Skip to main content
NCBI home page
Elsevier - PMC COVID-19 Collection logoLink to Elsevier - PMC COVID-19 Collection
. 2023 Feb 26;24(2):1052–1060. doi: 10.1021/acs.biomac.2c01525

Tetrahedral Framework Nucleic Acids: A Novel Strategy for Antibiotic Treating Drug-Resistant Infections

Yue Sun †, Xingyu Chen †, Sirong Shi †, Taoran Tian †, Zhiqiang Liu †, En Luo †,*, Yunfeng Lin †,,‡,*
PMCID: PMC10069167  PMID: 36723425

Abstract

Antibiotic multiresistance (AMR) has emerged as a major threat to human health as millions of people die from AMR-related problems every year. As has been witnessed during the global COVID-19 pandemic, the significantly increased demand for antibiotics has aggravated the issue of AMR. Therefore, there is an urgent need to find ways to alleviate it. Tetrahedral framework nucleic acids (tFNAs) are novel nanomaterials that are often used as drug delivery platforms because of their structural diversity. This study formed a tFNAs-antibiotic compound (TAC) which has a strong growth inhibitory effect on Escherichia coli and methicillin-resistant Staphylococcus aureus (MRSA) in vitro owing to the increased absorption of antibiotics by bacteria and improved drug movement across cell membranes. We established a mouse model of systemic peritonitis and local wound infections. The TAC exhibited good biosafety and improved the survival rate of severely infected mice, promoting the healing of local infections. In addition to the better transport of antibiotics to the target, the TAC may also enhance immunity by regulating the differentiation of M1 and M2 macrophages, providing a new option for the treatment of infections.

Unlabelled Image

Open in a new tab

1. Introduction

Under the raging infectious diseases around the world, the increase in dosage requirements of antibiotics has resulted in the reduction of clinical effects of the antibiotic and the aggravation of patient side effects.1., 2., 3. The emergence of drug-resistant bacterial strains renders antibiotics incapable of penetrating mutated thickened bacterial cell walls or biofilms.4 Drug-resistance genes change the protein structure and the number of antibiotic targets and affect drug binding.5 The active efflux system on the bacterial cell membrane renders the concentration of drugs within the bacteria insufficient.6 The first generation of antibiotics used for clinical applications such as ampicillin and erythromycin have experienced the most severe drug resistance. The most common causes of death associated with antibiotic multiresistance (AMR) are related to Escherichia coli and Staphylococcus aureus.7

Tetrahedral framework nucleic acids (tFNAs) are self-assembled using four single-stranded DNA (ssDNA) molecules through highly specific base pairing.8 , 9 Our previous studies have shown that tFNAs have good biocompatibility, and their size and structure can be precisely regulated;10., 11., 12., 13., 14. consequently, they are often studied as delivery vectors for antitumor drugs.15., 16., 17., 18., 19., 20. Our previous studies also showed that the tFNAs can be used for antibacterial and immune studies.21., 22., 23., 24., 25., 26. In this study, we extended the comparative investigations of the in vivo antimicrobial efficacy of tFNAs-antibiotic compound (TAC) in two mouse models of systemic peritonitis and local wound infections. In the first model, the skin wound infection assay was repeated using a clinical methicillin-resistant Staphylococcus aureus (MRSA) strain. In the second model, an E. coli strain (BNCC133264) obtained from the BeNa Culture Collection (Beijing, China) was selected for intraabdominal inoculation, which rapidly spread to systemic infection. Based on the background of tFNAs regulatory requirements and specific targeting,27., 28., 29., 30. an experimental study was conducted on tFNAs as antibiotic carriers, to ultimately demonstrate that the TAC better-protected animals from a wide range of infections compared to antibiotic-only (Scheme 1 ).

Scheme 1.

Scheme 1

Open in a new tab

tFNAs-Antibiotic Compound (TAC) Improved the Survival Rate of Severely Infected Mice and Promoted the Healing of Local Infections by the Excellent Delivery Capability of tFNAs

2. Materials and Methods

2.1. Synthesis of tFNAs and Antibiotic Loading

The TM buffer (pH 8.0) was prepared using 10 mM Tris–HCl and 50 mM MgCl2. First, 1 μm (S1–S4) ssDNA was added to the TM buffer to form tFNAs using specific preparation procedures.31., 32., 33. Table 1 lists the base sequence of each DNA strand, and the synthesis has been detailed in the literature. The tFNAs were incubated with different concentrations of Amp (400, 800, 1200, and 1600 μg/mL) and Ery solutions (500, 1500, 1000, and 2000 μg/mL) at 4 °C for 24 h. A 15 kDa centrifugal filter was used at 12,000 rpm for 5 min to separate the free antibiotic molecules, and a 30 kDa ultrafiltration centrifuge was used at 12,000 rpm for 5 min to remove the free ssDNA or dimer. Purified TACs solutions were obtained. An ultraviolet–visible (UV–vis) spectrometer (U-3900H, Hitachi, Japan) was used to quantify the UV absorption peaks of the drug solution before and after ultrafiltration (Amp: 208 nm, Ery: 236 nm). The antibiotic loading efficiency (LE) at different concentrations was calculated based on the peak area, as follows:

loadingefficiency=totaldrugNa−freedrugNatotaldrugNa×100%

Table 1.

Base Sequences of 4 ssDNA

ss DNA Base sequence (5′ → 3′)
S1 ATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGAA
S2 ACATGCGAGGGTCCAATACCGACGATTACAGCTTGCTACACGATTCAGACTTAGGAATGTTCG
S3 ACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCC
S4 ACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCG
Open in a new tab

2.2. Identification of Successfully Synthesized tFNAs and TACs

Dynamic light scattering and laser Doppler velocimetry were used to determine the average size and zeta potential of the tFNAs and TACs (Malvern Instruments, England). Four ssDNA and tFNAs samples were examined at a ratio of 5:1 in a 6× buffer solution, and 8% polyacrylamide gel electrophoresis (PAGE) was conducted using vertical electrophoresis at 60 V for 120 min. Special double-sided adhesive with clean samples (tFNAs and TACs) was pasted to an atomic force microscope (AFM, SPM-9700, Shimadzu, Kyoto, Japan) to scan and obtain images. Samples were also analyzed using transmission electron microscopy (TEM, Libra200, Zeiss, Germany).

2.3. Antibacterial Test of and TACs

E. coli was conducted using a 96-well plate, which was placed in a biochemical incubator (Thermo Scientific, USA) at 37 °C for 24 h. The minimum inhibitory concentration (MIC) of erythromycin for E. coli was recorded as MICEry, and that of ampicillin for MRSA was recorded as MICAmp. An automated spectrophotometer (BioTek Instruments, USA) was used to measure the OD600 value of the bacteria from 0 to 24 h, and the growth curve of each group was drawn. For evaluating the colony count, quantitative bacterial solutions from each group were transferred to Mueller–Hinton broth (MHB) agar plates for enumeration after incubation at 37 °C for 24 h. For morphological observation, the samples were prepared for scanning electron microscopy (FEI, INSPECTF, USA) to observe the changes in the number and spatial structure of bacteria treated by each group. The untreated bacteria were used as the control group. Each experiment was performed in triplicates.

2.4. Uptake of tFNAs by Bacteria

To observe the uptake rate of tFNAs and TACs into the bacteria, the bacteria were inoculated with each sample modified with Cyanine-5 (Cy5) in a 24-well plate and cultured at 37 °C for 90 min. The final detected bacterial concentration of 1 × 106 CFU were collected and stained with Hoechst 33342 (MRSA) and SYTO-9 (E. coli) dye for 15 min. A confocal laser microscope (TCS SP8; Leica, Wetzlar, Germany) was used to analyze the fluorescence images. To obtain more quantitative data, the bacterial strains (10,000 cells per sample) were centrifuged, collected, suspended in 200 μl phosphate-buffered saline (PBS), and analyzed using a flow cytometer (FC500 Beckman, IL USA).

2.5. Cytotoxicity Assay

L929 cells were purchased from the American Type Culture Collection (ATCC CRL1730) before being inoculated into 12-well plates (5000 cells per well) and cultured using different concentrations of tFNAs and TACs for 24 and 48 h. The live cells were washed twice with PBS and suspended with live cell fluorescent dye for immunofluorescence staining. A fluorescence microscope was used to capture the cell images. The CCK-8 kit (Dojindo, Japan) was used to monitor the cell proliferation rate of each group under different treatment conditions and evaluate the cytotoxicity of tFNAs and TACs.

2.6. Animals

KM mice (male, 18–22 g, 6–8 weeks) were provided by Dossy (Chengdu, China) for in vivo efficacy studies. The mice had free access to water and food. After the experiment, the mice were euthanized by isoflurane inhalation. Animals were raised and handled in accordance with the guidelines for the care and use of laboratory animals. This study was approved by the Ethics Committee of the Department of Laboratory Animal Science, Sichuan University (license number: WCHSIRB-D-2021-019).

2.7. Fluorescence Imaging In Vivo

The distribution of TAC in vivo and the stability time for the two administration modes were determined. After anesthesia with isoflurane, the mice were administered the same amount of TACs intraperitoneally and subcutaneously. Images were obtained using IVIS (Bio Real Quick View 3000, Austria) at various time points (0–90 min) after injection.

2.8. Establishment of Mice Abdominal Infection Model and Grouping

An abdominal infection assay was conducted using an E. coli strain. A total of 100 KM mice were randomly divided into 5 groups. Mice in the blank control group were intraperitoneally injected with 0.9% saline solution, and mice in other groups were intraperitoneally injected with E. coli solution (0.5 mL) at a concentration of 1 × 109 cells/mL. The criteria for successful modeling of peritonitis in mice were poor mental state, crouching immobility, anorexia, messy hair, and eye congestion after 24 h. Subsequently, the saline (NS) group was injected with saline for 2 d, while the mice in the Ery and TACs groups were injected intraperitoneally with 50,000 units of Ery and TACs, respectively, for 2 d. The mice in the low-dose TACs group were intraperitoneally injected with 30,000 units of TACs for 2 d.

2.9. Establishment of Mice Wound Infection and Grouping

The skin wound infection assay was conducted using a clinical MRSA strain. A total of 100 KM mice were randomly divided into 5 groups. After isoflurane anesthesia, the mice of the other groupsthat is, except for the control groupwere shaved on their backs, and wounds were established by knife cutting. An MRSA solution (0.1 mL) at a concentration of 1 × 108 cells/mL was inoculated into the wounds. The mouse skin incision infection model was formed after 48 h accompanied by symptoms of local red and swollen subcutaneous induration. The saline group received a subcutaneous injection of saline for 3 d, while the mice in the Amp and TAC groups were injected subcutaneously with 40,000 units of Amp and TAC, respectively, for 3 d. The mice in the low-dose TAC group were administered 20,000 units of TAC subcutaneously for 3 d. The control group received no treatment and was not modeled.

2.10. Evaluation Method of Anti-Infective Effect

The number of dead mice in each group within 48 h was recorded, and the survival rate was calculated using the exact probability method with four grids. The mice in each group were anesthetized, and their eyeball blood was collected for routine blood examination. The peritoneal fluid of the mice in each group was evenly distributed into Luria–Bertani (LB) agar plates and cultured in a bacterial incubator for 24 h for colony counting. After anesthesia, the eyeball blood of each group was collected, placed at room temperature for 1 h, and centrifuged at 4000 rpm for 15 min to separate the upper serum. The expression of TNF-α, IL-6, and IL-10 in serum was detected using an ELISA assay kit. Local skin and subcutaneous tissues were soaked in 4% paraformaldehyde, fixed, dehydrated, embedded, sliced, and stained using hematoxylin and eosin. An fSX100 microscope (Olympus, Tokyo, Japan) was used to obtain tissue sections for histological analysis.

2.11. Data Analysis

SPSS 19.0 (IBM, Armonk, NY) was used for data analysis. Analysis of variance (ANOVA) and t test were conducted to obtain between-group variance. All quantitative results were presented as mean ± standard deviation (SD). If the two-tailed P value was <0.05­(*), <0.01­(**), and <0.001­(***), then it can be considered that the data were significantly different.

3. Results and Discussion

3.1. Synthesis and Characterization of tFNAs and TAC

Figure 1A shows the synthesis of tFNAs and TAC. The values of tFANs are presented in the 8% PAGE band chart (Figure 1B). The increase in the zeta potential and size diameter of TAC shown in Figure 1C indicates that the compound is superimposed in volume and is more stable than tFNAs and antibiotics alone. The drug loading rate of antibiotics is 78.72 and 71.56% (Figure 1D). The AFM and TEM showed that tFNAs appear in an obtuse triangular shape, while TACs manifest the accumulation of particulate matter around and inside the tFNAs (Figure 1E,F).

Figure 1.

Figure 1

Open in a new tab

Characterization of tFNAs and TACs. (A) Schematic illustration synthesis of tFNAs and TACs. (B) Zeta potentials and size test. (C) Loading efficiency. (D) Polyacrylamide gel electrophoresis (PAGE). (E) AFM images of tFNAs and TACs. (F) TEM images of tFNAs and TACs.

3.2. Effective AntiDrug-Resistant Bacteria Activity of TACs in Vitro

The tFNAs with a concentration below 200 nM had no effect on the growth of the bacteria (Figure 2 A). MIC results (Figure 2B) showed that the MIC of TACs (MICTACs) was one-fourth of MICEry and one-half of MICAmp, respectively, which indicated that tFNAs could enhance the ability of antibiotic to inhibit bacteria and reduce the amount of antibiotics needed. The growth curve result was consistent with MIC (Figure 2C). In Figure 2D, colony formation was observed in the antibiotic group, while there was no colony formation in the TACs group. Furthermore, the inhibition ring experiment showed that the diameter of bacteriostatic ring in the TACs group was larger than that in the antibiotic-alone group. SEM observation was carried out to study the morphological changes of bacteria under the treatment of each group. As shown in Figure 2E, the bacteria treated with TACs was significantly inhibited and the morphological integrity was more damaged, compared with that of antibiotic group.

Figure 2.

Figure 2

Open in a new tab

Antibacterial activity of TACs on bacteria in vitro. (A) Effect of tFNAs on the proliferation of bacteria. (B) Minimal inhibition concentration (MIC) results. (C) Growth curve of bacteria. (D) Comparison of the plate colony count and bacteria inhibiting loop diameter of bacteria of each group. (E) SEM images.

3.3. Bacterial Uptake of tFNAs and TACs

Flow cytometry and a confocal laser microscope were used to measure the localization amount of tFNAs and TACs inside bacteria. The tFNAs and TACs carrying Cy5 emitted red fluorescence and living MRSA were stained to emit blue fluorescence. Living E. coli were stained to emit green fluorescence. Purple or yellow fluorescence appears in the merged image when tFNAs, TACs, and bacteria have a consistent location. The confocal laser microscope result showed that tFNAs could co-locate with MRSA, while TACs showed a higher affinity for MRSA (Figure 3 A). A large amount of yellow fluorescence was shown in E. coli in the merged image of the TACs group, which mean that TACs could enter E. coli efficiently (Figure 3B). Flow cytometry results indicated that TACs made use of the high cellular affinity of tFNAs itself to make bacteria have a better ability to take in the antibiotic (Figure 3C).

Figure 3.

Figure 3

Open in a new tab

Bacterial uptake of tFNAs and TACs. (A) Confocal laser scanning microscopy images of bacterial uptake of tFNAs and TACs in MRSA at 90 min. (B) Confocal laser scanning microscopy images of bacterial uptake of tFNAs and TACs at 90 min. (C) Flow cytometry analysis of the uptake rates of bacteria incubated with ssDNA, tFNAs, and TACs. The control group was the bacteria with no treatment; Statistical analysis (n = 3): ***, p < 0.001.

3.4. Biocompatibility and Distribution of TACs in Vivo

It can be seen from the cell morphology of immunofluorescence staining in Figure 4 A, tFNAs alone and TACs at concentrations below 50 μg/mL did not show cell inhibition on the growth of L929 cells treated for 24 and 48 h. Analysis of CCK-8 (Figure 4B) on cell proliferation was consistent with the above result, which indicated that tFNAs and TACs have favorable biocompatibility. After TACs were injected abdominal for 60 min, most of the drugs were concentrated in the abdominal cavity and metabolized by the kidney after 90 min. TACs injected subcutaneously began to reduce 40 min later and concentrated in the kidney 90 min later (Figure 4C). This suggests that TACs can rapidly gather in the infectional site, thus restricting their degradation in the liver and kidney.

Figure 4.

Figure 4

Open in a new tab

Cytotoxicity test and drug in vivo imaging of tFNAs and TACs. (A) Observation of L929 morphological change by fluorescent microscopy. (B) CCK-8 assay results. (C) Distribution of TACs in the mouse body and various organs by intraperitoneal injection and hypodermic injection respectively. Statistical analysis (n = 4): *, p < 0.05; **, p < 0.01.

3.5. Antisevere Infection Effect of TACs on Mice

The mortality rate of the low-dose TACs group was slightly higher than that of the Ery group, while that of the TACs group was the lowest (Figure 5 A). The body weight of mice within 0–48 h in each group was observed as shown in Figure 5B, the control group remained stable, while the NS group body continued to decrease. Mice treated with Ery, TACs, and low-dose TACs lost weight within the first 0–24 h, while the weight of mice in the TACs group began to recover from 24 to 48 h. The results of the routine blood examination were shown in Figure 5C. Compared with before treatment, the white blood cell count level and neutrophil proportion of the TACs group decreased most significantly after treatment. The results of CFU observation were shown in Figure 5D, the colony formation of the TACs group at 24 and 48 h is significantly less than that of the Ery group. The results of the ELISA analysis of inflammatory factors were shown in Figure 5E. The expression level of TNF-α of the TACs group and low-dose TACs group is lower than that of the Ery treatment group, the expression of IL-6 of the TACs group was significantly decreased compared with the Ery group, and the IL-10 expression level in the TACs group increased more significantly than that in the Ery group.

Figure 5.

Figure 5

Open in a new tab

Antisevere infection effect of TACs on mice abdominal infection model. (A) Mortality of abdominal infected mice in each group in 48 h. (B) Body weight changes of mice in each group. (C) Blood routine of mice was examined and the number and proportion of white blood cells were statistically analyzed. Data are presented as mean ± SD (n = 4). (D) Comparison of the plate colony count of bacteria of peritoneal fluid in each group at 24 and 48 h, respectively. (E) Expression levels of inflammatory factors (TNF-α, IL-6, IL-10) in serum were analyzed by ELISA. Data are presented as mean ± SD (n = 4). Statistical analysis: * p < 0.05, ** p < 0.01.

3.6. Anti-Infection and Heal-Promoting Effect of TACs on Mice

The blood routine result showed that the white blood cell level treated with Amp, TACs, and low-dose TACs decreased after treatment. Meanwhile, the neutrophil ratio in mice treated with each group decreased, and the decrease of TACs group was the most significant after treatment (Figure 6 B). The wound observation of each group (Figure 6A) showed that the wound in the NS group did not heal, and the healing of the TACs group was closer to that of the control group. HE staining was used to observe the histopathological changes of the incisions on the back of mice. It could be seen in Figure 6D that the epithelial cells in the control group were completely arranged and orderly, and no inflammatory cell infiltration was observed in the lamina layer, while no new epithelium was found in the NS group and a large amount of inflammatory exudate was observed. It can be observed that inflammatory cells infiltrated in the upper cortex, and more inflammatory cells clustered in the lamina layer in the Amp group, while a less number of inflammatory cells were observed in the upper cortex and more neovascularization was observed in the lamina layer of the TACs group. The ELISA analysis of inflammatory factors of each group is shown in Figure 6C, and the expression level of TNF-α in the TACs group and low-dose TACs group is lower than that in the Amp group. There was no significant difference in the IL-6 level between the three groups. For the changes of the IL-10 level, the value of the TACs group increased more significantly than that of the Amp treatment group.

Figure 6.

Figure 6

Open in a new tab

Therapeutic effect of mice skin incision infection. (A) General view of mice skin wound infection healing on day 1 and day 3 in each group. (B) Blood routine of mice was examined and the number and proportion of white blood cells were statistically analyzed. Data are presented as mean ± SD (n = 4). (C) Expression levels of inflammatory factors (TNF-α, IL-6, IL-10) in serum were analyzed by ELISA. Data are presented as mean ± SD (n = 4). Statistical analysis: * p < 0.05, *** p < 0.001. (D) Photomicrographs stained by HE at 5× magnification and 15× magnification. Tissue inflammation was analyzed by comparing the number of inflammatory cells.

Macrophages as cells reflecting inflammation have different phenotypes and functions in different reaction stages during the infection. They are mainly divided into M1 and M2 macrophages that are different in cell physiology and biochemistry. M1 macrophages stimulates the production of proinflammatory factors (TNF, IL-6, IL-12, and IL-15) through interferon-γ, acting in the early stage of inflammation that promotes the inflammatory process. M2 macrophages regulate the activation of TH-2 cytokines and immune complexes (CD163, mannose receptor, galactose-type receptor, IL-10, IL-8, McP-1, IP-10) that inhibit inflammatory progression and promote tissue repair in the late stage of inflammation. In this study, the expression of inflammatory factors in peripheral blood of mice treated with TACs showed the inhibition of M1 macrophage-related factors TNF-α and IL-6, and increased activation of the M2 macrophage-related factor IL-10. These results suggest that tFNAs may promote the effect of inhibiting inflammation by regulating the differentiation of M1 and M2 macrophages. Therefore, tFNAs as the vector of antibiotic, it is worth looking for more evidence on the reversing drug resistance and the immune regulation effect caused by tFNAs in future studies.

4. Conclusions

In conclusion, our study confirmed that antibiotic loading by tFNAs can improve the survival rate of severely infected mice and promote healing of localized infected mice, enhancing the anti-inflammatory effect. TAC proposed to the new idea and method for the treatment of infection, which has important theoretical significance and applicational prospect.

Acknowledgments

This work was financially supported by the National Key R&D Program of China [2019YFA0110600], National Natural Science Foundation of China [82201131, 81970917, 81970916, 81671031], Sichuan Science and Technology Program [2022NSFSC0002], Sichuan Province Youth Science and Technology Innovation Team [2022JDTD0021], Research and Develop Program, West China Hospital of Stomatology Sichuan University [RD03202302].

Author Contributions

The manuscript was written through contributions of all authors. All authors have given approval to the final version of the manuscript. The authors contributed equally.

Conflict of Interest

The authors declare no competing financial interest.

Fundings

National Natural Science Foundation of China 81671031

National Natural Science Foundation of China 81970916

National Natural Science Foundation of China 81970917

National Natural Science Foundation of China 82201131

Ministry of Science and Technology of the People's Republic of China 2019YFA0110600

References

  • 1.Chandra P., Mk U., Ke V., Mukhopadhyay C., U D.A., M S.R., V R. Antimicrobial resistance and the post antibiotic era: better late than never effort. Expert Opin. Drug Saf. 2021;20:1375–1390. doi: 10.1080/14740338.2021.1928633. 10.1080/14740338.2021.1928633 [DOI] [PubMed] [Google Scholar]
  • 2.Dahal D., Sundar S., Kullar R., Milevska-Kostova N., Dindial K. Antimicrobial resistance during the COVID-19 pandemic: the missing patient perspective. JAC-Antimicrob. Resist. 2021;3 doi: 10.1093/jacamr/dlab030. 10.1093/jacamr/dlab030 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Nieuwlaat R., Mbuagbaw L., Mertz D., Burrows L.L., Bowdish D.M.E., Moja L., Wright G.D., Schünemann H.J. Coronavirus Disease 2019 and Antimicrobial Resistance: Parallel and Interacting Health Emergencies. Clin. Infect. Dis. 2021;72:1657–1659. doi: 10.1093/cid/ciaa773. 10.1093/cid/ciaa773 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Krell T., Matilla M.A. Antimicrobial resistance: progress and challenges in antibiotic discovery and anti-infective therapy. Microb. Biotechnol. 2022;15:70–78. doi: 10.1111/1751-7915.13945. 10.1111/1751-7915.13945 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Morrison L., Zembower T.R. Antimicrobial Resistance. Gastrointest. Endosc. Clin. N. Am. 2020;30:619–635. doi: 10.1016/j.giec.2020.06.004. 10.1016/j.giec.2020.06.004 [DOI] [PubMed] [Google Scholar]
  • 6.Christaki E., Marcou M., Tofarides A. Antimicrobial Resistance in Bacteria: Mechanisms, Evolution, and Persistence. J. Mol. Evol. 2020;88:26–40. doi: 10.1007/s00239-019-09914-3. 10.1007/s00239-019-09914-3 [DOI] [PubMed] [Google Scholar]
  • 7.Ghosh S., Bornman C., Zafer M.M. Antimicrobial Resistance Threats in the emerging COVID-19 pandemic: Where do we stand? J. Infect. Public Health. 2021;14:555–560. doi: 10.1016/j.jiph.2021.02.011. 10.1016/j.jiph.2021.02.011 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Zhang T., Tian T., Lin Y. Functionalizing Framework Nucleic Acid-Based Nanostructures for Biomedical Application. Adv. Mater. 2022;34 doi: 10.1002/adma.202107820. 10.1002/adma.202107820 [DOI] [PubMed] [Google Scholar]
  • 9.Tian T., Xiao D., Zhang T., Li Y., Shi S., Zhong W., Gong P., Liu Z., Li Q., Lin Y. A Framework Nucleic Acid Based Robotic Nanobee for Active Targeting Therapy. Adv. Funct. Mater. 2021;31 10.1002/adfm.202007342 [Google Scholar]
  • 10.Ma W., Zhan Y., Zhang Y., Mao C., Xie X., Lin Y. The biological applications of DNA nanomaterials: current challenges and future directions. Signal Transduct. Target. Ther. 2021;6:351. doi: 10.1038/s41392-021-00727-9. 10.1038/s41392-021-00727-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Li J., Xiao L., Yan N., Li Y., Wang Y., Qin X., Zhao D., Liu M., Li N., Lin Y. The Neuroprotective Effect of MicroRNA-22-3p Modified Tetrahedral Framework Nucleic Acids on Damaged Retinal Neurons Via TrkB/BDNF Signaling Pathway. Adv. Funct. Mater. 2021;31 10.1002/adfm.202104141 [Google Scholar]
  • 12.Li J., Lai Y., Li M., Chen X., Zhou M., Wang W., Li J., Cui W., Zhang G., Wang K., Liu L., Lin Y. Repair of infected bone defect with Clindamycin-Tetrahedral DNA nanostructure Complex-loaded 3D bioprinted hybrid scaffold. Chem. Eng. J. 2022;435 10.1016/j.cej.2022.134855 [Google Scholar]
  • 13.Li J., Yao Y., Wang Y., Xu J., Zhao D., Liu M., Shi S., Lin Y. Modulation of the Crosstalk between Schwann Cells and Macrophages for Nerve Regeneration: A Therapeutic Strategy Based on a Multifunctional Tetrahedral Framework Nucleic Acids System. Adv. Mater. 2022;34 doi: 10.1002/adma.202202513. 10.1002/adma.202202513 [DOI] [PubMed] [Google Scholar]
  • 14.Zhang T., Zhou M., Xiao D., Liu Z., Jiang Y., Feng M., Lin Y., Cai X. Myelosuppression Alleviation and Hematopoietic Regeneration by Tetrahedral-Framework Nucleic-Acid Nanostructures Functionalized with Osteogenic Growth Peptide. Adv. Sci. 2022;9 doi: 10.1002/advs.202202058. 10.1002/advs.202202058 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Li Y., Zhou R., Xiao D., Shi S., Peng S., Wu S., Wu P., Lin Y. Polypeptide uploaded efficient nanophotosensitizers to overcome photodynamic resistance for enhanced anticancer therapy. Chem. Eng. J. 2021;403 10.1016/j.cej.2020.126344 [Google Scholar]
  • 16.Ma W., Yang Y., Zhu J., Jia W., Zhang T., Liu Z., Chen X., Lin Y. Biomimetic Nanoerythrosome-Coated Aptamer-DNA Tetrahedron/Maytansine Conjugates: pH-Responsive and Targeted Cytotoxicity for HER2-positive Breast Cancer. Adv. Mater. 2022;34 doi: 10.1002/adma.202109609. 10.1002/adma.202109609 [DOI] [PubMed] [Google Scholar]
  • 17.Zhang B., Tian T., Xiao D., Gao S., Cai X., Lin Y. Facilitating In Situ Tumor Imaging with a Tetrahedral DNA Framework-Enhanced Hybridization Chain Reaction Probe. Adv. Funct. Mater. 2022;32 10.1002/adfm.202109728 [Google Scholar]
  • 18.Gao Y., Chen X., Tian T., Zhang T., Gao S., Zhang X., Yao Y., Lin Y., Cai X. A Lysosome-Activated Tetrahedral Nanobox for Encapsulated siRNA Delivery. Adv. Mater. 2022;34 doi: 10.1002/adma.202201731. 10.1002/adma.202201731 [DOI] [PubMed] [Google Scholar]
  • 19.Li S., Liu Y., Zhang T., Lin S., Shi S., He J., Xie Y., Cai X., Tian T., Lin Y. A Tetrahedral Framework DNA-Based Bioswitchable miRNA Inhibitor Delivery System: Application to Skin Anti-Aging. Adv. Mater. 2022;34 doi: 10.1002/adma.202204287. 10.1002/adma.202204287 [DOI] [PubMed] [Google Scholar]
  • 20.Zhu J., Yang Y., Ma W., Wang Y., Chen L., Xiong H., Yin C., He Z., Fu W., Xu R., Lin Y. Antiepilepticus Effects of Tetrahedral Framework Nucleic Acid via Inhibition of Gliosis-Induced Downregulation of Glutamine Synthetase and Increased AMPAR Internalization in the Postsynaptic Membrane. Nano Lett. 2022;22:2381–2390. doi: 10.1021/acs.nanolett.2c00025. 10.1021/acs.nanolett.2c00025 [DOI] [PubMed] [Google Scholar]
  • 21.Sun Y., Liu Y., Zhang B., Shi S., Zhang T., Zhao D., Tian T., Li Q., Lin Y. Erythromycin loaded by tetrahedral framework nucleic acids are more antimicrobial sensitive against Escherichia coli (E. coli) Bioact. Mater. 2021;6:2281–2290. doi: 10.1016/j.bioactmat.2020.12.027. 10.1016/j.bioactmat.2020.12.027 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Li Y., Gao S., Shi S., Xiao D., Peng S., Gao Y., Zhu Y., Lin Y. Tetrahedral Framework Nucleic Acid-Based Delivery of Resveratrol Alleviates Insulin Resistance: From Innate to Adaptive Immunity. Nanomicro Lett. 2021;13:86. doi: 10.1007/s40820-021-00614-6. 10.1007/s40820-021-00614-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Gao S., Li Y., Xiao D., Zhou M., Cai X., Lin Y. Tetrahedral Framework Nucleic Acids Induce Immune Tolerance and Prevent the Onset of Type 1 Diabetes. Nano Lett. 2021;21:4437–4446. doi: 10.1021/acs.nanolett.1c01131. 10.1021/acs.nanolett.1c01131 [DOI] [PubMed] [Google Scholar]
  • 24.Cui W., Yang X., Chen X., Xiao D., Zhu J., Zhang M., Qin X., Ma X., Lin Y. Treating LRRK2-Related Parkinson’s Disease by Inhibiting the mTOR Signaling Pathway to Restore Autophagy. Adv. Funct. Mater. 2021;31 10.1002/adfm.202105152 [Google Scholar]
  • 25.Sun Y., Li S., Zhang Y., Li Q., Xie X., Zhao D., Tian T., Shi S., Meng L., Lin Y. Tetrahedral Framework Nucleic Acids Loading Ampicillin Improve the Drug Susceptibility against Methicillin-Resistant Staphylococcus aureus. ACS Appl. Mater. Interfaces. 2020;12:36957–36966. doi: 10.1021/acsami.0c11249. 10.1021/acsami.0c11249 [DOI] [PubMed] [Google Scholar]
  • 26.Liu Z., Chen X., Ma W., Gao Y., Yao Y., Li J., Zhang T., Qin X., Ge Y., Jiang Y., Lin Y. Suppression of Lipopolysaccharide-Induced Sepsis by Tetrahedral Framework Nucleic Acid Loaded with Quercetin. Adv. Funct. Mater. 2022;32 10.1002/adfm.202204587 [Google Scholar]
  • 27.Qin X., Xiao L., Li N., Hou C., Li W., Li J., Yan N., Lin Y. Tetrahedral framework nucleic acids-based delivery of microRNA-155 inhibits choroidal neovascularization by regulating the polarization of macrophages. Bioact. Mater. 2022;18:134–144. doi: 10.1016/j.bioactmat.2021.11.031. 10.1016/j.bioactmat.2021.11.031 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Li S., Liu Y., Tian T., Zhang T., Lin S., Zhou M., Zhang X., Lin Y., Cai X. Bioswitchable Delivery of microRNA by Framework Nucleic Acids: Application to Bone Regeneration. Small. 2021;17 doi: 10.1002/smll.202104359. 10.1002/smll.202104359 [DOI] [PubMed] [Google Scholar]
  • 29.Zhou M., Zhang T., Zhang B., Zhang X., Gao S., Zhang T., Li S., Cai X., Lin Y. A DNA Nanostructure-Based Neuroprotectant against Neuronal Apoptosis via Inhibiting Toll-like Receptor 2 Signaling Pathway in Acute Ischemic Stroke. ACS Nano. 2022;16:1456–1470. doi: 10.1021/acsnano.1c09626. 10.1021/acsnano.1c09626 [DOI] [PubMed] [Google Scholar]
  • 30.Fu W., Ma L., Ju Y., Xu J., Li H., Shi S., Zhang T., Zhou R., Zhu J., Xu R., You C., Lin Y. Therapeutic siCCR2 Loaded by Tetrahedral Framework DNA Nanorobotics in Therapy for Intracranial Hemorrhage. Adv. Funct. Mater. 2021;31 10.1002/adfm.202101435 [Google Scholar]
  • 31.Zhang Q., Lin S., Wang L., Peng S., Tian T., Li S., Xiao J., Lin Y. Tetrahedral framework nucleic acids act as antioxidants in acute kidney injury treatment. Chem. Eng. J. 2021;413 10.1016/j.cej.2020.127426 [Google Scholar]
  • 32.Zhang M., Zhang X., Tian T., Zhang Q., Wen Y., Zhu J., Xiao D., Cui W., Lin Y. Anti-inflammatory activity of curcumin-loaded tetrahedral framework nucleic acids on acute gouty arthritis. Bioact. Mater. 2022;8:368–380. doi: 10.1016/j.bioactmat.2021.06.003. 10.1016/j.bioactmat.2021.06.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Zhou M., Gao S., Zhang X., Zhang T., Zhang T., Tian T., Li S., Lin Y., Cai X. The protective effect of tetrahedral framework nucleic acids on periodontium under inflammatory conditions. Bioact. Mater. 2021;6:1676–1688. doi: 10.1016/j.bioactmat.2020.11.018. 10.1016/j.bioactmat.2020.11.018 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Biomacromolecules are provided here courtesy of Elsevier

RESOURCES