Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2023 Apr 3.
Published in final edited form as: Methods Mol Biol. 2023;2587:411–425. doi: 10.1007/978-1-0716-2772-3_21

CRISPR-Cas9 Correction of Duchenne Muscular Dystrophy in Mice by a Self-Complementary AAV Delivery System

Yu Zhang 1,2,3, Rhonda Bassel-Duby 4,5,6, Eric N Olson 7,8,9
PMCID: PMC10069557  NIHMSID: NIHMS1882839  PMID: 36401041

Abstract

Duchenne muscular dystrophy (DMD) is a fatal neuromuscular disorder, caused by mutations in the DMD gene coding dystrophin. Applying clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated proteins (CRISPR-Cas) for therapeutic gene editing represents a promising technology to correct this devastating disease through elimination of underlying genetic mutations. Adeno-associated virus (AAV) has been widely used for gene therapy due to its low immunogenicity and high tissue tropism. In particular, CRISPR-Cas9 gene editing components packaged by self-complementary AAV (scAAV) demonstrate robust viral transduction and efficient gene editing, enabling restoration of dystrophin expression throughout skeletal and cardiac muscle in animal models of DMD. Here, we describe protocols for cloning CRISPR single guide RNAs (sgRNAs) into a scAAV plasmid and procedures for systemic delivery of AAVs into a DMD mouse model. We also provide methodologies for quantification of dystrophin restoration after systemic CRISPR-Cas9–mediated correction of DMD.

Keywords: Gene editing, sgRNA, Adeno-associated virus, DMD mouse model, Dystrophin

1. Introduction

Duchenne muscular dystrophy (DMD) is a severe monogenic muscle disease, caused by mutations in the dystrophin gene located on the X chromosome [1, 2]. Dystrophin maintains muscle membrane integrity by linking the dystroglycan complex with the actin cytoskeleton [3, 4]. Absence of dystrophin in skeletal and cardiac muscle causes muscle degeneration and myocardial fibrosis, followed by respiratory and cardiac failure and, ultimately, premature death. There is no effective treatment for this debilitating disease. Numerous therapeutic approaches have been attempted to mitigate DMD disease progression, including corticosteroid supplementation, antisense oligonucleotide injection, and micro-dystrophin gene replacement [5,6,7]. However, none of these approaches enable correction of the underlying genetic mutation nor restore endogenous dystrophin expression. At present, the lack of transformative treatment emphasizes the need for development of new therapeutic approaches for DMD.

Gene editing by clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated proteins (CRISPR-Cas) offers the ability to precisely and efficiently modify the genome and correct disease-causing mutations [8,9,10]. With this approach, Cas9 nuclease is directed to a specific genomic locus through interaction with a single guide RNA (sgRNA) that anneals to complementary DNA sequences [8,9,10,11,12]. If the target DNA sequence is immediately followed by a protospacer adjacent motif (PAM), the RNA-guided nuclease generates DNA double-stranded breaks (DSBs). Depending on the cell type, CRISPR-Cas9-induced DSBs can be repaired by three distinct DNA repair pathways, including homology-directed repair (HDR), classical nonhomologous end joining (C-NHEJ), and microhomology-mediated end joining (MMEJ). HDR is confined to proliferating cells and requires a DNA repair template. Although HDR generates a precise modification at the target locus, this pathway is not feasible for correcting DMD mutations in vivo since skeletal and cardiac muscles are post-mitotic. Alternatively, DNA DSBs can be repaired by C-NHEJ when there is no sequence microhomology present at the breakage point, or by MMEJ when there are 2–25 base pairs of microhomology on each side of the DSB [13, 14]. The latter two DNA repair pathways occur in both proliferating and post-mitotic cells and can be adapted to correct DMD mutations in vivo.

There are several aspects of DMD that make it suitable for CRISPR-Cas9 therapeutic gene editing [15,16,17]. First, the central rod domain of the dystrophin protein is mainly composed of spectrin-like repeats. In-frame deletion of this modular structure converts DMD to Becker muscular dystrophy (BMD), which is a relatively mild form of muscular dystrophy. Second, the location of the DMD gene on the X chromosome only requires gene editing of a single mutant allele in affected boys, precluding potential off-target mutagenesis of the wild-type allele. Third, unlike toxic gain-of-function or dominant negative mutations, which require near-complete correction or elimination of the mutant allele, DMD is caused by a loss-of-function mutation of the dystrophin gene. Studies in patients with BMD have estimated that ~20% of normal levels of dystrophin protein could significantly slow disease progression [18]. Therefore, gene editing of a relatively small fraction of the mutant allele is sufficient to confer therapeutic benefits.

Using adeno-associated virus (AAV) as a delivery tool, we and others performed CRISPR-Cas9-mediated gene editing in animal models of DMD [19,20,21,22,23,24,25,26,27,28,29,30]. C-NHEJ or MMEJ-induced insertions and deletions (INDELs) reframed or skipped the mutant Dmd exon and subsequently restored the open reading frame of the dystrophin gene. Gene-edited animals restored dystrophin expression and demonstrated functional improvement in skeletal muscle and heart. Moreover, sustained dystrophin expression can be observed in DMD mice for 12–18 months after a single systemic dose of AAV9-encoded Cas9 [23, 28].

However, several studies demonstrated that single-stranded AAV (ssAAV)-delivered CRISPR sgRNA was a rate limiting factor for in vivo gene editing, and there was a preferential depletion of CRISPR sgRNA compared to Cas9 nuclease [23, 26]. To address this issue, we adapted the self-complementary AAV (scAAV) system to deliver CRISPR sgRNAs for in vivo gene editing [25, 31]. scAAV has a mutation in one end of the inverted terminal repeat (ITR) and carries a double-stranded viral genome [32]. This property allows scAAV to bypass second-strand synthesis, which is a rate-limiting step for gene expression from ssAAV [33, 34]. Moreover, double-stranded scAAV is more resistant to DNA degradation, thereby sustaining more copies of stable episomes after viral transduction [35, 36]. DMD mice receiving a systemic injection of scAAV-sgRNAs showed higher gene editing and dystrophin restoration compared to ssAAV-treated cohorts [35, 36]. Thus, CRISPR-Cas gene editing components delivered by scAAV can be deployed to correct diverse DMD mutations and offer the prospect of a potential gene therapy for the permanent correction of other genetic diseases.

In this chapter, we describe protocols for cloning CRISPR sgRNAs into a scAAV plasmid and procedures for systemic delivery of AAVs into a DMD mouse model. We also provide methodologies for quantification of dystrophin restoration after systemic CRISPR-Cas9–mediated correction of DMD.

2. Materials

2.1. Reagents for Cloning CRISPR sgRNAs into scAAV Plasmid

  1. Oligonucleotides (Integrated DNA Technologies).

  2. NEBuffer 2 (10×) (New England Biolab).

  3. Tango Buffer (10×) (Thermo Fisher Scientific).

  4. Dithiothreitol (DTT) (Thermo Fisher Scientific).

  5. ATP (10 mM) (Thermo Fisher Scientific).

  6. FastDigest Esp3I (Thermo Fisher Scientific).

  7. FastDigest BpiI (Thermo Fisher Scientific).

  8. T4 DNA ligase (New England Biolab).

  9. One Shot Stbl3™ Chemically Competent E. coli (Thermo Fisher Scientific).

  10. S.O.C. Medium (Thermo Fisher Scientific).

  11. Chloramphenicol (Sigma-Aldrich).

  12. Ampicillin (Sigma-Aldrich).

  13. Glycerol (Sigma-Aldrich).

  14. Qiaprep Spin Miniprep Kit (QIAGEN).

  15. NucleoBond PC 500 Maxiprep Kit (MACHEREY-NAGEL).

  16. AhdI (New England Biolab).

  17. CutSmart Buffer (New England Biolab).

  18. Standard DNA gel electrophoresis equipment and reagents.

2.2. Reagents for Injecting AAV CRISPR-Cas9 into DMD Mice

  1. Ultrafine insulin syringe (Becton, Dickinson and Company).

  2. Sodium chloride solution 0.9% in water (Sigma-Aldrich).

2.3. Reagents for Skeletal and Cardiac Muscle Dystrophin Western Blot Analysis

  1. Liquid nitrogen.

  2. Bessman Tissue Pulverizer (Repligen).

  3. Protein lysis buffer (10% SDS, 62.5 mM Tris–HCl pH 6.8, 1 mM EDTA, protease inhibitor).

  4. Pellet Pestle and Motor (Fisher Scientific)..

  5. 1-mL syringe (Becton, Dickinson and Company).

  6. 22 and 27 gauge needles (Becton, Dickinson and Company).

  7. Pierce BCA Protein Assay Kit (Thermo Fisher Scientific).

  8. 4× Laemmli Sample Buffer (Bio-Rad).

  9. β-mercaptoethanol (Sigma-Aldrich).

  10. 4–20% Criterion™ TGX™ Precast Protein Gel (Bio-Rad).

  11. Protein ladder (Bio-Rad).

  12. Running buffer (25 mM Tris–HCl, 192 mM glycine, 0.1% SDS, pH 8.3).

  13. PVDF membrane (Bio-Rad)

  14. Transfer buffer (25 mM Tris–HCl, 192 mM glycine, 0.1% SDS, 20% methanol, pH 8.3).

  15. Tris-buffered saline (TBS, pH 7.5).

  16. Blocking buffer (5% w/v nonfat dry milk, 1× TBS, 0.1% Tween-20).

  17. Wash buffer (0.1% Tween-20 in TBS).

  18. Mouse anti-dystrophin antibody (MANDYS8, Sigma-Aldrich).

  19. Mouse anti-vinculin antibody (V9131, Sigma-Aldrich).

  20. Goat anti-mouse IgG (H+L)-HRP antibody (Bio-Rad).

  21. Western Blotting Luminol Reagent (Santa Cruz).

2.4. Reagents for Skeletal and Cardiac Muscle Dystrophin Immunostaining

  1. Gum tragacanth (Sigma-Aldrich).

  2. Tissue-Tek® O.C.T. tissue freezing compound (SAKURA).

  3. Liquid nitrogen.

  4. Isopentane (Sigma-Aldrich).

  5. Hydrophobic pen.

  6. Phosphate-buffered saline (PBS, pH 7.4) (Sigma-Aldrich).

  7. Triton X-100 (Sigma-Aldrich).

  8. M.O.M.® (Mouse on Mouse) Immunodetection kit containing blocking reagent, protein concentrate, and biotinylated anti-mouse IgG reagent (Vector Laboratories).

  9. Mouse anti-dystrophin primary antibody (MANDYS8, Sigma-Aldrich).

  10. Rabbit anti-laminin Laminin primary antibody (Sigma-Aldrich, L9393).

  11. Fluorescein Avidin D, FITC (Vector Laboratories).

  12. Goat anti-rabbit IgG (H+L) secondary antibody conjugated with Alexa Fluor® 555 (Thermo Fisher Scientific).

  13. DAPI (Sigma-Aldrich).

  14. Shandon Immu-mount (Fisher Scientific).

3. Methods

3.1. Generating scAAV with Multiplexed CRISPR sgRNAs

Cloning CRISPR sgRNAs into the scAAV vector relies on two steps of Golden Gate Assembly. The first step is to clone the annealed sgRNA oligonucleotides into three donor plasmids using Esp3I (BsmBI)-mediated Golden Gate Assembly. The donor plasmids do not carry AAV ITRs, which prevents potential sequence recombination during assembly. The second step is to subclone the U6, H1, and 7SK sgRNA expression cassettes from each donor plasmid into the scAAV vector using BpiI (BbsI)-mediated Golden Gate Assembly.

3.1.1. Ordering and Annealing CRISPR sgRNA Oligonucleotides

  1. Order CRISPR sgRNA oligonucleotides with adaptor sequences for the donor plasmid:

    Forward oligonucleotides : 5′– CACCG(N)20 – 3′

    Reverse oligonucleotides : 5′– AAAC(N)20C – 3′

  2. Anneal CRISPR sgRNA oligonucleotides as indicated in Table 1 and incubate in a thermocycler: (95 °C for 5 min, cool down to 25 °C at 5 °C/min). Dilute the annealed oligonucleotides 1:200 in water.

Table 1.

CRISPR sgRNA oligonucleotide annealing reaction

Components Amount
Forward oligonucleotides (100 μM) 1 μL
Reverse oligonucleotides (100 μM) 1 μL
NEBuffer 2 (10×) 1 μL
ddH2O 7 μL
Total 10 μL
Open in a new tab

3.1.2. Golden Gate Assembly of CRISPR sgRNAs into Donor Plasmids

There are three independent donor plasmids with each carrying a unique RNA polymerase III promoter (U6, H1, and 7SK) to drive sgRNA expression (Fig. 1). Each donor plasmid carries a negative selection gene ccdB and a chloramphenicol resistance gene (see Note 1). CRISPR sgRNA must be cloned into these donor plasmids separately.

Fig. 1.

Fig. 1

Open in a new tab

Assembly of CRISPR sgRNAs into donor plasmids. Annealed CRISPR sgRNA oligos are cloned into three independent donor plasmids using Esp3I-mediated Golden Gate Assembly method. Each donor plasmid contains a unique RNA polymerase III promoter, U6, H1, and 7SK. ccdB is a negative selection gene to prevent unassembled plasmid from being transformed into E. coli. Chloramphenicol is the antibiotic resistance gene. Blue triangle depicts Esp3I restriction enzyme recognition site. Red triangle depicts BpiI restriction enzyme recognition site

  1. Set up three independent Golden Gate Assembly reactions as indicated in Table 2 and incubate the reaction mixture in a thermocycler: (37 °C for 5 min followed by 21 °C for 5 min (6 cycles), 65 °C for 10 min to denature the restriction enzyme and ligase, cool down to 4 °C).

  2. Transform 50 μL of One Shot Stbl3™ Chemically Competent E. coli with 5 μL of assembled mixture. Incubate on ice for 30 min followed by heat shock at 42 °C for 30 s.

  3. Recover the Stbl3™ E. coli in 450 μL of S.O.C. medium and place on a shaker for 45 min (300 RPM, 37 °C).

  4. Plate the Stbl3™ E. coli on LB agar plate containing 25 μg/mL of chloramphenicol and incubate at 37 °C overnight.

  5. The next day, pick three colonies and culture each colony in 5 mL of LB broth with 25 μg/mL of chloramphenicol at 37 °C overnight.

  6. Isolate donor plasmid from bacterial culture using Qiaprep Spin Miniprep Kit according to the manufacturer’s protocol.

  7. Confirm assembly of CRISPR sgRNA into donor plasmid by Sanger sequencing using primer:

    5′– GTATGTTGTGTGGAATTGTGAG – 3′

  8. Donor plasmids assembled with CRISPR sgRNA can be stored at −20 °C.

Table 2.

Golden Gate Assembly of CRISPR sgRNAs into donor plasmids

Components Amount
Donor plasmid (U6 or H1 or 7SK) (100 ng/μL) 1 μL
Annealed sgRNA oligonucleotides (1:200 diluted) 2 μL
Tango buffer (10×) 2 μL
DTT (10 mM) 1 μL
ATP (10 mM) 1 μL
FastDigest Esp3I restriction enzyme 1 μL
T4 DNA ligase 1 μL
ddH2O 11 μL
Total 20 μL
Open in a new tab

3.1.3. Golden Gate Assembly of CRISPR sgRNAs into scAAV Vector

The second round of Golden Gate Assembly aims to subclone CRISPR sgRNAs from each donor plasmid into the scAAV vector (Fig. 2). The scAAV plasmid carries a negative selection gene ccdB and an ampicillin resistance gene (see Note 1). The fully assembled scAAV plasmid carries three copies of the same CRISPR sgRNA driven by three independent RNA polymerase III promoters U6, H1, and 7SK.

Fig. 2.

Fig. 2

Open in a new tab

Assembly of CRISPR sgRNAs into scAAV plasmid. A CRISPR sgRNA is cloned into three independent donor plasmids, digested with BpiI, and cloned into scAAV plasmid using Golden Gate Assembly method. ccdB is a negative selection gene to prevent unassembled plasmid from being transformed in E. coli. Chloramphenicol and ampicillin are antibiotic resistance genes used in donor plasmids and scAAV plasmid, respectively. Red triangle indicates the BpiI restriction enzyme recognition site

  1. Set up Golden Gate Assembly reactions as indicated in Table 3 and incubate the reaction mixture in a thermocycler: (37 °C for 5 min followed by 21 °C for 5 min (6 cycles), 65 °C for 10 min to denature the restriction enzyme and ligase, cool down to 4 °C).

  2. Transform 50 μL of One Shot Stbl3™ Chemically Competent E. coli (see Note 2) with 5 μL of assembled mixture. Incubate on ice for 30 min followed by heat shock at 42 °C for 30 s.

  3. Recover the Stbl3™ E. coli in 450 μL of S.O.C. medium and place on a shaker for 45 min (300 RPM, 37 °C).

  4. Plate the Stbl3™ E. coli on LB agar plate containing 50 μg/mL of ampicillin and incubate at 37 °C overnight.

  5. The next day, pick several colonies and culture each colony in 5 mL of LB broth with 50 μg/mL of ampicillin at 37 °C for 12–14 h (see Note 3).

  6. Isolate the scAAV plasmid from a bacterial culture using Qiaprep Spin Miniprep Kit according to the manufacturer’s protocol.

  7. Confirm assembly of three copies of the CRISPR sgRNA into scAAV plasmid by Sanger sequencing using primers (see Note 4):

    U6 forward primer 5′– GAGGGCCTATTTCCCATGATTCC – 3′

    H1 forward primer 5′– TGTCGCTATGTGTTCTGGGAAATCA – 3′

  8. Perform AhdI restriction digestion of sequence confirmed plasmid to ensure that ITRs of scAAV plasmid are maintained without significant recombination (Fig. 3) (see Note 5).

  9. For scAAV plasmid with correctly assembled CRISPR sgRNAs and intact ITRs, generate glycerol stock from the corresponding bacterial culture by mixing 500 μL of the bacterial culture with 500 μL of 50% glycerol. Store at −80 °C for long-term storage.

  10. Set up a large-scale bacterial culture from the glycerol stock and purify at least 500 μg of the scAAV plasmid using a maxiprep kit.

  11. Perform AhdI restriction digestion of plasmid from maxiprep to ensure that ITRs of scAAV plasmid are maintained without significant recombination.

  12. Produce scAAV with multiplexed CRISPR sgRNAs (see Note 6).

Table 3.

Golden Gate Assembly of CRISPR sgRNAs into scAAV plasmid

Components Amount
Donor plasmid 1 (U6-sgRNA) (50 ng/μL) 1 μL
Donor plasmid 2 (H1-sgRNA) (50 ng/μL) 1 μL
Donor plasmid 3 (7SK-sgRNA) (50 ng/μL) 1 μL
scAAV plasmid (50 ng/μL) 1 μL
Tango buffer (10×) 2 μL
DTT (10 mM) 1 μL
ATP (10 mM) 1 μL
FastDigest Bpil restriction enzyme 1 μL
T4 DNA ligase 1 μL
ddH2O 10 μL
Total 20 μL
Open in a new tab
Fig. 3.

Fig. 3

Open in a new tab

AhdI restriction digestion of the scAAV plasmid. The scAAV plasmid contains three AhdI recognition sites, which are located in the two ITR regions and the ampicillin resistant gene. Restriction digestion of the scAAV plasmid using AhdI enzyme generates three bands after 1.5% agarose gel electrophoresis. The upper band above the three AhdI-digested bands indicates loss of ITR. Typically, a scAAV plasmid with less than 10% ITR recombination is recommended to be used for AAV packaging

3.2. In Vivo CRISPR-Cas9 Gene Editing of DMD Mice Using scAAV

In vivo CRISPR-Cas9-mediated correction of Dmd mutation in mice requires systemic injection of two AAVs into postnatal DMD mice. The first AAV is a single-stranded AAV encoding Streptococcus pyogenes Cas9 (SpCas9), and the second AAV is a double-stranded scAAV expressing three copies of the CRISPR sgRNA.

  1. Weigh postnatal day 4 (P4) DMD mice and calculate total amount of AAVs used for injection. For each mouse, 1 × 1014 vg/kg of ssAAV-SpCas9 and 1 × 1014 vg/kg of scAAV-sgRNAs is recommended to achieve efficient in vivo gene editing.

  2. Prepare AAV injection mixture by diluting ssAAV-SpCas9 and scAAV-sgRNAs with saline to achieve total volume of 100 μL.

  3. Inject AAV mixtures intraperitoneally (IP) into P4 DMD mice using an insulin syringe.

  4. Muscle harvested from CRISPR gene edited DMD mice can be used to quantify dystrophin restoration at 4 weeks post-IP injection.

3.3. Quantification of Dystrophin Restoration in DMD Mice After Systemic AAV CRISPR Gene Editing

Many assays can be used to assess dystrophin restoration in DMD mice after systemic administration of AAV CRISPR gene editing components. Western blot analysis is performed to quantitatively measure the percentage of dystrophin protein restoration in skeletal muscles and heart. Immunostaining is performed to quantify the percentage of myofibers or cardiomyocytes expressing dystrophin protein.

3.3.1. Skeletal and Cardiac Muscle Dystrophin Western Blot Analysis

  1. Euthanize mouse and harvest skeletal muscles and hearts from AAV CRISPR gene edited DMD mice (see Note 7).

  2. Freeze muscle samples in liquid nitrogen. Pulverize frozen muscle samples into fine powder using liquid nitrogen cooled tissue pulverizer (see Note 8).

  3. Lyse pulverized muscle samples in 250 μL lysis buffer. Use a Pellet Pestle Motor to homogenize the protein lysate for 20 s.

  4. Pass the protein lysate through a 22-gauge needle for ten times. Repeat with a 27-gauge needle for ten times.

  5. Measure protein concentration using Pierce BCA Protein Assay Kit according to the manufacturer’s protocol.

  6. Prepare protein sample by mixing 50 μg of total protein with 4× Laemmli sample buffer (containing 5% β-mercaptoethanol) to achieve a final volume of 20 μL. Boil protein samples at 95 °C for 5 min. Store the protein sample at −80 °C if not using it immediately.

  7. Load 50 μg of total protein in 4–20% 10-well or 18-well Criterion™ TGX™ Precast Protein Gel. Run the SDS-PAGE at 80 V for 30 min followed by 130 V for 2 h.

  8. Transfer the protein to PVDF membrane using the wet transfer method (see Note 9).

  9. Block the PVDF membrane in blocking buffer at room temperature for 1 h.

  10. Incubate the PVDF membrane with mouse anti-dystrophin antibody (1:1000) at 4 °C overnight.

  11. Wash the PVDF membrane with TBST buffer three times.

  12. Incubate the PVDF membrane with goat anti-mouse IgG (H+L)-HRP antibody (1:10,000) at room temperature for 1 h. Wash the PVDF membrane with TBST buffer three times.

  13. Develop the PVDF membrane using Western Blotting Luminol Reagent according to the manufacturer’s protocol. Detect dystrophin protein using either X-ray film or digital imaging.

  14. Use stripping buffer to remove the antibodies from the PVDF membrane.

  15. Re-block the PVDF membrane in blocking buffer at room temperature for 1 h.

  16. Incubate the PVDF membrane with mouse anti-vinculin antibody (1:1000) at room temperature for 1 h, followed by washing the PVDF membrane with TBST buffer three times.

  17. Incubate the PVDF membrane with goat anti-mouse IgG (H+L)-HRP antibody (1:10,000) at room temperature for 1 h. Wash the PVDF membrane with TBST buffer three times.

  18. Develop the PVDF membrane using Western Blotting Luminol Reagent according to the manufacturer’s protocol. Detect vinculin protein using either X-ray film or digital imaging.

3.3.2. Skeletal and Cardiac Muscle Dystrophin Immunostaining

  1. Embed skeletal muscles of AAV CRISPR edited DMD mice in a 1:2 volume mixture of gum tragacanth and tissue-freezing compound. Submerge heart in tissue-freezing compound.

  2. Snap freeze the embedded skeletal muscles and heart in supercooled isopentane to −155 °C and store at −80 °C for long-term storage.

  3. Perform cryosectioning of skeletal muscles and heart (eight-micron transverse sections) using a cryostat.

  4. Air dry the cryosections at room temperature for 20 min.

  5. Use a hydrophobic pen to draw a water-repellent barrier around the muscle sections.

  6. Rehydrate and delipidate muscle sections with 1% Triton X-100 in phosphate buffered saline (PBS; pH 7.4) for 30 min.

  7. Wash muscle sections with PBS three times (5 min each wash).

  8. Block muscle sections with M.O.M IgG Blocking Reagent (two drops of M.O.M Blocking Reagent stock solution in 2.5 mL of PBS) at room temperature for 1 h.

  9. Wash muscle sections with PBS twice (2 min each wash).

  10. Equilibrate muscle sections with M.O.M diluent (600 μL of M.O.M Protein Concentrate stock solution to 7.5 mL of PBS) at room temperature for 5 min.

  11. Incubate muscle sections with mouse anti-dystrophin primary antibody (1:500) and rabbit anti-laminin primary antibody (1:500) dissolved in M.O.M diluent at room temperature for 1 h (see Note 10).

  12. Wash muscle sections with PBS twice (2 min each wash).

  13. Incubate muscle sections with M.O.M biotinylated anti-mouse IgG reagent (1:250) dissolved in M.O.M diluent at room temperature for 10 min.

  14. Wash muscle sections with PBS three times (5 min each wash).

  15. Incubate muscle sections with Avidin D conjugated with FITC (1:250), goat anti-rabbit IgG secondary antibody conjugated with Alexa Fluor 555 (1:500), and DAPI (1:250) dissolved in M.O.M diluent at room temperature for 30 min.

  16. Wash muscle sections with PBS three times (5 min each wash).

  17. Mount the slides and detect dystrophin expression using a fluorescent microscope.

4. Notes

  1. ccdB is a lethal gene that targets E. coli DNA gyrase. Propagation of the original donor plasmid and scAAV plasmid requires ccdB-resistant E. coli strain.

  2. scAAV plasmid contains ITRs, which is prone to DNA recombination. It is recommended to use recombination defective E. coli strain to propagate AAV plasmid.

  3. Culturing E. coli transformed with AAV plasmid should not exceed over 14 h. This is because AAV ITRs are unstable in E. coli and plasmids that lose the ITRs have a replication advantage in transformed cells.

  4. U6 forward sequencing primer primes at the U6 promoter and can be used to confirm CRISPR sgRNA cloned after the U6 and H1 promoters. H1 forward sequencing primer primes at the H1 promoter and can be used to confirm CRISPR sgRNA cloned after the H1 and 7SK promoters.

  5. AhdI cuts at two ITRs and the ampicillin resistant gene, which digests scAAV plasmid into three fragments. Loss of AAV ITRs results in an undigested upper band (Fig. 3). Plasmids with significant ITR recombination cannot be used to package AAV. Typically, scAAV plasmid with less than 10% ITR recombination is recommended to be used for AAV packaging.

  6. We recommend packaging scAAV using a Viral Core facility or commercial vendor to ensure that both AAV purity and titer meets standard in vivo application.

  7. Muscles from one side of the limb can be used for biochemical analysis, such as genomic DNA, RNA, and protein analysis. Muscles from the contralateral limb can be used for histological analysis, such as immunostaining, hematoxylin, and eosin staining. Diaphragm and heart can be cut into two parts for biochemical and histological analysis.

  8. Pulverized muscle samples can be divided into three parts for isolating genomic DNA (20% of total sample), RNA (40% of total sample), and protein (40% of total sample).

  9. We recommend using the wet transfer method for transferring large molecular weight proteins. Keep transfer buffer and apparatus in the cold room. The recommended transfer condition is 100 V for 1.5 h.

  10. Alternatively, incubate muscle sections with mouse anti-dystrophin primary antibody (1:1500) and rabbit anti-laminin primary antibody (1:1500) dissolved in M.O.M diluent at 4 °C overnight.

Acknowledgments

We thank J. Cabrera for graphics and H. Li and E. Sanchez-Ortiz for providing insight to this manuscript. This work was supported by the NIH (grants HL130253), the Senator Paul D. Wellstone Muscular Dystrophy Specialized Research Center (grant P50 HD 087351), and the Robert A. Welch Foundation (grant 1-0025 to E.N.O.).

Contributor Information

Yu Zhang, Department of Molecular Biology, University of Texas Southwestern Medical Center, Dallas, TX, USA; Hamon Center for Regenerative Science and Medicine, University of Texas Southwestern Medical Center, Dallas, TX, USA; Senator Paul D. Wellstone Muscular Dystrophy Specialized Research Center, University of Texas Southwestern Medical Center, Dallas, TX, USA.

Rhonda Bassel-Duby, Department of Molecular Biology, University of Texas Southwestern Medical Center, Dallas, TX, USA; Hamon Center for Regenerative Science and Medicine, University of Texas Southwestern Medical Center, Dallas, TX, USA; Senator Paul D. Wellstone Muscular Dystrophy Specialized Research Center, University of Texas Southwestern Medical Center, Dallas, TX, USA.

Eric N. Olson, Department of Molecular Biology, University of Texas Southwestern Medical Center, Dallas, TX, USA Hamon Center for Regenerative Science and Medicine, University of Texas Southwestern Medical Center, Dallas, TX, USA; Senator Paul D. Wellstone Muscular Dystrophy Specialized Research Center, University of Texas Southwestern Medical Center, Dallas, TX, USA.

References

  • 1.Hoffman EP, Brown RH Jr, Kunkel LM (1987) Dystrophin: the protein product of the Duchenne muscular dystrophy locus. Cell 51(6):919–928 [DOI] [PubMed] [Google Scholar]
  • 2.Koenig M, Hoffman EP, Bertelson CJ et al. (1987) Complete cloning of the Duchenne muscular dystrophy (DMD) cDNA and preliminary genomic organization of the DMD gene in normal and affected individuals. Cell 50(3):509–517 [DOI] [PubMed] [Google Scholar]
  • 3.Gao QQ, McNally EM (2015) The dystrophin complex: structure, function, and implications for therapy. Compr Physiol 5(3):1223–1239. 10.1002/cphy.c140048 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Guiraud S, Aartsma-Rus A, Vieira NM et al. (2015) The pathogenesis and therapy of muscular dystrophies. Annu Rev Genomics Hum Genet 16:281–308. 10.1146/annurev-genom-090314-025003 [DOI] [PubMed] [Google Scholar]
  • 5.Quattrocelli M, Zelikovich AS, Jiang Z et al. (2019) Pulsed glucocorticoids enhance dystrophic muscle performance through epigenetic-metabolic reprogramming. JCI Insight 4(24). 10.1172/jci.insight.132402 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Lim KR, Maruyama R, Yokota T (2017) Eteplirsen in the treatment of Duchenne muscular dystrophy. Drug Des Devel Ther 11:533–545. 10.2147/DDDT.S97635 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Duan D (2018) Systemic AAV micro-dystrophin gene therapy for Duchenne muscular dystrophy. Mol Ther 26(10):2337–2356. 10.1016/j.ymthe.2018.07.011 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Cong L, Ran FA, Cox D et al. (2013) Multiplex genome engineering using CRISPR/Cas systems. Science 339(6121):819–823. 10.1126/science.1231143 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Jinek M, Chylinski K, Fonfara I et al. (2012) A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337(6096):816–821. 10.1126/science.1225829 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Mali P, Yang L, Esvelt KM et al. (2013) RNA-guided human genome engineering via Cas9. Science 339(6121):823–826. 10.1126/science.1232033 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Ran FA, Cong L, Yan WX et al. (2015) In vivo genome editing using Staphylococcus aureus Cas9. Nature 520(7546):186–191. 10.1038/nature14299 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Zetsche B, Gootenberg JS, Abudayyeh OO et al. (2015) Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system. Cell 163(3):759–771. 10.1016/j.cell.2015.09.038 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Iyer S, Suresh S, Guo D et al. (2019) Precise therapeutic gene correction by a simple nuclease-induced double-stranded break. Nature 568(7753):561–565. 10.1038/s41586-019-1076-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Gallagher DN, Haber JE (2018) Repair of a site-specific DNA cleavage: old-school lessons for Cas9-mediated gene editing. ACS Chem Biol 13(2):397–405. 10.1021/acschembio.7b00760 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Chemello F, Bassel-Duby R, Olson EN (2020) Correction of muscular dystrophies by CRISPR gene editing. J Clin Invest 130(6):2766–2776. 10.1172/JCI136873 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Min YL, Bassel-Duby R, Olson EN (2019) CRISPR correction of Duchenne muscular dystrophy. Annu Rev Med 70:239–255. 10.1146/annurev-med-081117-010451 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Zhang Y, Long C, Bassel-Duby R et al. (2018) Myoediting: toward prevention of muscular dystrophy by therapeutic genome editing. Physiol Rev 98(3):1205–1240. 10.1152/physrev.00046.2017 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Hoffman EP, Kunkel LM, Angelini C et al. (1989) Improved diagnosis of Becker muscular dystrophy by dystrophin testing. Neurology 39(8):1011–1017. 10.1212/wnl.39.8.1011 [DOI] [PubMed] [Google Scholar]
  • 19.Amoasii L, Hildyard JCW, Li H et al. (2018) Gene editing restores dystrophin expression in a canine model of Duchenne muscular dystrophy. Science 362(6410):86–91. 10.1126/science.aau1549 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Amoasii L, Li H, Zhang Y et al. (2019) In vivo non-invasive monitoring of dystrophin correction in a new Duchenne muscular dystrophy reporter mouse. Nat Commun 10(1):4537. 10.1038/s41467-019-12335-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Amoasii L, Long C, Li H et al. (2017) Single-cut genome editing restores dystrophin expression in a new mouse model of muscular dystrophy. Sci Transl Med 9(418). 10.1126/scitranslmed.aan8081 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Bengtsson NE, Hall JK, Odom GL et al. (2017) Muscle-specific CRISPR/Cas9 dystrophin gene editing ameliorates pathophysiology in a mouse model for Duchenne muscular dystrophy. Nat Commun 8:14454. 10.1038/ncomms14454 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Hakim CH, Wasala NB, Nelson CE et al. (2018) AAV CRISPR editing rescues cardiac and muscle function for 18 months in dystrophic mice. JCI Insight 3(23). 10.1172/jci.insight.124297 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Long C, Amoasii L, Mireault AA et al. (2016) Postnatal genome editing partially restores dystrophin expression in a mouse model of muscular dystrophy. Science 351(6271):400–403. 10.1126/science.aad5725 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Min YL, Chemello F, Li H et al. (2020) Correction of three prominent mutations in mouse and human models of Duchenne muscular dystrophy by single-cut genome editing. Mol Ther 28(9):2044–2055. 10.1016/j.ymthe.2020.05.024 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Min YL, Li H, Rodriguez-Caycedo C et al. (2019) CRISPR-Cas9 corrects Duchenne muscular dystrophy exon 44 deletion mutations in mice and human cells. Sci Adv 5(3):eaav4324. 10.1126/sciadv.aav4324 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Nelson CE, Hakim CH, Ousterout DG et al. (2016) In vivo genome editing improves muscle function in a mouse model of Duchenne muscular dystrophy. Science 351(6271):403–407. 10.1126/science.aad5143 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Nelson CE, Wu Y, Gemberling MP et al. (2019) Long-term evaluation of AAV-CRISPR genome editing for Duchenne muscular dystrophy. Nat Med 25(3):427–432. 10.1038/s41591-019-0344-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Tabebordbar M, Zhu K, Cheng JKW et al. (2016) In vivo gene editing in dystrophic mouse muscle and muscle stem cells. Science 351(6271):407–411. 10.1126/science.aad5177 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Moretti A, Fonteyne L, Giesert F et al. (2020) Somatic gene editing ameliorates skeletal and cardiac muscle failure in pig and human models of Duchenne muscular dystrophy. Nat Med 26(2):207–214. 10.1038/s41591-019-0738-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Zhang Y, Li H, Min YL et al. (2020) Enhanced CRISPR-Cas9 correction of Duchenne muscular dystrophy in mice by a self-complementary AAV delivery system. Sci Adv 6(8):eaay6812. 10.1126/sciadv.aay6812 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.McCarty DM, Fu H, Monahan PE et al. (2003) Adeno-associated virus terminal repeat (TR) mutant generates self-complementary vectors to overcome the rate-limiting step to transduction in vivo. Gene Ther 10(26):2112–2118. 10.1038/sj.gt.3302134 [DOI] [PubMed] [Google Scholar]
  • 33.Ferrari FK, Samulski T, Shenk T et al. (1996) Second-strand synthesis is a rate-limiting step for efficient transduction by recombinant adeno-associated virus vectors. J Virol 70(5):3227–3234 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Fisher KJ, Gao GP, Weitzman MD et al. (1996) Transduction with recombinant adeno-associated virus for gene therapy is limited by leading-strand synthesis. J Virol 70(1):520–532 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Ren C, Kumar S, Shaw DR et al. (2005) Genomic stability of self-complementary adeno-associated virus 2 during early stages of transduction in mouse muscle in vivo. Hum Gene Ther 16(9):1047–1057. 10.1089/hum.2005.16.1047 [DOI] [PubMed] [Google Scholar]
  • 36.McCarty DM (2008) Self-complementary AAV vectors; advances and applications. Mol Ther 16(10):1648–1656. 10.1038/mt.2008.171 [DOI] [PubMed] [Google Scholar]

RESOURCES