MicroRNA-127 promotes anti-microbial ability in porcine alveolar macrophages via S1PR3/TLR signaling pathway

Abstract

Background

As Actinobacillus pleuropneumonniae (APP) infection causes considerable losses in the pig industry, there is a growing need to develop effective therapeutic interventions that leverage host immune defense mechanisms to combat these pathogens.

Objectives

To demonstrate the role of microRNA (miR)-127 in controlling bacterial infection against APP. Moreover, to investigate a signaling pathway in macrophages that controls the production of anti-microbial peptides.

Methods

Firstly, we evaluated the effect of miR-127 on APP-infected pigs by cell count/enzyme-linked immunosorbent assay (ELISA). Then the impact of miR-127 on immune cells was detected. The cytokines tumor necrosis factor (TNF)-α and interleukin (IL)-6 were evaluated by ELISA. The expression of cytokines (anti-microbial peptides [AMPs]) was assessed using quantitative polymerase chain reaction. The expression level of IL-6, TNF-α and p-P65 were analyzed by western blot. The expression of p65 in the immune cells was investigated by immunofluorescence.

Results

miR-127 showed a protective effect on APP-infected macrophage. Moreover, the protective effect might depend on its regulation of macrophage bactericidal activity and the generation of IL-22, IL-17 and AMPs by targeting sphingosine-1-phosphate receptor3 (SIPR3), the element involved in the Toll-like receptor (TLR) cascades.

Conclusions

Together, we identify that miR-127 is a regulator of S1PR3 and then regulates TLR/nuclear factor-κB signaling in macrophages with anti-bacterial acticity, and it might be a potential target for treating inflammatory diseases caused by APP.

INTRODUCTION

Actinobacillus pleuropneumonniae (APP) is a gram-negative respiratory pathogen in the Pasteurellceae family that causes swine pleuropneumonia, which poses a serious threat to industrial swine production efforts [1]. Swine pleuropneumonia incurs high morbidity and mortality rates among affected swine, resulting in an adverse impact on animal welfare and economic productivity owing to decreases in feed conversion and average daily weight gain rates, the need for interventional treatment, and slaughter-related losses [2,3]. APP-infected animals have pulmonary lesions with inflammatory, hemorrhagic, and necrotic regions of varying size that are distinguishable from the surrounding healthy tissue [4]. APP-related mortality is primarily attributable to the direct induction of an immune response triggered by these bacteria, resulting in the sepsis-like systemic overproduction of inflammatory mediators that can ultimately cause multiple organ failure [5].

Tissue-resident macrophages are immune cells that function as sentinels, surveilling their local microenvironment and responding to pathogens or other adverse stressors to restore tissue homeostasis. Initially derived from monocytic bone marrow precursor cells, macrophages can be recruited in response to specific chemokines release in response to tissue injury or as a means of replenishing local tissue-resident populations of these cells as necessary [6]. As critical regulators of innate and adaptive immune responses to pathogens, macrophages coordinate key immunological functions about the induction and resolution of inflammatory responses and the regulation of tissue repair [7]. In acute or chronic inflammatory conditions, macrophages have been identified as the primary sources of inflammatory cytokine production [8]. However, the mechanism of macrophages in resistance to APP infection is still unclear.

MicroRNAs (miRNAs) are small conserved RNAs that lack coding potential, but can regulate post-transcriptional gene expression [9]. A growing body of evidence suggests that miRNAs play functional roles in infections and autoimmunity, inhibiting the translation of target mRNAs and/or promoting their degradation [10]. miR-127 was first found to be highly expressed in embryos and involved in lung development [11]. Then, miR-127 could be induced in the pulmonary disease-related inflammation suggesting miR-127 might have a potential role in the inflammatory signaling in respiratory [12]. Furthermore, miR-127 might regulate host defense against bacterial infection [13].

Additionally, researchers have found that sphingosine-1-phosphate receptor3 (SIPR3) is a miR-127 target in the myogenic cell [14]. S1PR3 mediates multiple function inflammatory responses and vascular barrier function in many infectious diseases [15]. However, the roles of S1PR3 in the host defense against infecting pathogens still need to be addressed.

Here, we hypothesized that miR-127 might regulate alveolar macrophage (AM) immune responses in the context of APP infection. To test this possibility, we analyzed the expression of this miRNA over time in APP-infected AMs, and we further explored its functional role in porcine fetal ZMAC-4 cells and AMs. This study is the first to our evaluate the significance of miR-127 concerning APP infection. Overall, we found that miR-127 enhanced the bactericidal activity of AMs, promoting the expression of anti-microbial peptides and cytokines, including tumor necrosis factor (IL)-17 and IL-22, through the S1PR3 pathway.

MATERIALS AND METHODS

Bacterial strains and reagents

A. pleuropneumoniae serotype 1 was obtained from the Jiangsu Agri-animal Husbandry Vocational College. All miR-127 mimic, inhibitor, and control (miR-control) constructs were based on the miR-127 sequence from the miRBase database (MI0002528), and were synthesized by Tsingke Biotechnology Co., Ltd. (China). The double-stranded miR-127 mimic sequences were 5′UCGGAUCCGUCUGAGCUUGGCU-3′ and 5′-CCAAGCUCAGACGGAUCCGAUU-3′, while the single-stranded miR-127 inhibitor sequence was 5′-AGCCAAGCUCAGACGGAUCCGA-3′. Nonspecific control miRNA: 5′-UUCUCAGAACGUGUCACGU-3′. The S1PR3-specific siRNAa were 5′-UGAAAUUUAUUGUUUUUCCAG-3′ (sense) and 5′-GGAAAAACAAUAAAUUUCACA-3′ (anti-sense), siRNA duplexes were transfected into pig macrophages at 10 nM concentration.

Animal preparation and APP infection model

Twelve male miniature pigs (one-month-old) were purchased from long yuan special animal breeding company in Shandong, China. Moreover, further bred in a specific-pathogen-free (SPF) environment. A total volume of 50 mL of PBS with APP (8*107CFU/pig) for pulmonary bacterial infections was intratracheally administered to the pig. The pigs were divided into four groups: miR-127 mimic, anti-miR-127, non-specific control (control) (2 mg/kg), and untreated. The survival rate of the pig was monitored every 4h. Moreover, all experiments on live animals were as per guidelines approved internationally for the use of animals in research (National Research Council; 1996. Guide for the Care and Use of Laboratory Animals. Washington, D.C.: The National Academies Press. https://doi.org/10.17226/5140). Furthermore, all of the procedures described in this study were reviewed and approved by the ethical committee of the Jiangsu Agri-animal Husbandry Vocational College (No. JSAG20210122-1).

Bronchoalveolar lavage fluid (BALF) collection

Pig weasand was disclosed and intubation with a sterile tube. Bronchoalveolar lavage fluid was obtained by washing the lungs with PBS. Then the bronchoalveolar lavage fluid was centrifuged at 2,000 rpm, and the supernatants were stored at −80°C for use. The cell numbers in the bronchoalveolar lavage fluid were counted with a hemocytometer, and neutrophils in the bronchoalveolar lavage fluid were evaluated by flow cytometry.

Cell preparation and infection

The porcine ZMAC-4 macrophage cell line was obtained from Biovector Science Lab, Inc. All cells were authenticated and confirmed to be free of mycoplasma contamination and were cultured in DMEM supplemented with 10% FBS in a 5% CO₂ incubator at 37°C. AMs were harvested from collected BALF samples via centrifugation, after which they were rinsed, plated in 12-well plates, and detected based on their adherence following multiple rounds of washing. APP was used to infect ZMAC-4 cells at a multiplicity of infection (MOI) of 0–6 (MOI: 0, 2, 4, 6) for a range of time periods (0, 4, 8, 12, or 24 h) prior to analysis. For AMs extraction, the collected BALF were centrifuged, washed, and plated in 12-cell plates, and AMs were selected by adherence after three washing.

Transfection

All miRNA mimic/inhibitor constructs (200nM) were transfected into appropriate cells using Lipofectamine 3000 (Invitrogen, USA) based on provided directions. Briefly, cells were cultured in 6-well plates and transfected with 20 µM of appropriate constructs. At 6 h post-transfection, the mixture was removed, and 2 mL of fresh media was added per well for 24 h, after which quantitative polymerase chain reaction (qPCR) was used to determine knockdown efficiency.

Western blotting

Lysis buffer (50mM Tris-HCl, pH 7.5, 5mM EDTA, 150mM NaCl, 06% NP-40) was used to harvest protein from cells for 45 min on ice, with a Bio-Rad Protein Assay then used to quantify protein levels in the resultant lysates. Proteins were separated via 10% SDS-PAGE and transferred onto nitrocellulose membranes for Western blotting using appropriate primary antibodies following blocking with 5% non-fat milk in PBST. Primary antibodies were specific for GAPDH, IL-6, p-p65, tumor necrosis factor (TNF)-α, and S1PR3. The enhanced western Bright ECL reagent was used to detect protein bands, with the ImageJ software (v1.46) then used for densitometric quantification. GAPDH was a loading control when normalizing protein expression, with fold-change values being determined by comparing control and experimental groups.

Enzyme-linked immunosorbent assays (ELISAs)

Levels of cytokines, including TNF-α, IL-6, IL-1β, and IL-10 in individual samples were measured using appropriate ELISA kits (R&D Systems, Hycult Biotech, Netherlands) based on provided directions. Standard curves were used for quantification purposes. Data are presented as the fold-change over control treatment.

qPCR

TRIzol (Invitrogen) was utilized to extract RNA from cells based on provided directions, after which PrimerScriptII and a First-Stand cDNA Synthesis Kit (Takara, China) were used to prepare cDNA. All qPCR reactions were then performed using an SYBR Green PCR Master Mix (Takara). Changes in gene expression were determined using β-actin for normalization via the ΔΔCt method. All primers were synthesized by Tsingke Biotechnology Co., Ltd (Table 1).

Table 1. Primers used in this paper.

Primer name	Sense/anti-sense	Primer sequence (5′-3′)
IL-1β	F	CTCGTGCTGTCGGACCCAT
	R	CAGGCTTGTGCTCTGCTTGTGA
TNF-α	F	ATCCGCGACGTGGAACTGGC
	R	CCATGCCGTTGGCCAGGAGG
IL-6	F	CACTTCACAAGTCGGAGGC
	R	GCAAGTGCATCATCGTTGTTC
IL-22	F	ATGAGTTTTTCCCTTATGGGGAC
	R	CTGGAAGTTGGACACCTCAA
IL-23	F	CAGCAGCTCTCTCGGAAT
	R	CAACCATCTTCACACTGGATAC
IL-17	F	CCACGTCACCCTGGACTCTC
	R	CTCCGCATTGACACAGCG
β-actin	F	CTCATGAAGATCCTGACCGAG
	R	GTCTAGAGCAACATAGCACAG
iNOS	F	GAGGAGTGGAAGTGGTTCCG
	R	TGAAGCAGGGTACAGGGTCT
S100A8	F	CGGATCTGGAGAGTGCCATT
	R	CCCCAAAGCTCTGCTACTCTT
miRNA-127	F	GCGGCTCGGATCCGTCTGAGCT
	R	GTGCAGGGTCCGAGGT
Reg3β	F	ATGGCTCCTACTGCTATGCC
	R	GTGTCCTCCAGGCCTCTT

IL, interleukin; TNF, tumor necrosis factor; iNOS, inducible nitric oxide synthase.

Immunofluorescent p65 staining

After transfection with appropriate miRNA mimic/inhibitor constructs for 36 h, ZMAC-4 cells were aliquoted onto slides and treated with APP. Cells were then harvested, fixed using 100% methanol, washed twice, and stained with permeabilization using 0.2% saponin. Cells were blocked with 5% bovine serum prior to overnight staining with rabbit anti-p65 at 4°C, followed by staining with FITC-anti-rabbit IgG (Solarbio, China). DAPI (Solarbio) was used for nuclear counterstaining, and cells were analyzed via fluorescence microscopy (Zeiss, Germany).

Statistical analysis

Data from triplicate experiments were analyzed using SPSS 22.0 (IBM Corp., USA) and PRISM 5. Data were compared via one-way ANOVAs followed by Tukey’s test. All assays were performed in independent triplicates, and are given as means ± SEM.

RESULTS

miR-127 promotes bacterial clearance and protects against A. pleuropneumoniae infection in pig

To gauge the functional importance of miR-127 in anti-pathogenic host responses to bacterial infection, we utilized a porcine A. pleuropneumoniae model system. The results showed that miR-127 mimic administration could increase the inflammatory response in bronchoalveolar lavage fluid by inducing more total cells and neutrophils. Whereas miR-127 inhibitor could decrease the level of total cells and neutrophils (Fig. 1). Consistently, pig with miR-127 administration showed less body weight loss, whereas those treated with anti-miR-127 more weight loss (Supplementary Fig. 1). Furthermore, we observed that miR-127 induced increased proinflammatory activity by increased cellular infiltration and bronchoalveolar lavage fluid levels of inflammatory factors such as IL-6 and TNF-α; while, miR-127 inhibitor treatment impaired inflammatory cytokine production and cellular infiltration (Fig. 2). IL-22 and associated effector molecules play critical roles in host defense responses to bacterial infection, and miR-127 mimics were found to enhance AM expression of IL-22 and the related cytokines IL-17 and IL-23 in bronchoalveolar lavage fluid, whereas miR-127 inhibitor treatment had the opposite effect (Fig. 2). Consistently, miR-127 mimic treatment increased the expression of anti-microbial peptides (AMPs) including regenerating islet-derive protein 3β (Reg-3β), S100 calcium-binding protein A8 (S100A8), and inducible nitric oxide synthase as well as interferon-γ; while, miR-127 inhibition had the opposite effect (Fig. 3).

Fig. 1. The number of total cells and neutrophils in bronchoalveolar lavage fluid. Mice bronchoalveolar lavage fluid were collected and shown were counts of total cells and neutrophils in bronchoalveolar lavage fluid. Pigs (n = 5/group) were inrtracheally administrated with miR-127, anti-miR-127, and non specific microRNA control (control), the untreat pigs were used as experimental control. The pigs were challenged with 6 × 10⁷ CFU of APP.

APP, Actinobacillus pleuropneumonniae.

^*p < 0.05, ^**p < 0.01.

Fig. 2. The level of bronchoalveolar lavage fluid cytokines including TNF-α and IL-6 were detected by ELISA assay. Following transfection with miR-127, anti-miR-127, or corresponding control constructs for 4 h, cells were infected with APP (multiplicity of infection = 4), with untreated cells serving as controls. ELISAs were then used to detect levels of specific cytokines (IL-6 and TNF-α) following treatment with (A) miR-127 or (B) anti-miR-127.

TNF, tumor necrosis factor; APP, Actinobacillus pleuropneumonniae; IL, interleukin; ELISA, enzyme-linked immunosorbent assay.

^*p < 0.05, ^**p < 0.01.

Fig. 3. A quantitative polymerase chain reaction approach was used to assess the expression of specific cytokines (IFN-γ, IL-22, IL-17, and IL-23) and anti-microbial peptides (iNOS, Reg3β, S100A8) in the indicated samples. Data are means ± SD.

IL, interleukin; APP, Actinobacillus pleuropneumonniae; IFN, interferon; iNOS, inducible nitric oxide synthase.

^*p < 0.05, ^**p < 0.01.

miR-127 enhances macrophage effector responses to A.pleuropneumonniae

Owing to the critical role of macrophages as regulators of protective immune responses against pathogenic bacteria, we next evaluated the role of miR-127 as a regulator of macrophage activity in the context of A. pleuropneumoniae infection. These analyses revealed miR-127 to be upregulated in a dose-and time-dependent fashion in the porcine ZMAC-4 macrophage cell line (Fig. 4). Moreover, miR-127 was found to enhance the expression of proinflammatory cytokines (TNF-α, IL-6, IL-1β) whereas it inhibited the expression of anti-inflammatory IL-10 (Fig. 5). miR-127 also promoted the upregulation of IL-22, which can induce AMP expression, suggesting that this miRNA can enhance the ability of macrophages to clear bacteria partly by enhancing their production of anti-microbial effector molecules.

Fig. 4. A quantitative polymerase chain reaction approach was used to analyze ZMAC-4 cells following infection with APP. (A) over different periods of time, or (B) at different multiplicity of infection values.

APP, Actinobacillus pleuropneumonniae.

^*p < 0.05.

Fig. 5. miR-127 regulates inflammatory activity associated with APP infection. Following transfection for 24 h with miR-127, anti-miR-127, or corresponding control constructs, ZMAC-4 cells were infected with APP (multiplicity of infection = 2) for the indicated amounts of time. Levels of different cytokines were then assessed via enzyme-linked immunosorbent assay in cell culture supernatants. Data are means ± SD from three or more replicate experiments.

IL, interleukin; APP, Actinobacillus pleuropneumonniae; TNF, tumor necrosis factor.

^*p < 0.05, ^**p < 0.01.

miR-127 regulates S1PR3 to influence antibacterial signaling responses in AMs infected with A. pleuropneumoniae

S1PR3 is a bioactive signaling agent known to be derived from mammalian membranes and plays an important role in inflammatory responses. In this paper, we wondered whether S1PR3 could mediate miR-127 to increase anti-APP infection in pigs. Firstly we observed a reduction in S1PR3 mRNA and protein levels following miR-127 mimic treatment in AMs infected with A. pleuropneumoniae, whereas miR-127 inhibitor treatment resulted in the opposite phenotype (Fig. 6). Then to assess the ability of miR-127 to modulate macrophage antibacterial responses, we referenced the Targetscan database, which confirmed the presence of a predicted miR-127 target site within the 3′-untranslated region or S1PR3 (Supplementary Fig. 2). When S1PR3 was silenced using a specific siRNA construct, the production of the proinflammatory cytokines TNF-α, IL-6, and IL-1β in infected macrophages was inhibited (Fig. 7).

Fig. 6. miR-127 targeted SIPR3 in APP infected macrophage infected by APP. After transfection for 24 h with miR-127a mimics,anti-miR-127, or appropriate control constructs, ZMAC-4 cells were infected for 6 h with APP. quantitative polymerase chain reaction (A) and Western blot (B) were used to assess S1PR3 expression, with GAPDH as a normalization control. Data are means ± SD from three or more replicate experiments.

APP, Actinobacillus pleuropneumonniae.

^**p < 0.01.

Fig. 7. The level of cytokines in macrophages infected with APP infected under knockdown of S1PR3. After co-transfection with miR-127 and the indicated siRNAs, ZMAC-4 cells were infected with APP, and enzyme-linked immunosorbent assays were used to measure TNF-α (A), IL-6 (B), and IL-1β (C) levels in cell culture supernatants.

TNF, tumor necrosis factor; IL, interleukin; APP, Actinobacillus pleuropneumonniae.

^**p < 0.01.

miR-127 enhances inflammatory responses induced by APP through the upregulation of nuclear factor (NF)-κB and proinflammatory cytokines

To better understand the significance of miR-127 upregulation in the context of APP infection, we next assess Toll-like receptor (TLR) signaling-related proinflammatory gene expression. We found that APP infection resulted in the upregulation of NF-κB, IL-6, and TNF-α, while in the absence of such infection, the protein level expression of NF-κB p-p65, IL-6, and TNF-α was increased following miR-127 mimic transfection relative to control treatment. However, mRNA levels were not significantly changed, and TNF-α protein levels were upregulated in response to miR-127 mimics (Fig. 8A). The transfection of cells with a miR-127 inhibitor resulted in the downregulation of these proinflammatory factors (Fig. 8B). Meanwhile, the activation of NF-κB p-p65 subunit (Fig. 8) and p65 nuclear translocation (Fig. 9) is also in agreement with this. The changes in inflammatory factor expression were observed in APP-infected cells following miR-127 mimic or inhibitor transfection.

Fig. 8. The expression of the indicated proteins involved in the NF-κB signaling pathway. Western blotting was used to assess the expression of the indicated NF-κB signaling-related proteins, GAPDH as a normalization control. Cells were transfected with miR-127, anti-miR-127 and non-specific control for 24 h and infected by Actinobacillus pleuropneumonniae for different time.

IL, interleukin; TNF, tumor necrosis factor; NF, nuclear factor.

Fig. 9. The expression of p65 in macrophages measured by immunofluorescent microscopy. Nuclei were stained with DAPI. After transfection for 24 h with miR-127 mimics, anti-miR-127, or appropriate control constructs, ZMAC-4 cells were infected for 6 h with APP.

APP, Actinobacillus pleuropneumonniae.

DISCUSSION

Pathogen antibiotic resistance has been receiving growing attention as a serious public health issue. Macrophages are critical mediators of pathogen clearance and immune response induction, functioning as the primary cell time involved in phagocytosis, killing of bacteria and initiating inflammatory responses [16]. Such inflammation is an essential facet of respiratory defense responses [17]. Several A. pleuropneumoniae-derived virulence factors have been shown to contribute to inflammatory cytokine production in the context of porcine pleuropneumonia [18]. As antibiotic-resistant bacteria continue to emerge as a significant threat to global health, there is an urgent need to develop novel anti-microbial strategies that leverage a detailed understanding of host immunity and pathogen functionality to ensure therapeutic efficacy [19]. When immune responses are inappropriately regulated, they can induce acute or chronic inflammatory disorders. Several negative feedback mechanisms generally serve temper these responses to maintaining immunologic homeostasis. Herein, we identified miR-127 as a regulator of host innate immune antibacterial responses, and we then explored its functional role as a regulator of A. pleuropneumoniae infection. Through a series of experiments, we determined that miR-127 is upregulated in response to APP infection and promotes expedited bacterial clearance, thereby protecting against pneumonia. As such, the inhibition of miR-127 increases susceptibility to A.pleuropneumoniae infection, increasing bacterial burden and pneumonia severity.

miRNAs are well-studied transcripts that, despite lacking protein-coding potential, can influence the stability and/or translation of specific mRNA transcripts [20]. Bacteria have been reported to leverage specific miRNAs to skew the immune microenvironment in a manner conducive to their growth and replication. Several miRNAs are necessary for proper macrophage regulatory activity and immune response induction, including miR-302, miR-155, and miR-223 [21,22]. Several studies have consistently highlighted the importance of miR-146a within innate immune cells [23,24], with its expression first having been reported in human monocytic THP-1 cells following stimulation with the TLR4 ligand lipopolysaccharide [25]. Moreover, the research found that miR-127 upregulation has been shown to occur in response to the JNK pathway to regulate other TLR agonists [12]. Consistently, we observed time- and dose-dependent miR-127 upregulation in macrophages infected with A. pleuropneumoniae, likely owing to TLR signaling induction and/or NF-κB expression in response to these pathogenic bacteria [26]. Recent research further suggests that miRNAs can regulate TLR signaling activity, thereby shaping the downstream induction of innate immune responses to pathogen detection [14,27].

Nevertheless, previous studies mainly center on miRNA’s effect on repressing inflammation. However, the effect of miRNA in regulating anti-bacterial is still scarce. Here, we determined that miR-127 could target S1PR3, key downstream adaptor proteins mediating multiple aspects of the inflammatory response. We confirmed the ability of miR-127 to target S1PR3, with the downregulation of these signal pathways markedly increasing the resultant TLR-induced inflammatory responses induced within cells expressing this miRNA [16,28].

Inflammation is a critical facet of the immune response to pathogens and other damaging stimuli, but unrestrained inflammatory signaling can cause substantial immunopathology, tissue damage, and, in severe cases, mortality [28]. However, our study found that the inflammation amplified by miR-127 in pig did not cause harm to the animal, but improved antibacterial ability by alleviated body weight loss when pigs were treated with intratracheal miR-127 administration. In order to address this, the molecules involved in tissue repairing, and mucosal barrier intergrity were detected in this study, such as Reg3β, and S100A8 [29,30]. This indicated that there might be some protection scheme wihle miR-127 induces inflammation. Furthermore, cytokines IL-17 and IL-22 also play roles in tissue protection [31]. So, we think miR-127 might have multiple protection functions, mainly in macrophages, when induced by APP.

Herein, we found that in addition to its role as a regulator of anti-microbial responses, miR-127 also influenced the expression of inflammatory cytokines and modulated inflammatory cell infiltration. IL-6, TNF-α, IL-1β, and other inflammatory cytokines can promote the expression of additional cytokines and effector molecules that can aid in resolving a given infection. Meanwhile, IL-6 can further promote the induction of IL-22 mediated ant-imicrobial responses [32,33]. Here, we determined that miR-127 can regulate the expression of S1PR3, thereby increasing inflammation and constraining excessive immunopathological damage in the context of APP infection. In summary, we herein identified miR-127 as an essential regulator of host responses to APP infection, defining a regulatory circuit through which this miRNA can shape optimal antibacterial responses and thereby highlighting promising approaches to the treatment of A. pleuropneumoniae infections.

SUPPLEMENTARY MATERIALS

Supplementary Fig. 1

The body weight loss of experimental pigs (n = 5/group) were inrtracheally administrated with miR-127, anti-miR-127, and non specific microRNA control (control), the untreat pigs were used as experimental control. The pigs were challenged with 6 × 10⁷ CFU of Actinobacillus pleuropneumonniae.

Supplementary Fig. 2

Sequence alignment of miR-127 and it’s target site in 3’-UTR segments of S1PR3.