FRAP value of SE50 was significantly (p < 0.05) higher than SE80 and SE100. However, no significant differences were observed between the SE80 and SE100 groups. Our results showed that sorghum has many phenolic compounds and antioxidants, as evidenced in numerous previous studies and phenolic compounds and antioxidant capacity were the highest in SE50 compared to SE80 and SE100. Phenolic compounds exhibit antioxidant properties, as phenol rings can stabilize free radicals (Nakagawa and Amano, 1974). In this study, the same trend was observed as in a previous study which reported a high correlation between the phenolic compounds of the extract and DPPH radical scavenging activity (Choi et al., 2007). The antioxidant capacity of the SE50 was higher than that of the other extracts, which could be attributed to the influence of ethanol concentration on the yield of total polyphenolics.

Table 3.

The DPPH radical scavenging activity and FRAP assay of SE at different ethanol concentrations

Group	DPPH (IC50)	FRAP (mmole TE/100 g)
SE50	133.9 ± 2.7a	80.17 ± 3.7a
SE80	182.7 ± 5.8b	58.10 ± 3.2bc
SE100	285.7 ± 7.8c	61.09 ± 5.2c

Data are expressed as mean ± standard error of the mean (SEM). Means with different letters (a‒c) are significantly different (p < 0.05). SE50, 50% ethanol extract; SE80, 80% ethanol extract; SE100, 100% ethanol extract

TE Trolox equivalents, DPPH 2,2-diphenyl-1-picrylhydrazyl free radical scavenging assay, FRAP ferric ion reducing antioxidant power assay

Cytotoxicity of SE in 3T3-L1 preadipocytes

The cytotoxicity of SE was assessed using the MTT assay in 3T3-L1 preadipocytes (Fig. 1). Treatment of 3T3-L1 preadipocytes with 0, 25, 50, 100, and 200 μg/mL concentrations of each ethanol extract for 24 h revealed no cytotoxic effect, with cell viability remaining high at > 80% after treatment. However, the viability of cells treated with SE80 decreased by approximately 17 and 19% at concentrations above 100 μg/mL. In addition, the concentration of 200 μg/mL was significantly reduced by approximately 19% compared with control. These results showed that the SE80 indicated cytotoxicity against 3T3-L1 cells at 200 μg/mL. On the other hand, cell viability SE treatment up to 200 μg/mL in SE50 and SE100 that indicated 15% or less had no cytotoxicity. Thus, we performed SE concentrations for subsequent experiments at 25 to 100 μg/mL.

Fig. 1.

Cell viability of 3T3-L1 preadipocytes treated with sorghum extracts at different ethanol concentrations. Data are expressed as mean ± standard error of the mean (SEM). SE50 sorghum of 50% ethanol extract, SE80 sorghum of 80% ethanol extract, SE100 sorghum of 100% ethanol extract

Effect of SE on lipid accumulation in 3T3-L1 preadipocytes

The potential lipid-inhibiting effect of SE was investigated using Oil Red O staining of 3T3-L1 differentiated adipocytes. The effects of lipid accumulation using a microscope and quantified intracellular lipid contents at different ethanol concentrations in SE at 0, 25, 50, and 100 µg/mL are illustrated in Fig. 2. SE50, SE80, and SE100 at 25 µg/mL were significantly reduced by 87, 90, and 86%, respectively, compared to the control group (Fig. 2A). However, SE80 respectively decreased by 91% and 89% at concentrations of 50 and 100 µg/mL, and there was no significant difference. On the other hand, SE100 decreased by 85% and 86%, and the SE50 showed significant differences up to 79% and 75% (Fig. 2B and C). In summary, SE50 showed a greater inhibition ability of lipid accumulation than SE80 and SE100. Based on these findings, SE50 was selected for subsequent examination of the molecular mechanism.

Fig. 2.

Effect of SE at different ethanol concentrations on lipid accumulation using Oil red O staining in 3T3-L1 adipocytes. Lipid accumulation was shown as a relative percentage to control (100%) at different ethanol concentrations for 25 µg/mL (A), 50 µg/mL (B), 100 µg/mL (C), and was observed in microscopic images of adipocytes stained with Oil Red O (D). Data are expressed as mean ± standard error of the mean (SEM). Means with different letters (a‒c) of the sample are significantly different (p < 0.05). SE50 sorghum of 50% ethanol extract, SE80 sorghum of 80% ethanol extract, SE100 sorghum of 100% ethanol extract

Effect of SE50 on the mRNA expression levels of Cebpα, Pparγ, and Fabp4 in 3T3-L1 preadipocytes

Real-time PCR analysis was conducted to determine whether adipogenesis affects the expression of a transcription factor. The mechanism of inhibition of lipid accumulation by the SE50 was investigated by analyzing the mRNA expression of genes that modulate adipogenic CCATT/enhancer-binding protein-α (Cebpα), peroxisome proliferator-activated receptor (Pparγ), and fatty acid-binding protein (Fabp4).

The most critical first transcription factors for adipogenesis are the expression of Cebpα and the nuclear hormone receptor Pparγ; these two factors remain elevated for adipocyte maturation. Pparγ induces the expression of the adipogenic transcription factor Cebpα and then binds with Cebpα to the promoter/enhancer of the gene encoding the adipocyte fatty acid-binding protein Fabp4 (Rosen, 2005). Fabp4, expressed at the last stage of adipocyte differentiation, is involved in fatty acid synthesis, transport, storage, and energy consumption (Haunerland and Spener 2004). As shown in Fig. 3, SE50 induced significant down-regulation of gene expression of Cebpα, Pparγ, and Fabp4 (p < 0.05). The relative level of Cebpα, Pparγ, and Fabp4 mRNA expression decreased by 65, 33, and 47%, respectively, following treatment with SE50 at a concentration of 100 µg/mL. Similarly, sorghum bran extract repressed the expression of adipogenic genes Cebpα and Pparγ (Lee et al. 2022). Therefore, SE50 inhibits the differentiation of adipocytes by mutually regulating the expression of these genes.

Fig. 3.

Effect of SE50 on the mRNA expression levels of Cebpα (A), Pparɣ (B), and Fabp4 (C) related to adipogenesis and Srebp1c (D), Fas (E), and Scd1 (F) related to lipogenesis in 3T3-L1 preadipocytes. Data are expressed as mean ± standard error of the mean (SEM). Means with different letters (a‒c) of the sample are significantly different (p < 0.05). SE50, sorghum of 50% ethanol extract

Effect of SE50 on the mRNA expression levels of Srebp1c, Fas, and Scd1 in 3T3-L1 preadipocytes

The mechanism of lipogenesis inhibition affects the mRNA expression levels of lipid metabolism-related genes of sterol regulatory element binding protein 1 (Srebp1c), fatty acid synthase (Fas), and stearoyl-CoA desaturase 1 (Scd1). Srebp1c induces intracellular triglyceride production and accumulation by increasing the expression of lipogenic enzymes, such as Scd1 and Fas, which promote preadipocyte differentiation and increase the content of lipid droplets in mature adipocytes (Lowe et al., 2011). The results of treatment with SE50 are shown in Fig. 3. The gene expression of Srebp1c was significantly (p < 0.05) reduced by 19% and 27% at concentrations of 50 and 100 µg/mL, respectively, compared to the control. Fas and Scd1 expression were also significantly (p < 0.05) decreased by 19% and 18%, respectively, at 100 µg/mL. These results were consistent with the results of previous studies showing that the reduction of Srebp1c expression in 3T3-L1 preadipocytes suppressed the mRNA and protein expression of adipogenic enzymes such as Fas and Scd1 (Kwon et al., 2018). As a result, SE50 downregulated the expression of Cebpα, Pparγ, and Fabp4 in 3T3-L1 preadipocytes to suppress the early stage of adipogenesis and lipogenic enzymes genes such as Srebp1c, Fas, and Scd1. It was confirmed that it effectively inhibited fatty acid metabolism and lipid accumulation. In conclusion, these findings provide convincing evidence to indicate that SE extracted using 50% ethanol could be used as a bioactive ingredient in functional foods for anti-obesity.

Funding

This study was supported by Rural Development Administration (Grant No. PJ015056012022).

Declarations

Conflict of interest

The authors declare no conflict of interest.