Skip to main content
Engineering in Life Sciences logoLink to Engineering in Life Sciences
. 2023 Mar 9;23(4):e2200064. doi: 10.1002/elsc.202200064

Site‐directed mutagenesis improves the practical application of L‐glutamic acid decarboxylase in Escherichia coli

Liu Fengmin 1,, Zhang Heng 1, Zhang Xiangjun 1, Wei Xiaobo 1, Liu Huiyan 1, Fang Haitian 1,
PMCID: PMC10071571  PMID: 37025190

Abstract

γ‐Aminobutyric acid (GABA) is a kind of non‐proteinogenic amino acid which is highly soluble in water and widely used in the food and pharmaceutical industries. Enzymatic conversion is an efficient method to produce GABA, whereby glutamic acid decarboxylase (GAD) is the key enzyme that catalyzes the process. The activity of wild‐type GAD is usually limited by temperature, pH or biotin concentration, and hence directional modification is applied to improve its catalytic properties and practical application. GABA was produced using whole cell transformation of the recombinant strains Escherichia coli BL21(DE3)‐Gad B, E. coli BL21(DE3)‐Gad B‐T62S and E. coli BL21(DE3)‐Gad B‐Q309A. The corresponding GABA concentrations in the fermentation broth were 219.09, 238.42, and 276.66 g/L, and the transformation rates were 78.02%, 85.04%, and 98.58%, respectively. The results showed that Gad B‐T62S and Gad B‐Q309A are two effective mutation sites. These findings may contribute to ideas for constructing potent recombinant strains for GABA production.

Practical Application : Enzymatic properties of the GAD from Escherichia coli and GAD site‐specific mutants were examined by analyzing their conserved sequences, substrate contacts, contact between GAD amino acid residues and mutation energy (ΔΔG) of the GAD mutants. The enzyme activity and stability of Gad B‐T62S and Gad B‐Q309A mutants were improved compared to Gad B. The kinetic parameters Km and Vmax of Gad B, Gad B‐T62S, and Gad B‐Q309A mutants were 11.3 ± 2.1 mM and 32.1 ± 2.4 U/mg, 7.3 ± 2.5 mM and 76.1 ± 3.1 U/mg, and 7.2 ± 3.8 mM and 87.3 ± 1.1 U/mg, respectively. GABA was produced using whole cell transformation of the recombinant strains E. coli BL21(DE3)‐Gad B, E. coli BL21(DE3)‐Gad B‐T62S, and E. coli BL21(DE3)‐Gad B‐Q309A. The corresponding GABA concentrations in the fermentation broth were 219.09, 238.42, and 276.66 g/L, and the transformation rates were 78.02%, 85.04%, and 98.58%, respectively.

Keywords: γ‐aminobutyric acid, glutamate decarboxylase, site‐directed mutation, whole cell transformation


Abbreviations

DE3

E. coli BL21

E. coli

Escherichia coli

GABA

γ‐Aminobutyric acid

GAD

glutamic acid decarboxylase

IPTG

isopropyl thiogalactoside

PLP

pyridoxal phosphate

1. INTRODUCTION

γ‐Aminobutyric acid (GABA) is a four‐carbon non‐proteinogenic amino acid that is highly soluble in water and widely distributed in animals and plants. GABA plays an important role in improving the physiological function of the body and is often used as a drug and food addition. In the pharmaceutical industry, GABA has an anticonvulsant function [1] and is used to treat epilepsy [2], anxiety [3], and in adjuvant treatment of Parkinson's disease [4]. As a food addition, GABA is often added to beverages, alcohol, and milk to prevent neurological diseases [5]. In addition to its application in preventing plant diseases and promoting plant photosynthesis [6], GABA has also attracted increasing attention as a postharvest treatment to inhibit the browning of mushrooms such as Agaricus bisporus [7].

GABA can be synthesized by chemical, plant enrichment, and biological methods [8, 9]. Chemical production of GABA has poor safety and high energy consumption, and the acquisition of raw materials and waste disposal are relatively cumbersome [10]. The plant enrichment production method of GABA has low efficiency and the separation is difficult, which will result in a reduced GABA yield [11]. As a result, the biological synthesis of GABA has attracted a lot of attention due to its advantages of simple raw material requirements, an easy process and environmental friendliness [12]. The biological methods can be divided into fermentation and transformation methods [13]. Pham et al. and Vo et al. [14, 15], In order to improve the efficiency of the GABA pathway a synthetic protein scaffold was introduced in E. coli and P. horikoshii glutamic acid decarboxylase was overexpressed so that the recombinant strains successfully produced GABA from glucose. Chae et al. [16], successfully constructed an engineered bacterium with glutamate decarboxylase (GAD) activity by transforming the GAD of E. coli K‐12 into E. coli BL21(DE3) that used 300 mM sodium glutamate as the substrate for whole cell transformation to produce up to 102 mM of GABA. Fan et al. [17], performed site‐directed saturation mutagenesis of the N‐terminal residues of GadB from E. coli to improve its thermal stability. A triple mutant (M6, Gln5Ile/V al6Asp/Thr7Gln) showed higher thermal stability. GAD is the key enzyme catalyzing GABA production from L‐glutamate [18], and its activity directly determines the amount of GABA obtained by the transformation method. Generally, GAD from wild strains has low activity and poor stability, which limits its application [19, 20]. Nevertheless, the application of site‐directed mutagenesis in enzyme transformation provides a new potential for the increased production of GABA. On the basis of multiple sequence alignment, the enzyme activity center, protein surface amino acids, protein model, and other factors, site‐directed mutation of relevant amino acid residues of Bacillus megaterium GAD was used for cell transformation by Cheng HJ [21] and the studies managed to produce 347.9 g/L GABA from 500 g/L L‐glutamate.

In this study, the amino acid residues related to the catalytic performance of GAD were summarized based on a homologous comparison of Gad B (the gene that encodes the B isoform of GAD) and its catalytic–substrate interactions to synthesize GABA. Additionally, the related amino acid residues were established by mutation free energy analysis. GAD before and after mutation was expressed in E. coli BL21(DE3). The effect of site‐directed mutation on the GAD enzymatic properties and the GABA production of the recombinant strains were further determined (as shown in Figure 1). The results provide a context for the directional transformation of enzymes and facilitate a better application of the whole‐cell transformation approach to GABA production using recombinant strains.

FIGURE 1.

FIGURE 1

Schematic diagram of relevant experimental processes of this study.

2. MATERIALS AND METHODS

2.1. Experimental samples and reagents

Table 1 shows the strains, plasmids and primers (synthesized by Shanghai Shenggong) used in the present study. The restriction endonucleases Bam HI and Hind III, T4 DNA ligase, Dpn I digestive enzyme, Pyrobest DNA polymerase, kanamycin and nucleic acid dye were purchased from Baoriyi Biotechnology (Beijing) Co., Ltd., and LB medium from Oxoid, UK. Glucose, sucrose and NH3·H2O were purchased from Tianjin Kemio Chemical Reagent Co., Ltd.; KH2PO4 from Tianjin Damao Chemical Reagent Factory; MgSO4·7H2O from Nanjing Aoduofuni Biotechnology Co., Ltd.; and acetonitrile (LC‐grade) was purchased from Shanghai McLean Biochemical Technology Co., Ltd.

TABLE 1.

Strains, plasmids and primers used in this study

Strain, plasmid or primer Characteristics Source
Strain
Escherichia coli BL21(DE3) Plasmid‐expressing host bacterium Lab stock
Escherichia coli K‐12 γ‐Aminobutyric acid‐producing strain Lab stock
E. coli BL21(DE3)‐Gad B Recombinant strain capable of expressing glutamic acid decarboxylase This study
E. coli BL21(DE3)‐Gad B‐T62S Recombinant strain capable of expressing mutant glutamate decarboxylase This study
E. coli BL21(DE3)‐Gad B‐Q309A Recombinant strain capable of expressing mutant glutamate decarboxylase This study
Plasmid
pET‐30a(+) Overexpression vector, kanamycin resistance Lab stock
pET‐30a(+)‐Gad B pET‐30a(+) carrying Gad B from Escherichia coli K‐12 This study
pET‐30a(+)‐Gad B‐T62S pET‐30a(+) carrying mutated Gad B from Escherichia coli K‐12 This study
pET‐30a(+)‐Gad B‐Q309A pET‐30a(+) carrying mutated Gad B from Escherichia coli K‐12 This study
Primer (5′→3′)
P‐Gad B

Forward: 5′‐ACGC(GTCGAC)ATGGATAAGAAGCAAGTAACGGA‐3′ (Bam HI)

Reverse: 5′‐CCG(CTCGAG)TCAGGTATGTTTAAAGCTGTTCTGT‐3′ (Hind III)

P‐Gad B‐T62S

Forward: 5′‐GGTCTGGCAGAAAGAGGCCAGGTTCTGAC‐3′

Reverse: 5′‐GTCAGAACCTGGCCTCTTTCTGCCAGACC‐3′

P‐Gad B‐Q309A

Forward: 5′‐GATGGCAAAAGTACCAATTGCACCACCCAGGTAGTCAACG‐3′

Reverse: 5′‐ CGTTGACTACCTGGGTGGTGCAATTGGTACTTTTGCCATC‐3′

2.2. Experimental method

2.2.1. Construction of mutants

The crystal structure of homo‐hexameric Gad B (pdb: 1 pmm) was downloaded from the protein data bank (http://www.rcsb.org).Conserved domains and sequence motifs were analyzed using the online software MEME (http://meme‐suite.org/), EMBI (http://www.ebi.ac.uk/Tools/msa), and WebLogo (http://weblogo.threeplusone) to select the mutation sites [22, 23, 24]. Protein structure and protein ligand interaction analyses were performed using the three‐dimensional structure visualization software VMD (http://www.ks.uiuc.edu/Research/vmd) [25]. The mutation energy (ΔΔG) after point mutation was predicted using the online software PoPMiSiC (http://soft.dezyme.com/query/create/pop) [26]. The software is based on the change value of the folding free energy (ΔΔG) of mutants to predict all possible point mutations and reasonably select mutation sites.

For the acquisition of recombinant strains, the Gad B gene(GenBank accession no. EF551356.1) derived from E. coli K‐12 was used as template and P‐Gad B was used as the primer for PCR amplification. The recombinant plasmid pET‐30a(+)‐Gad B was obtained by enzyme digestion and gel recovery after linking with pET‐30a(+). After correct sequencing, the amplified DNA was transformed into E. coli BL21(DE3) competent cells to obtain the recombinant strain E. coli BL21(DE3)‐Gad B. The extracted recombinant plasmid pET‐30a(+)‐Gad B was used as a template and P‐Gad B‐T62S or P‐Gad B‐Q309A was used as a primer for PCR amplification. The PCR products were added to Dpn I enzyme to digest the methylation template and then transformed into E. coli BL21(DE3) competent cells to obtain the recombinant strains E. coli BL21(DE3)‐Gad B‐T62S and E. coli BL21(DE3)‐Gad B‐Q309A.

For the purification and expression of GAD, the recombinant strains were selected and inoculated into LB liquid medium supplemented with kanamycin (final concentration 50 μg/mL) for overnight culture. The recombinant strains at 1% were then cultured in TB medium containing kanamycin (final concentration of 50 μg/mL) at 37°C with shaking (200 r/min) until the OD600 was 0.7–0.8, and further induced with 0.2 mM isopropyl thiogalactoside (IPTG). The induced bacterial solution was centrifuged at 12,000 r/min (4°C) for 4 min, the culture medium was discarded and the bacteria were collected. The bacteria were then suspended in PBS buffer solution (pH 7.4) and the cells in the suspension were broken by ultrasonic treatment. The bacteria were centrifuged at 12,000 r/min (4°C) for 10 min and the supernatant was filtered using a 0.22 μm membrane to obtain GAD crude enzyme solution. The GAD crude enzyme solution was purified by using the Ni‐NTA method [27, 28].

2.2.2. Determination of GAD enzyme characteristics before and after mutation

The amount of enzyme required to catalyze the substrate to produce 1 μmol GABA per minute in the reaction solution is 1 activity unit (U). The Lineweaver–Burk Plot method [29] was used to investigate the kinetic parameters of GAD. To determine the enzyme activity, 980 μL of substrate buffer (including 0.05 mM pyridoxal phosphate (PLP) and 200 mM L‐glutamate sodium) was prepared, purified, and diluted to a concentration of 10 mg/mL Gad B enzyme protein solution. The total reaction solution was 1 mL after mixing, and the pH of the reaction solution was adjusted by phosphate buffer. After 30 min of reaction under different conditions, the reaction was terminated in an 80°C hot water bath for 10 min, centrifuged and the supernatant was filtered through a 0.22 μm membrane. The GABA content of the supernatant was determined using high‐performance liquid chromatography to investigate the catalytic performance of GAD before and after mutation.

2.2.3. Whole cell transformation to produce GABA

E. coli BL21(DE3)‐Gad B, E. coli BL21(DE3)‐Gad B‐T62S, and E. coli BL21(DE3)‐Gad B‐Q309A recombinant strains stored in glycerol tubes were cultured in LB slant medium. After that, the inclined plane strains were selected and activated in the seed medium to obtain seed liquid. The seed solution was inoculated at 20% in the fermentation medium for high‐density fermentation (NH3·H2O was added to maintain pH at 7.0, temperature at 35–37°C and dissolved oxygen level at 40%–50%). When the final OD600 value reached about 30, 0.2 mM IPTG was added for induction. After induction, the cells were collected after centrifugation for the whole cell transformation experiment at pH 6.0 and 33–35°C, and the dissolved oxygen level was maintained at 40%–50% by flowing NH3·H2O. The seed culture medium was composed of: 2 g/L glucose, 10 g/L sucrose, 1 g/L KH2PO4, 1 g/L urea, 0.5 g/L MgSO4·7H2O, 0.3 g/L succinic acid, 1 × 10−4 g/L calcium pantothenate, 1 × 10−5 g/L vitamin B2 and 1 × 10−5 g/L biotin. The transformation medium was: 400 g/L L‐glutamic acid, 50 μg/mL kanamycin, and 60 μmol/L PLP; NH3·H2O was added to control the pH of transformation at about 6.0.

2.2.4. Analytical method

A spectrophotometer was used to measure the OD changes of fermentation broth corresponding to each strain. An SBA‐40E biosensor was used to monitor the glucose and L‐glutamate concentrations in the fermentation and transformation processes, respectively. The high‐performance liquid phase was used to monitor the concentration of GABA before and after GAD mutation according to the method specified by Meeploy and Deewatthanawong, Wang et al. [30, 31].

3. RESULTS AND DISCUSSION

3.1. Determining the mutation point

The stability of an enzyme is usually the guarantee of its production and application, and the stability of structure is the basis of enzyme stability. In the process of biological evolution, the arrangement of amino acids will change with changes of the internal and external environment, but the conserved domain in this process is basically unchanged, which is closely related to structural stability [32]. Through multiple sequence alignment of several sources of GAD, it was found that they all have three conserved domain sequences (as shown in Figure 2). In Gad B site‐directed mutation, selecting non‐conserved amino acid mutations in the conserved domain structure will increase the effectiveness of the mutation and reduce the damage to the original structure when the domain is well‐defined. After multi‐sequence alignment screening, it was found that residues 62 and 309 of Gad B were located in the conserved domain, and they were not highly conserved amino acids.

FIGURE 2.

FIGURE 2

Conserved domains and sequence motifs.

The structure of Gad B under neutral and acidic conditions was analyzed and found to be a hexamer composed of six subunits. The difference was that the six subunits composing the hexamer under acidic conditions were the same (as shown in Figure 3A), while the six subunits composing the hexamer under neutral conditions were different (as shown in Figure 3B). Furthermore, Gad B has the ability to catalyze the synthesis of GABA from L‐glutamate under acidic conditions, but loses this ability under neutral conditions [33]. Structural analysis of Gad B under two pH environments showed that the C‐terminus of Gad is far away from the active catalytic center under acidic conditions, while the active center of PLP is exposed, which promotes contact between the substrate and the active site. Meanwhile, the N‐terminus of each subunit of Gad was found to be “helical” [34] and in contact with adjacent subunits, forming a steady‐state structure under acidic conditions (as shown in Figure 3A). Under neutral conditions, the C‐terminus of Gad B is close to K276 (that is, the active catalytic site binding with cofactor PLP) and forms the occupied conformation, thus losing the catalytic effect of Gad B on L‐glutamate [35]. At the same time, when the C‐terminus of Gad B extends to the active catalytic center under neutral conditions, it contacts the β‐lamellar structure formed by amino acids at positions 300–313 of the adjacent subunits, which is also a key factor affecting the catalytic effect of Gad B (as shown in Figure 3B). It can be concluded that the change of amino acid structure of Gad B under neutral conditions is the main reason for the change of its catalytic performance. In order to solve the limitation of GABA production by Gad B under neutral conditions, the site‐directed mutation method is proposed to modify the amino acid residues that interact with the active center under neutral conditions. Meanwhile, in order to verify the effect of site‐directed mutation on the catalytic performance of the enzyme and reveal the cause of the change, the relevant amino acid residues in the β‐lamellar structure of residues 301–313 react with the C‐terminus extending to the active center under neutral conditions.

FIGURE 3.

FIGURE 3

Gad B protein structure under acidic (A) and neutral (B) conditions.

Submit the three‐dimensional structure of GAD enzyme to online software PoPMiSiC, predict the change of folding free energy(ΔΔG) of each mutant amino acid of GAD enzyme, and select the amino acid residue with negative ΔΔG and significant change as the mutation site. Based on the conserved domain analysis and multi‐sequence alignment analysis, and on the change of mutation energy (ΔΔG < 0), it was determined that the 62nd amino acid residue of Gad B was mutated from threonine to serine. After mutation, the amino acid residues at position 466 lost their interaction with the amino acid residues at position 62 (as shown in Figure 4A), which weakened the occupation of the C‐terminus at the active catalytic center of PLP and changed the catalytic effect of Gad B near the center pH. In addition, at neutral pH, the β‐lamina formed by amino acid residues 300–313 interacts with the C‐terminus to form an envelope conformation of the active catalytic center of PLP, causing the neutral of the exposed active catalytic center of PLP to shrink significantly into the interior of Gad B. It is difficult for the substrate L‐glutamate to enter the active pocket, which weakens its catalytic performance. Position 309 at the end of the β‐lamellar formed by the amino group of Gad B's amino acids 300–313 is the hydrophilic amino acid glutamine, which has a flexible conformation and is often used as a binding site for various proteins. Therefore, it was decided to mutate Gad B into a hydrophobic amino acid (for proteins, large, deep hydrophobic cavities are critical for substrate binding to the receptor), in an attempt to weaken the interaction between Gad 309 as a hydrophilic amino acid and the C‐terminus while expanding the channel of the substrate into the catalytic pocket. Such a mutation changes the structure and orientation of Gad B under neutral conditions [36, 37], and the contact effect is weakened (as shown in Figure 4B). Second, the R group of the amino acid residues that form the β‐lamellar must not be too large, so stretching is conducive to the chain, under the condition of the peptide chain extension, most amino acids hydrophilic interaction with the surrounding water, a large number of hydrophilic amino acid residues of side chain groups and melting by solvent, which contribute to the formation of hydrophobic internal role, hydrophobic packaging to form active center cavities is also a major determinant of protein stability [38]. Guo et al. [39], using online prediction software PoPMiSiC, to predict the change of free energy of single point mutation of Bacillus subtilis chitosanase Bs Csn46A, the specific activity of the three mutants increased 1.69, 1.97, and 2.15 times, respectively. Similarly, Zhu et al. [40], screened the mutant aromatic sulfatase K253H with improved thermal stability by using PoPMiSiC. These studies show that the online prediction software PoPMiSiC is used to calculate the change of the ΔΔG of each amino acid site in the protein sequence to help design the site‐directed mutation of the enzyme, which may change the interaction between the amino acid residues in the local region of the enzyme molecule and predict the change of the enzyme stability after the amino acid point mutation.

FIGURE 4.

FIGURE 4

Conformation of Gad B under neutral conditions before and after mutation: amino acid residues at position 62 (A) and position 309 (B).

3.2. Construction and verification of mutants

After the mutation site was determined, the DNA of E. coli K‐12 was extracted as the amplification template, and the 1401 bp target fragment of gad B was amplified with the primer P‐Gad B. The amplified target fragment was linked to plasmid pET‐30a(+) for double‐digestion verification. The recombinant plasmid pET‐30a(+)‐Gad B was successfully obtained (as shown in Figure 5a). The plasmid containing the mutant site was further amplified by PCR with primer P‐Gad B‐T62S; the amino acid residue 62 of Gad B was mutated from tryptophan to serine, and residue 309 was mutated from glutamine to alanine. The plasmid obtained above was transformed into E. coli BL21(DE3) cells to obtain the recombinant strains E. coli BL21(DE3)‐Gad B, E. coli BL21(DE3)‐Gad B‐T62S, and E. coli BL21(DE3)‐Gad B‐Q309A. The induced expression and SDS‐PAGE analysis of the strains before and after mutation were further carried out. The expression vector pET‐30a(+) contained a His protein coding sequence. The crude enzyme solution of GAD was purified by Ni‐NTA and verified by SDS‐PAGE. The protein band appeared at about 53 kDa (as shown in Figure 5B). Thus, this indicated the successful intracellular expression of GadB in recombinant strains E. coli.

FIGURE 5.

FIGURE 5

(A) Double enzyme digestion verification map (M, marker; 1, pET‐30a(+)‐Gad B recombinant plasmid band; 2, double enzyme digestion verification band); (B) GAD polyacrylamide gel electrophoresis map (M, marker; 1, Gad B protein band; 2, Gad B‐T62S protein band; 3, Gad B‐Q309A protein band).

In theory, three codon saturation mutagenesis will give rise to a library with 8000 members if each mutation is represented equally. Mutations are bidirectional. Some may increase their thermal stability, while others may reduce their thermal stability. In this study, some mutants with residual activity higher than wild type were collected and sequenced through repeated screening. Because some mutants had the same amino acids sequence, we actually only obtained two thermal stable mutants. The purpose of our study was to find and characterize thermal stable E.coli GadB mutants. We only studied this two mutants in detail and found Gad B‐Q309A was the most stable one among them.

3.3. Verification of enzymatic properties

Temperature and pH characteristics: at pH 4.5, the optimum temperature of the enzyme was determined (as shown in Figure 6A). Gad B, Gad B‐T62S, and Gad B‐Q309A showed enzyme activity in the range of 25 to 46°C, the highest activity being found at 37°C. The activity of Gad B‐T62S and Gad B‐Q309A was higher than that of Gad B at 37°C. At 37°C, the optimal pH of the enzyme was determined (as shown in Figure 6B). Gad B, Gad B‐T62S, and Gad B‐Q309A showed enzyme activity in the range of pH 2.0 to 6.5, the activity being highest at pH 4.3, and the activity of Gad B‐T62S and Gad B‐Q309A was higher than that of Gad B at pH 4.3. At 37°C and pH 4.3, both Gad B‐T62S and Gad B‐Q309A mutants showed increased enzyme activity compared with the wild‐type Gad B. This preliminarily determined the optimum reaction conditions for GAD and provided corresponding parameters for the verification of GAD enzyme stability.

FIGURE 6.

FIGURE 6

Effect of different conditions on enzyme activity. (A)optimum temperature determination diagram; (B) optimal pH determination diagram; (C) temperature stability; (D) pH stability; (E) optimal PLP concentration diagram.

The enzyme was stored at 15 or 20°C for 12 h, and then used for validation of enzyme activity. Due to low temperature inhibition, its activity was not affected. Gad B was stored at 25, 30, and 35°C for 12 h, and then used to verify the enzyme activity. The enzyme activity was damaged when the temperature increased, and the enzyme stability decreased sharply when the temperature exceeded 35°C; under the same conditions, Gad B‐T62S and Gad B‐Q309A were less affected. At 45°C and pH 4.3, the thermal stability of Gad B‐T62S and Gad B‐Q309A mutants compared with wild‐type Gad B increased from 22% to 41% and 49%, respectively (as shown in Figure 6C), indicating that the thermal stability of the enzyme is improved to a certain extent at higher temperatures. At 20°C, the enzyme was stored in buffer with different pH for 12 h and then reacted in buffer with substrate. The mutant strain maintained more than 60% of the relative enzyme activity in the range of pH 4.0–6.0, while the stability of wild‐type Gad B was relatively poor. At 37°C and pH 6.5, the pH stability of Gad B‐62 and Gad B‐309 mutants compared with the wild‐type Gad B increased from 18% to 24% and 28%, respectively (as shown in Figure 6D), indicating that the stability of the enzyme is improved to a certain extent when it is close to neutral pH.

Effects of PLP supplemental level on enzyme properties before and after mutation: the enzyme activity of wild‐type Gad B and Gad B‐T62S mutants was highest when using the coenzyme PLP at a concentration of 60 μmol/L. With an increase of PLP concentration, the catalytic capacity of Gad B and Gad B‐T62S was not significantly promoted, and when the PLP concentration reached 160 μmol/L, PLP significantly inhibited the enzyme activity of Gad B and Gad B‐T62S. The mutant Gad B‐Q309A did not have optimal enzyme activity at 60 μmol/L PLP. However, at 80 μmol/L PLP, the enzyme activity of Gad B‐Q309A was significantly increased, which suggests that the optimal PLP concentration for Gad B‐309 is 80 μmol/L (as shown in Figure 6E); when the PLP concentration was 160 μmol/L, PLP could also inhibit Gad B‐309, but the enzyme activity of Gad B‐309 was higher than that of Gad B and Gad B‐T62S. In the later production of GABA, this experiment provides a reference for PLP concentration.

Kinetic parameters Km and Vmax: it can be seen from Table 2 that the Km value of GAD after mutation is significantly smaller than that before mutation, and the Vmax of GAD after mutation is significantly higher than that before mutation; according to the Km value, the Vmax of Gad B‐62 and Gad B‐309 is 2.37 and 2.71 times higher than that of Gad B, respectively. In addition, according to the Km value, the affinity between GAD and substrate was also enhanced after mutation, achieving the desired result of site‐directed mutation.

TABLE 2.

Kinetic parameters of enzymes before and after mutation

Enzyme Km (mM) Vmax (U/mg)
Gad B 11.3 ± 2.1 32.1 ± 2.4
Gad B‐T62S 7.3 ± 2.5 76.1 ± 3.1
Gad B‐Q309A 7.2 ± 3.8 87.3 ± 1.1

3.4. Whole cell transformation produces GABA

After seed solution was inoculated in a 5 L fermentation tank, the three strains entered logarithmic growth phase at about 8 h and left logarithmic growth phase at about 12 h, and the OD600 value of the three recombinant strains at this stage was around 30 (as shown in Figure 7A). At this time, IPTG was added to the fermentation broth and the concentration was controlled to 0.2 mM. The fermentation temperature was controlled at 35–37°C and the dissolved oxygen was maintained at 40%–50%. In the later stage of fermentation, attention should be paid to the sterile air flux and stirring speed in time.

FIGURE 7.

FIGURE 7

Whole‐cell conversion of L‐Glutamate into γ‐aminobutyric by wild‐type and mutant type (A) Changes of OD value in fermentation tank over time; (B) L‐glutamate consumption curve in transformation; (C) GABA generation curve in transformation.

At this point, the bacteria were collected by centrifugation and suspended with an appropriate amount of sterilized ultra‐pure water to enter the whole cell transformation experiment. The cycle of whole cell transformation and production of GABA was 12 h, and 400 g/L L‐glutamate substrate was added. The substrate L‐glutamate is consumed when it is put in (as shown in Figure 7B). Meanwhile, the bacteria have the highest utilization efficiency of L‐glutamate at 3–5 h. In the 6th hour of transformation, the concentration of L‐glutamate decreases slowly, which may be the reason for the decrease of bacterial biological activity. The concentration of L‐glutamate did not change at all. Since the whole cell transformation lasted for about 6 h, L‐glutamate consumption of the three strains did not change, so termination of the whole cell transformation experiment could be considered after 5–6 h. In this experiment, after measuring the residual concentration of L‐glutamate in the fermentation broth after 8 h of transformation, the concentration of L‐glutamate in the whole cell transformation broth corresponding to the three recombinant strains E. coli BL21(DE3)‐Gad B, E. coli BL21(DE3)‐Gad B‐T62S, and E. coli BL21(DE3)‐Gad B‐Q309A was 83.43, 56.92, and 1.03 g/L, respectively. Strains containing GAD before and after mutation can effectively utilize the substrate L‐glutamate for the whole cell transformation experiment, and the degree of L‐glutamate utilization by E. coli BL21(DE3)‐Gad B‐T62S and E. coli BL21(DE3)‐Gad B‐Q309A is higher than that by E. coli BL21(DE3)‐Gad B, proving that the mutant strains have the potential to produce GABA, and the forward mutant strains were successfully obtained.

The whole cell transformation selected can be said to be between fermentation and enzyme transformation. Compared with the consumption of L‐glutamic acid in direct fermentation, whole cell transformation may be due to the directness and specificity of GAD enzyme. As soon as it enters the whole cell transformation experiment, L‐glutamic acid is consumed in large quantities. Compared with enzyme‐catalyzed GABA production, whole cell transformation retains the integrity of the cell and maintains a cascade between various enzymes in the cell [41]; further, the whole cell‐transformed bacteria can be reused, such as in continuous fermentation or transformation. According to the L‐glutamate consumption curve, the consumption rate of L‐glutamate substrate by strains E. coli BL21(DE3)‐Gad B‐T62S and E. coli BL21(DE3)‐Gad B‐Q309A was significantly higher than that by strain E. coli BL21(DE3)‐Gad B. With the passage of time, the influence of environment on enzyme stability limits the ability of strain E. coli BL21 (DE3)‐Gad B to produce GABA, while strains E. coli BL21 (DE3)‐Gad B‐T62S and E. coli BL21 (DE3)‐Gad B‐Q309A can stably consume L‐glutamate in the middle and late stages of transformation compared with strain E. coli BL21 (DE3)‐Gad B, and the effect of E. coli BL21 (DE3)‐Gad B‐Q309A is better. This further shows that site‐directed mutation can effectively improve the stability of GAD and can be used in the production of GABA.

According to the GABA formation curve (as shown in Figure 7C), the accumulation of GABA increased significantly at 1–4 h, the synthesis rate of GABA slowed down at 5 h and there was almost no increase at 7 h. E. coli BL21(DE3)‐Gad B‐T62S and E. coli BL21(DE3)‐Gad B‐Q309A had a higher catalytic rate of GABA synthesis than E. coli BL21(DE3)‐Gad B. After one cycle of whole cell transformation, the concentration of GABA in the corresponding fermentation broth of recombinant strains E. coli BL21(DE3)‐Gad B, E. coli BL21(DE3)‐Gad B‐T62S, and E. coli BL21(DE3)‐Gad B‐Q309A was 219.09, 238.42, and 276.66 g/L, respectively, and the transformation rates were 78.02%, 85.04%, and 98.58%, respectively. The results show that GAD from wild E. coli was expressed in competent E. coli BL21(DE3) cells, which effectively transformed L‐glutamate to GABA, significantly shortened the production cycle and solved the problem of weakening enzyme protein activity due to long‐term fermentation.

In whole cell transformation, GABA is mainly obtained by the enzymatic method. In order to ensure sufficient biological activity of cells, various nutrients in the culture medium should be strictly controlled during early fermentation, and an appropriate IPTG concentration should be selected for induction at the appropriate time. In the experiment, whole cell‐transformed bacteria are generally collected by centrifugation. The centrifugation process may cause damage to the bacteria. We can try to collect the bacteria by natural sedimentation in order to provide them a certain degree of protection. In this experiment, in the later stage of whole cell transformation, due to the lack of increase of bacterial activity and the accumulation of products in the fermentation tank, the experiment was terminated. The GABA production efficiency of this process is high, but a large number of bacteria are discarded after being used in a short time. In a later experiment, we can try to recover the bacteria for whole cell transformation to produce GABA while achieving continuous transformation to produce GABA so that the bacteria can be reused. Compared with direct feeding, continuous feeding may alleviate the problem that the concentration of L‐glutamate in the fermentation broth is too high and affects the performance of bacteria. Of course, too high a concentration of GABA will also inhibit the rate of GABA production, so that the GABA produced in cells cannot be transported out of cells in time, thus affecting the yield of GABA. Therefore, it is necessary to effectively isolate the GABA produced during whole cell transformation, which should be paid attention to in future research.

At present, the yield of GABA produced by E. coli or Lactobacillus brevis is higher than that by other strains (such as Corynebacterium glutamicum, yeast, Aspergillus oryzae, etc.) [42]. Plokhov et al. [43]. reported the expression of E. coli K‐12 GAD in E. coli BL21(DE3), and the whole cell was transformed into GABA with a transformation rate of 98.6%. Zhang et al. [44]. Screened a strain of L. brevis GLB‐127 and transformed it into GABA in a 10 L fermentation tank, with a conversion rate of 98.5%, which is a high level of GABA production at present. Although C. glutamicum itself does not have a GABA metabolic system, it is a strain that produces a high level of the GABA precursor L‐glutamate. The method of recombining the GAD system into C. glutamicum and producing GABA with a recombinant strain has also attracted attention, which also effectively utilizes the L‐glutamic acid produced in its own metabolic system [45]. In this study, the GABA conversion rate of the recombinant strain E. coli BL21 (DE3)‐Gad B‐Q309A was the highest, 98.58%, but did not reach the level obtained in relevant studies. However, this experiment only verified the GABA production ability of the recombinant strain, and did not refine and adjust the operating conditions of the fermentation and transformation processes. Therefore, it is necessary to optimize the fermentation and transformation conditions in the later stage to improve the GABA yield. In recent years, GABA has tended to be produced at the food and drug level. Attention should be paid to the production of GABA with GAD from probiotics [46]; however, when wild GAD is used for continuous transformation or long‐term preservation, its vitality is often damaged due to its insufficient stability, affecting the use effect [47]. Considering the strong operability and clear genetic background of E. coli, this experiment carried out site mutation on GAD from E. coli K‐12. While improving the stability of GAD, the whole cell transformation of recombinant strain E. coli BL21(DE3)‐Gad B‐Q309A produced GABA, and the yield reached 98.58%. This provides a certain convenience for the production of GABA and the preservation of GAD. In the following research, while making full use of the directed transformation technology of enzymes to transform GAD and improve the yield of GABA, we should also expand the transformation of other enzymes, to strengthen the application of various enzymes and facilitate the further expansion of production.

4. CONCLUSIONS

In this study, the Gad B gene of E. coli K‐12 was used as the template. The two amino acid residues affecting the catalytic performance of GAD were identified using bioinformatics methods, and the GAD before and after mutation was recombined into E. coli BL21(DE3). The mutated GAD enzyme was used to increase GABA production through the whole cell transformation approach. Two effective mutants, Gad B‐T62S and Gad B‐Q309A, were obtained. The enzyme activity of the mutants at different temperatures and pH was 4%–13% higher than that of the wild type. The pH stability was 6%–10% higher than that of the wild type and the temperature stability was 19%–27% higher than that of the wild type, while the catalytic activity and affinity with the substrate were found to be improved. The transformation rate of E. coli BL21(DE3)‐Gad B‐T62S and E. coli BL21(DE3)‐Gad B‐Q309A was higher than that of E. coli BL21(DE3)‐Gad B; the highest transformation rate was obtained for E. coli BL21(DE3)‐Gad B‐Q309A, reaching 98.58% in the present study. Overall, this study not only contributes a strategy for the directional transformation of enzymes to improve GABA production, but also enhances current knowledge related to the whole cell transformation method.

CONFLICT OF INTEREST STATEMENT

The authors have declared no conflicts of interest.

ACKNOWLEDGMENTS

This research was funded by National Natural Science Foundation of China, grant number 31860020; Key R&D Projects in Ningxia, grant number 2019BCH01002; Ningxia Hui Autonomous Region Youth Top Talent Training Project grant number 022004000010; Ningxia Key Laboratory of Food Microbial Application Technology and Safety Control Platform Construction Project, grant number 2021DPC05003.

Fengmin L, Heng Z, Xiangjun Z, Xiaobo W, Huiyan L, Haitian F. Site‐directed mutagenesis improves the practical application of L‐glutamic acid decarboxylase in Escherichia coli . Eng Life Sci. 2023;23:e2200064. 10.1002/elsc.202200064

Contributor Information

Liu Fengmin, Email: liuhy@nxu.edu.cn.

Fang Haitian, Email: fanght@nxu.edu.cn.

REFERENCES

  • 1. Zhao Y, Long A, Guo S, et al. LMR‐101, a novel derivative of propofol, exhibits potent anticonvulsant effects and possibly interacts with a novel target on γ‐aminobutyric acid type A receptors. Epilepsia. 2021;62(1):238‐249. [DOI] [PubMed] [Google Scholar]
  • 2. Myers KA, Bennett MF, Grinton BE, et al. Contribution of rare genetic variants to drug response in absence epilepsy. Epilepsy Res. 2021;170:106537. [DOI] [PubMed] [Google Scholar]
  • 3. Miyata S, Kakizaki T, Fujihara K, et al. Global knockdown of glutamate decarboxylase 67 elicits emotional abnormality in mice. Molecular Brain. 2021;14(1):1‐14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Bullock A, Kaul I, Li S, et al. Zuranolone as an oral adjunct to treatment of Parkinsonian tremor: a phase 2, open‐label study. J Neurol Sci. 2021;421:117277. [DOI] [PubMed] [Google Scholar]
  • 5. Bojesen KB, Broberg BV, Fagerlund B, et al. Associations between cognitive function and levels of glutamatergic metabolites and gamma‐aminobutyric acid in antipsychotic‐naïve patients with schizophrenia or psychosis. Biol Psychiatry. 2021;89(3):278‐287. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Khanna RR, Jahan B, Iqbal N, et al. GABA reverses salt‐inhibited photosynthetic and growth responses through its influence on NO‐mediated nitrogen‐sulfur assimilation and antioxidant system in wheat. J Biotechnol. 2021;325:73‐82. [DOI] [PubMed] [Google Scholar]
  • 7. Sadaji Y, Junichi H, Kiyoshi H. Production of γ‐aminobutyric acid from alcohol distillery lees by Lactobacillus brevis IFO‐12005. J Biosci Bioeng. 2002;93(1):95‐97. [PubMed] [Google Scholar]
  • 8. Zhou M, Ndeurumio KH, Zhao L, et al. Impact of precooling and controlled‐atmosphere storage on γ‐aminobutyric acid (GABA) accumulation in longan (Dimocarpus longan Lour.) fruit. J Agric Food Chem. 2016;64:6443‐6450. [DOI] [PubMed] [Google Scholar]
  • 9. Cho YR, Chang JY, Chang HC. Production of ${∖gamma}‐Aminobutyric $ Acid (GABA) by Lactobacillus buchneri isolated from Kimchi and its neuroprotective effect on neuronal cells. J Microbiol Biotechnol. 2007;17:104‐109. [PubMed] [Google Scholar]
  • 10. Takahashi C, Shirakawa J, Tsuchidate T, et al. Robust production of gamma‐amino butyric acid using recombinant Corynebacterium glutamicum expressing glutamate decarboxylase from Escherichia coli . Enzyme Microb Technol. 2012;51(3):171‐176. [DOI] [PubMed] [Google Scholar]
  • 11. Shelp BJ, Bozzo GG, Trobacher CP, Zarei A, Deyman KL, Brikis CJ. Hypothesis/review: contribution of putrescine to 4‐aminobutyrate (GABA) production in response to abiotic stress. Plant Sci. 2012;193–194:130–135. [DOI] [PubMed] [Google Scholar]
  • 12. Nikmaram N, Dar BN, Roohinejad S, et al. Recent advances in γ‐aminobutyric acid (GABA) properties in pulses: an overview. J Sci Food Agric. 2017;97:2681‐2689. [DOI] [PubMed] [Google Scholar]
  • 13. Cui Y, Miao K, Niyaphorn S, Qu X. Production of gamma‐aminobutyric acid from lactic acid bacteria: a systematic Review. Int J Mol Sci. 2020;21:995 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Pham VD, Somasundaram S, Park SJ, et al. Efficient production of gamma‐aminobutyric acid using Escherichia coli by co‐localization of glutamate synthase, glutamate decarboxylase, and GABA transporter. J Microbiol Biotechnol. 2016;26:710‐716.26838342 [Google Scholar]
  • 15. Vo T, Pham VD, Ko JS, et al. Improvement of gamma‐amino butyric acid production by an overexpression of glutamate decarboxylase from Pyrococcus horikoshii in Escherichia coli . Biotechnol Bioprocess Eng. 2014;19:327‐331. [Google Scholar]
  • 16. Ahram C, Kim BG. Production of gamma aminobutyric acid using recombinant cell carrying L‐glutamate decarboxylase at high substrate concentration. Korean Soc Bioeng Acad Conf. 2011;180. [Google Scholar]
  • 17. Fan LQ, Li MW, Qiu Y, et al. Increasing thermal stability of glutamate decarboxylase from Escherichia. coli by site‐directed saturation mutagenesis and its application in GABA production. J Biotechnol. 2018;278:1‐9. [DOI] [PubMed] [Google Scholar]
  • 18. Jun C, Joo JC, Lee JH, et al. Thermostabilization of glutamate decarboxylase B from Escherichia coli by structure‐guided design of its pH‐responsive N‐terminal interdomain. J Biotechnol. 2014;174:22‐28. [DOI] [PubMed] [Google Scholar]
  • 19. Wu X, Zhang Q, Zhang L, et al. Insights into the role of exposed surface charged residues in the alkali‐tolerance of GH11 xylanase. Front Microbiol. 11:872. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Letícia MZ, Mariana ABM, José AD, et al. Structure‐guided design combined with evolutionary diversity led to the discovery of the xylose‐releasing exo‐xylanase activity in the glycoside hydrolase family 43. Biotechnol Bioeng. 2019;116:734‐744. [DOI] [PubMed] [Google Scholar]
  • 21. Cheng HJ. Study on enzymatic properties of glutamic acid decarboxylase from Bacillus megaterium. Tianjin University of Science and Technology; 2016. [Google Scholar]
  • 22. Bailey TL. Discovering novel sequence motifs with MEME. Curr Protoc Bioinformatics. 2003;2.4:1–2.4, 35. [DOI] [PubMed] [Google Scholar]
  • 23. Goujon M, McWilliam H, Li W, et al. A new bioinformatics analysis tools framework at EMBL–EBI. Nucleic Acids Res. 2010;38(Suppl_2):W695‐W699. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Crooks GE, Hon G, Chandonia JM, et al. WebLogo: a sequence logo generator[J]. Genome Res. 2004;14(6):1188‐1190. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Humphrey W, Dalke A, Schulten K. VMD: visual molecular dynamics. J Mol Graphics. 1996;14:33‐38. [DOI] [PubMed] [Google Scholar]
  • 26. Dehouck Y, Kwasigroch JM, Gilis D, et al. PoPMuSiC 2.1: a web server for the estimation of protein stability changes upon mutation and sequence optimality. BMC Bioinf. 2011;12(1):1‐12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Mótyán JA, Miczi M, Bozóki B, Tőzsér J, et al. Data supporting Ni‐NTA magnetic bead‐based fluorescent protease assay using recombinant fusion protein substrates. Data in Brief. 2018;18:203‐208. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Matsuura K, Shiomi Y, Mizuta T, et al. Horseradish peroxidase‐decorated artificial viral capsid constructed from β‐annulus peptide via interaction between His‐Tag and Ni‐NTA. Processes. 2020;8(11):1455. [Google Scholar]
  • 29. You Q, Chen F, Wang X, et al. Inhibitory effects of muscadine anthocyanins on α‐glucosidase and pancreatic lipase activities. J agricultural food chem, 2011, 59(17):9506‐9511. [DOI] [PubMed] [Google Scholar]
  • 30. Meeploy M, Deewatthanawong R. Determination of γ‐Aminobutyric Acid (GABA) in Rambutan Fruit cv. Rongrian by HPLC‐ELSD and separation of GABA from rambutan fruit using dowex 50W‐X8 column. J Chromatogr Sci. 2015;54:bmv166. [DOI] [PubMed] [Google Scholar]
  • 31. Wang D, Wang Y, Lan H, et al. Enhanced production of γ‐aminobutyric acid in litchi juice fermented by Lactobacillus plantarum HU‐C2W. Food Biosci. 2021;42:101155. [Google Scholar]
  • 32. Yan W, Zhou J, Sun M, et al. The construction of an amino acid network for understanding protein structure and function. Amino Acids. 2014;46:1419‐1439. [DOI] [PubMed] [Google Scholar]
  • 33. Capitani G, Debiase D, Aurizi C, et al. Crystal structure and functional analysis of Escherichia coli glutamate decarboxylase. EMBO J. 2003;22:4027‐4037. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Gut H, Pennacchietti E, John RA, et al. Escherichia coli acid resistance: pH‐sensing, activation by chloride and autoinhibition in GadB. EMBO J. 2006;25:2643‐2651. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Astegno A, Capitani G, Dominici P. Functional roles of the hexamer organization of plant glutamate decarboxylase. Biochim Biophys Acta. 2015;1854:1229‐1237. [DOI] [PubMed] [Google Scholar]
  • 36. Pohl P, Joshi R, Petrvalska O, et al. 14‐3‐3‐protein regulates Nedd4‐2 by modulating interactions between HECT and WW domains. Commun Biol. 2021;4(1):899. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Sales MVS, da Silva Filho RC, Silva MM, et al. Consequences of thimerosal on human erythrocyte hemoglobin: assessing functional and structural protein changes induced by an organic mercury compound. J Trace Elem Med Biol. 2022;71:126928. [DOI] [PubMed] [Google Scholar]
  • 38. Qianzhu H, Abdelkader EH, Herath ID, et al. Site‐specific incorporation of 7‐fluoro‐L‐tryptophan into proteins by genetic encoding to monitor ligand binding by 19F NMR spectroscopy. ACS Sensors. 2022;7:44‐49. [DOI] [PubMed] [Google Scholar]
  • 39. Guo J, Wang Y, Zhang X, et al. Improvement of the catalytic activity of chitosanase BsCsn46A from Bacillus subtilis by site‐saturation mutagenesis of proline121. J Agric Food Chem. 2021;69(40):11835‐11846. [DOI] [PubMed] [Google Scholar]
  • 40. Zhu Y, Qiao C, Li H, et al. Improvement thermostability of Pseudoalteromonas carrageenovora arylsulfatase by rational design. Int J Biol Macromol. 2018;108:953‐959. [DOI] [PubMed] [Google Scholar]
  • 41. Sun C, Peng H, Zhang W, et al. Production of heterodimeric diketopiperazines employing a mycobacterium‐based whole‐cell biocatalysis system. J Org Chem. 2021; 86(16):11189‐11197. [DOI] [PubMed] [Google Scholar]
  • 42. Dahiya D, Manuel JV, Nigam PS. An overview of bioprocesses employing specifically selected microbial catalysts for γ‐aminobutyric acid production. Microorganisms. 2021;9(12):2457. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. Plokhov AY, Gusyatiner MM, Yampolskaya TA, et al. Preparation of γ‐aminobutyric acid using E. coli Cells with high activity of glutamate decarboxylase. Appl Biochem Biotechnol. 2000;88:257‐265. [Google Scholar]
  • 44. Zhang YH, Yuan XH, Gao XL, et al. Study on the preparation of γ ‐aminobutyric acid by Lactobacillus brevis GLB‐127 fermentation. Food Ferment Industry. 2022;48(15):118‐123. [Google Scholar]
  • 45. Wen J, Bao J. Improved fermentative γ‐aminobutyric acid production by secretory expression of glutamate decarboxylase by Corynebacterium glutamicum . J Biotechnol. 2021;331:19‐25. [DOI] [PubMed] [Google Scholar]
  • 46. Diez‐Gutierrez L, San Vicente L, Barron LJR, et al. γ‐aminobutyric acid and probiotics: Multiple health benefits and their future in the global functional food and nutraceuticals market. J Funct Foods, 2020, 64:103669. [Google Scholar]
  • 47. Rúbia P, Souza F, Silva S, et al. Preservation of Bacillus firmus strain 37 and optimization of cyclodextrin biosynthesis by cells immobilized on loofa sponge. Molecules. 2012;17:9476‐9488. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Engineering in Life Sciences are provided here courtesy of Maximum Academic Press

RESOURCES