Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2023 Apr 4.
Published in final edited form as: Lipids. 2018 Oct;53(10):933–945. doi: 10.1002/lipd.12102

The Lentiviral System Construction for Highly Expressed Porcine Stearoyl-CoA Desaturase-1 and Functional Characterization in Stably Transduced Porcine Swine Kidney Cells

Jinhee Hwang 1, Neetu Singh 2, Charles Long 2, Stephen B Smith 1
PMCID: PMC10071579  NIHMSID: NIHMS1874556  PMID: 30592064

Abstract

The most highly regulated and abundant fatty acid in animal tissue is oleic acid (18:1n9). Oleic acid is synthesized by the Δ9 desaturase, stearoyl-CoA desaturase-1 (SCD1), which is responsible for the synthesis of the putative cytokine palmitoleic acid (16:1n7) and 18:2 cis-9, trans-11 conjugated linoleic acid. Owing to the importance of SCD1 in lipid metabolism, we generated porcine swine kidney (SK6) transgenic cell lines for sustained overexpression or knockdown of porcine stearoyl-CoA desaturase-1 (pSCD1) in an inducible manner by utilizing a lentiviral expression system. We successfully validated these cell culture models for expression and functionality of pSCD1 by documenting that the pSCD-transduced cells overexpressed pSCD1 protein and mRNA. Additionally, the pSCD1-transduced cells increased the conversion of palmitate (16:0) to palmitoleic acid nearly fourfold. The lentiviral vectors utilized in this study can be further used to generate transgenic animals to document the effects of the overexpression of SCD1 on obesity and steatosis.

Keywords: Knockdown, Overexpression, Palmitoleic acid, Porcine SCD1, SK6 cells, Tet-inducible system

Introduction

Epidemiological and randomized controlled studies have provided conflicting evidence regarding dietary fat and risk for cardiovascular disease (CVD). Although epidemiological studies (Posner et al., 1991; Xu et al., 2006) indicated significant positive associations between the incidence of CVD and the proportion of dietary energy intake from monounsaturated fatty acids (MUFA), randomized controlled studies indicated that increasing dietary oleic acid (18:1n9) reduced risk factors for CVD (Adams et al., 2010; Gilmore et al., 2011, 2013; Kris-Etherton et al., 1999). However, endogenously produced oleic acid may promote obesity, hepatic steatosis, and lipid accumulation in muscle (Hulver et al., 2005; Ntambi and Miyazaki, 2004).

The conversion of saturated fatty acids (SFA) to MUFA by the fatty-acid Δ9 desaturase, stearoyl-CoA desaturase-1 (SCD1), accounts for the majority of MUFA in porcine muscle and adipose tissue (Klingenberg et al., 1995; St John et al., 1991). SCD1 is also responsible for the conversion of trans-vaccenic acid to its corresponding conjugated linoleic acid isomer, 18:2 cis-9, trans-11 (Ntambi and Miyazaki, 2003). In laboratory rodents, SCD1 is expressed in both liver (Ntambi, 1992; Waters and Ntambi, 1994) and adipose tissue (Kang et al., 2004), although SCD1 activity is at least two orders of magnitude higher in mouse liver than in adipose tissue (Enser, 1979). Oleic acid is the preferred substrate for acyl-CoA:cholesterol acyltransferase (Landau et al., 1997; Miyazaki et al., 2000), and adipose tissue stores cholesterol primarily as cholesterol ester (Sweeten et al., 1990).

We have used pig as a model to document the effects of dietary fatty acids on lipid metabolism (Demaree et al., 2002; Go et al., 2012; King et al., 2004; Smith et al., 1996a, b, 1999, 2002; St John et al., 1987a). Feeding palmitic acid (16:0) or a combination of myristoleic acid (14:1n5) plus palmitoleic acid (16:1n7) to pigs depressed lipid synthesis from glucose and subcutaneous adipocyte size (Smith et al., 1996b), whereas the myristoleic/palmitoleic acid combination increased plasma low-density lipoprotein cholesterol (Smith et al., 1996a). SCD1 activity in porcine adipose tissue increases when fed a starch-based diet, and is greater in obese pig adipose tissue than in lean pigs (Smith et al., 1999). In contrast to rodents, porcine adipose tissue exhibits substantially higher SCD1 catalytic activity than liver or intestinal mucosal cells (Klingenberg et al., 1995). However, we demonstrated that there were no differences in SCD1 gene expression across liver, muscle, adipose tissue, and intestinal mucosal cells (Go et al., 2012), suggesting translational or post-translational control of activity.

SCD1 expression was previously demonstrated in mouse kidney, which was depressed during the onset of diabetes (Wilson et al., 2003). SCD1 is expressed in proximal kidney tubule cells, and SCD1 expression is increased during uromodulin-associated kidney disease (Horsch et al., 2014). The predominant isoform of SCD in mouse kidneys is SCD1 (Ntambi and Miyazaki, 2003), and SCD1 is upregulated in the glomeruli of patients with diabetic nephropathy (Sieber et al., 2013). Palmitic acid induces glomerular podocyte death, whereas palmitoleic acid and oleic acid attenuate palmitic acid-induced lipotoxicity in podocytes (Sieber et al., 2010).

Measurement of SCD1 activity requires large amounts of microsomal protein and the assay inherently has high intra-sample variability (Chung et al., 2007; Smith et al., 2002; St John et al., 1991; Yang et al., 1999). SCD1 activity has not been described in porcine kidney cells. The porcine swine kidney (SK6) cell line has been used to study viral infections such as hog cholera (Terpstra et al., 1990) and classical swine fever (Chen et al., 2015; van Gennip et al., 1999). However, to date, SCD1 expression has not been documented in SK6 cells. We predicted that endogenous SCD1 expression would be low in this kidney cell line, and hypothesized that SCD1 expression would be upregulated in SK6 cells by exposure to palmitic acid. Therefore, one objective of this study was to establish an effective and highly reproducible means of estimating functional SCD1 catalytic activity. To accomplish this goal, we used SK6 cells, which do not contain detectable SCD1 mRNA or protein and further, SK6 cells transduced with an inducible porcine stearoyl-CoA desaturase-1 (pSCD1) lentiviral construct. pSCD1-transduced SK6 cells effectively converted supplemental palmitic acid to palmitoleic acid, consistent with profound increases in SCD1 mRNA and protein. The long-term goal of this research is to generate transgenic pigs for the study of obesity and muscle and liver steatosis using the lentiviral constructs utilized in this study.

Methods

Cell Lines

SK6 cells were obtained from the Foreign Animal Disease Diagnostic Laboratory at Plum Island Animal Disease Center, Greenport, NY, USA. Cells were cultured under standard tissue culture conditions, using Dulbelco’s modified Eagle’s medium (DMEM) (Life Technologies/Invitrogen, Grand Island, NY, USA) containing 10% FBS (Atlanta Biologicals, Flowery Branch, GA, USA) and supplemented with 1% antibiotics (Life Technologies/Invitrogen, Grand Island, NY, USA) and 1% nonessential amino acids. Lenti-X 293T cell line (Clontech Laboratories, Inc., Mountain View, CA, USA) is a human embryonic kidney (HEK) cell line, transformed with adenovirus type 5 DNA that also expresses the SV40 large T antigen. The lenti-X 293T cell line was subcloned for high transfectability and high-titer virus production. This cell line was used to produce recombinant lentiviruses. These cells were also cultured under similar standard conditions to those explained above.

Generation of All-In-One Tet-Inducible Bidirectional Lentiviral Vector for pSCD1 Overexpression

The all-in-one bidirectional lentiviral vector system was derived from pLVX-Tre3G-IRES (Clontech Laboratories Inc., Mountain View, CA, USA) (Fig. 1a) and consisted of a cytomegalovirus promoter (CMV)-driven Tet responsive transactivator (rt-TA) (Tet-On 3G transactivator) in the reverse orientation with gene of interest (GOI) under the influence of tetracycline responsive element (Tre3G) promoter in the forward direction (Fig. 1b). The promoters (CMV and Tre3G) in bidirectional orientation were separated by a ubiquitous chromatin opening element (UCOE) known to promote sustained and reliable transgene expression by resisting DNA methylation (Zhang et al., 2010). In the presence of doxycycline (dox), the rt-TA (Tet-On 3G) is expressed, which in turn binds to Tre3G to drive the expression of the transgene.

Fig. 1.

Fig. 1

Open in a new tab

Schematics of the lentiviral vector constructs. Porcine swine kidney (SK6) cells were transduced with the bidirectional lentivector construct depicted in Fig. 1c followed by puromycin selection to generate SK6-I-pSCD1 cells that could be induced with doxycycline to express pSCD1 and GFP. The transcription directions of the CMV, Tre3G, and PGK promoters are indicated with arrows. The lentiviral bidirectional promoter constructs were packaged as recombinant Lenti viruses in HEK293T cells. (a) Schematics of pLVX-Tre3G-IRES (Clontech). (b) Schematics of bidirectional pLVX-UCOE-Tre3G-GOI. (c) Schematics of bidirectional pLVX-UCOE-Tre3G-pSCD1. LTR, long-terminal repeat; ψ, packaging signal; ZE, zeocin; rt-TA, Tet responsive transactivator; Tre3G, Tet promoter; CMV, cytomegalovirus promoter; PGK, phosphoglyceratekinase promoter; UCOE, ubiquitous chromatin opening element; pSCD1, porcine stearoyl-CoA desaturase-1; IRES, internal ribosome entry site; and GFP, green fluorescent protein

The full-length coding sequence of porcine SCD1 was amplified from reverse-transcribed porcine mRNA using primers listed in Table 1. The amplified pSCD1 gene was inserted at BamHI-NotI sites of a bidirectional lentiviral vector, pLVX-UCOE-Tre3G-GOI, under the influence of Tre3G in the forward orientation followed by internal ribosome entry site (IRES)-green fluorescent protein (GFP) to create pLVX-UCOE-Tre3G-pSCD1 (Fig. 1c). The recombinant lentiviral vectors also consisted of a puromycin antibiotic selection marker driven by the phosphoglycerate kinase (PGK) promoter for selection of transduced cells. The correct orientation and integrity of recombinant lentiviral vector was confirmed by restriction enzyme analysis followed by DNA sequencing.

Table 1.

Primers for Real-time quantitative polymerase chain reaction, and cloning of pSCD1 and pSCD short hairpin RNA (shRNA)a

Gene Accession number Sequence Amplicon length (bp)
Primers for qPCR
pSCD1 NM_213781.1 F: 5′-ACACTTGGGAGCCCTGTATG-3′
R: 5′-GGGCAGTCGAGCTTTGTAAG-3′		 152
pGAPDH NM_001206359.1 F: 5′-TCGGAGTGAACGGATTTG-3′
R: 5′-CCTGGAAGATGGTGATGG-3′		 219
pYWHAG XM_005661962.3 F: 5′-TTTTTCCAACTCCGTGTTTCTCT-3′
F: 5′-CCATCACTGAGGAAAACTGCTAA-3′		 75
pYWHAZ XM_021088756.1 F: 5′-ATGCAACCAACACATCCTATC-3′
R: 5′-ATGCAACCAACACATCCTATC-3′		 178
Primers for cloning
pSCD1 NM_213781.1 F: 5′- ATGCCGGCCCACTTGCTGC-3′
R: 5′- AAGGGACCCCAAACTCAG-3′		 1094
pSCD1shRNA1 oligo TGCTGTTGACAGTGAGCGAGCCCAAGCTTGAATATGTTTGTAGTGAAGCCACAGATGTACAAACATATTCAAGCTTGGGCCTGCCTACTGCCTCGGA
pSCD1shRNA2 oligo TGCTGTTGACAGTGAGCGCGGAGTCACCGAACTTACAAAGTAGTGAAGCCACAGATGTACTTTGTAAGTTCGGTGACTCCATGCCTACTGCCTCGGA
Open in a new tab
a

pSCD1, porcine stearoyl-CoA desaturase-1; pGAPDH, porcine glyceraldehyde 3-phosphate dehydrogenase; pYWHAG, porcine tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein gamma; and pYWHAZ, tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta.

Generation of All-In-One Tet-Inducible Bidirectional Lentiviral Vector for Knockdown of pSCD1

To generate the all-in-one bidirectional lentiviral vector system for suppression of pSCD1, we utilized the same lentiviral backbone utilized for pSCD1 overexpression. Two short hairpin RNA (shRNA1 and shRNA2) were designed to target different regions of pSCD1 and a scrambled shRNA was designed as a control. short hairpin RNA (shRNA) for pSCD1 were designed using a web-based tool (RNAi Central; http://cancan.cshl.edu/RNAi_central/RNAi.cgi?type=shRNA). Each shRNA was cloned using second-generation shRNA-mirs by the PCR-based strategy described previously (Silva et al., 2005) into a noninducible lentiviral vector (PEG) consisting of a mir (miR30 microRNA) cassette (Fig. 2a) (Golding and Mann, 2011) to create PEG-pSCD1shRNA1, PEG-pSCD1shRNA2, and PEG-scrambled shRNA. The shRNA-mir cassette was cloned into the 3′ UTR of GFP under the influence of the elongation factor-1α (EF1α) promoter for constitutive expression of hairpins (Fig. 2a). The sequences for pSCD1shRNA oligos are listed in Table 1. Restriction enzyme analysis and DNA sequencing confirmed all cloned pSCD1shRNA. The GFP-pSCD1shRNA fragment was cut from PEG-pSCD1shRNA and cloned at BamHI-sphI in bidirectional lentiviral vector pLVX-UCOE-Tre3G to create pLVX-UCOE-Tre3G-pSCD1shRNA (Fig. 2b).

Fig. 2.

Fig. 2

Open in a new tab

Schematics of the lentiviral vector constructs. The transcription direction of the CMV, Tre3G PGK and EF1α promoters are indicated with arrows. The lentiviral bidirectional constructs (pLVX-Tre3G-GFP-pSCD1shRNA and pLVX-UCOE-Tre3G-GFP-pSCD1shRNA) and lentiviral unidirectional construct (PEG-pSCD1shRNA) were packaged as recombinant lentiviruses in HEK293T cells. (a) Schematic of PEG-pSCD1shRNA. (b) Schematic of bidirectional pLVX-UCOE-Tre3G-pSCD1shRNA. LTR, long-terminal repeat; ψ, packaging signal; Ze, zeocin; rt-TA, Tet responsive transactivator; Tre3G, Tet promoter; CMV, cytomegalovirus promoter; PGK, phosphoglyceratekinase promoter; UCOE, ubiquitous chromatin opening element; pSCD1, porcine stearoyl-CoA desaturase-1; EF1α, elongation factor; GFP, green fluorescent protein; shRNA, short hairpin RNA, and miR, flanking and loop sequences from an endogenous miRNA that directs the excision of the engineered miRNA from a pri-miRNA

Production of Recombinant Lentiviral Vector Stock

The lentiviral vector stocks were generated by triple plasmid cotransfection of HEK293T cells, with a Calcium Phosphate Transfection Kit (Life Technologies, Grand Island, NY, USA) or X-Fect Transfection Reagent (Clontech Laboratories Inc., Mountain View, CA, USA). Briefly, the HKE293T cells were cotransfected with bidirectional lentiviral vectors expressing the pSCD1 or pSCD1shRNA cassettes along with envelope plasmid pMD.G and packaging plasmid pCMV8.91 described previously (Case et al., 1999; Miyoshi et al., 1999). A total of 13.8 μg of vector, 10.2 μg of pCMV8.91, and 6 μg of pMD.G plasmid were used to transfect a 10-cm tissue culture dish. The transfection efficiency was determined by GFP expression by fluorescence microscopy. The medium was replaced with DMEM after 24 h of transfection. The supernatant fractions were harvested 48 and 72 h after transfection, centrifuged at 1000 × g for 10 min and filtered through a 0.45 μm polyethersulfone (low protein binding) filter. The recombinant lentiviral vector stocks were concentrated using a Lenti-X Concentrator (Clontech Laboratories Inc., Mountain View, CA, USA) as per the manufacturer’s protocol. Briefly, the lentiviral vector particles were concentrated by combining 1 volume of the Lenti-X Concentrator with 3 volumes of clarified supernatant fraction followed by incubation at 4 °C for 60 min and centrifugation at 1500 × g for 45 min. The supernatant fraction was removed carefully, and the pellet was resuspended in 1/100th of the original volume using complete DMEM.

Viral titers were determined by a standard viral titration protocol that consists of transducing SK6 cells with serial dilutions of these recombinant lentivirus stocks and then selecting for stable transductants with antibiotic (3 μg/mL of puromycin) and counting the resulting cell colonies. This dose of puromycin was selected based on the kill curve in unmodified SK6 cells. The titer of virus corresponds to the number of colonies generated by the highest dilution. Viral titers were 4.5 × 105 colony forming units (CFU).

Generation of Transgenic SK6 Expressing pSCD1

SK6 cells were transduced with recombinant lentiviral stocks at the multiplicity of infection of 1 along with 4 μg/mL of polybrene. Media were replaced 24 h after transduction with DMEM supplemented with 10% tetracycline free heat-inactivated FBS. After 48 h, transduced cells were subjected to puromycin drug selection at a dose of 3 μg/mL for 7–14 days to obtain stable transductants. Puromycin-resistant colonies were picked using cloning cylinders and expanded in the presence of puromycin at a maintenance dose of 0.25 μg/mL. These colonies were selected and expanded to create SK6-I-pSCD1 cells. Transduced SK6 cells were induced with dox at a dose of 4 μg/mL for transgene (pSCD1 and GFP) expression. Transduction efficiency in SK6 cells upon induction with dox was estimated based on GFP fluorescence. This dose of dox was optimized in SK6 cells by a dose response experiment. Dox was replenished in media every 48–72 h.

Testing shRNA Knockdown of pSCD1

Inserting shRNA into the mir cassette ensured efficient processing of the expressed hairpins (Manjunath et al., 2009). The efficiency of the hairpins was validated in SK6-I-pSCD1 cells that were overexpressing pSCD1, because SK6 cells exhibited very low or undetectable levels of pSCD1. SK6-I-pSCD1 cells in 6-well plates induced pSCD1 and GFP expression 48 h before transfection by induction with dox. Following 48 h, the cells were mock transfected or with 2 μg/mL of PEG-pSCD1shRNA1, PEG-pSCD1shRNA2, and PEG-scrambled shRNA using Lipofectamine 3000 (Thermo Fisher Scientific, Waltham, MA, USA). The medium was replaced with DMEM after 24 h of transfection. The cells were harvested 48 h post-transfection for RNA and protein analysis.

Real-time Quantitative Polymerase Chain Reaction (RT-qPCR)

Total RNA was isolated from cells using the RNAeasy kit (Qiagen, Valencia, CA, USA) as per the manufacturer’s protocol followed by DNAseI (Sigma-Aldrich, St. Louis, MO, USA) treatment. The DNAseI-treated RNA was quantified and used to produce cDNA with the qScript kit (Quanta Biosciences, Gaithersburg, MD, USA) according to the manufacturer’s instructions. Relative mRNA levels were determined by comparative cycle threshold (CT) analysis (Livak and Schmittgen, 2001) for pSCD1 using the PerfeCTa SYBR Green FastMix, ROX (Quanta Biosciences, Gaithersburg, MD, USA) on an ABI Prism 7500 thermocycler (Applied Bio systems, Carlsbad, CA, USA). Porcine glyceraldehyde 3-phosphate dehydrogenase (GAPDH), tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta (YWHAZ), and tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein gamma (YWHAG) were used as endogenous controls for these experiments. Relative mRNA levels were expressed as fold change over transfection control. The primers used in these studies are listed in Table 1.

Western Blot

Protein concentrations in samples were measured using the Pierce BCA Protein Assay Kit (Life Technologies, Grand Island, NY, USA). Total protein (30 μg) was separated on a 12% sodium dodecyl-sulfate-polyacrylamide gel electrophoresis gel at constant current. Proteins in the gel were transferred onto a polyvinylidene fluoride membrane using Mini Trans-Blot (Bio-Rad, Hercules, CA, USA). Porcine SCD1 and β-actin were detected using a polyclonal anti-SCD1 (2 μg/mL) and anti-β-actin antibodies (0.2 μg/mL) (Abcam, Cambridge, MA, USA). For quantification of SCD1 protein, the pixel intensity of the SCD1 signal was normalized to that of β-actin for each sample using Image J software.

Palmitic Acid Treatment and Fatty-Acid Analysis

SK6 and SK6-I-pSCD1 cells (dox + and dox−) in T-175 flasks were mock treated or treated with an inhibitor of SCD1 activity (ab 142,089, Abcam, Cambridge, MA, USA) (2 μM). Twenty-four hours later, cells were exposed to 50 μM palmitic acid or ethanol (control). Six hours after palmitic acid treatment, cells were harvested for fatty acid, RNA, and protein analyses. The extraction of fatty acids was conducted by a modification of the method of Folch et al. (1957). Total lipids from SK6 cells were extracted in chloroform/methanol (2:1, vol/vol) and then methylated by 14% (wt/vol) boron trifluoride-methanol (Sigma-Aldrich Corp, St. Louis, MO, USA). The fatty-acid methyl esters (FAME) were analyzed using a gas chromatograph equipped with a CP-8200 auto sampler and a flame-ionization detector (FID) (Varian CP-3800 GC system, Varian Inc., Walnut Creek, CA, USA). FAME were separated on a CP-Sil88 fused silica capillary column (100 m × 0.25 mm internal diameter with 0.2 mm film thickness), with hydrogen as the carrier gas at a flow rate of 35 mL/min (split ratio 20:1) (Chrompak Inc., Middleburg, Netherlands). The oven temperature was programmed to increase from 150 °C at 5 °C/min to 220 °C and held for 22 min. Front inlet and FID temperatures were at 270 and 300 °C, respectively. Individual fatty-acid peaks were identified by genuine external standard GLC-68D (Nu-Chek Prep, Inc., Elysian, MN, USA) and calculated as the ratio of individual areas to that of total identified fatty acids.

Statistical Analyses

Statistical analysis was performed using either Student’s t-test or one-way ANOVA followed by Tukey’s Multiple Comparison Test (Graph Pad Prism 6.0, Graph Pad Software, La Jolla, CA, USA). Means for fatty-acid percentages were compared by ANOVA and when significant (p < 0.05), means were separated by Fisher’s Protected least significant differences method. All the experiments were performed in triplicate with at least two independent runs. The data are presented as mean ± SEM. Treatment means were considered significantly different when p < 0.05.

Results

Overexpression of pSCD1 in Transduced SK6 Cells

The expression of pSCD1 in lentiviral-transduced SK6 cells (SK6-I-pSCD1 cells) was validated by real-time quantitative polymerase chain reaction (RT-qPCR) and Western blot. SK6-I-pSCD1 cells were subjected to puromycin selection at a dose of 3 μg/mL, which resulted in death of majority of the SK6 cells within 3–4 days, with only SK6-I-pSCD1 cells surviving in colonies. These colonies were expanded in the presence of puromycin (3 μg/mL) for 10–14 days and thereafter they were grown in maintenance dose of puromycin (0.5 μg/mL). Two colonies (Cl 1 and Cl 2), seeded in 6-well plates, were induced with different doses of dox as indicated in Fig. 3a to test the dose response. Twenty-four hours after dox induction (dox+), GFP expression was monitored under a microscope. Both Cl 1 and Cl 2 exhibited GFP expression upon induction with dox (data not shown). Cells were harvested for RNA 48 h postdox induction. A dose-dependent increase in pSCD1 transcripts was observed (Fig. 1a). There was a significant increase in pSCD1 mRNA levels in both Cl 1 and Cl 2 upon induction with dox at 2 μg/mL (>600-fold increase) and 4 μg/mL (>800-fold increase) as compared to uninduced (dox−) SK6-I-pSCD1 cells (Fig. 3a). The mRNA levels of pSCD1 Cl 2 at either level of dox were not different than Cl 1 (Fig. 3a). However, in Cl 1, 4 μg/mL dox increased the level of pSCD1 mRNA compared to 2 μg/mL dox (p < 0.05). To determine the optimum time after dox induction for harvesting and analyzing our samples for transgene (pSCD1) expression, we performed a time-response study.

Fig. 3.

Fig. 3

Open in a new tab

Doxycycline-induced expression of porcine SCD1 (pSCD1) in SK6-I-pSCD1 cells. (a) Dose response in two colonies of SK6-I-pSCD1 cells. (b) Time effects against treatment of dox in two colonies of SK6-I-pSCD1 cells. (c) pSCD1 protein levels detected by Western blot using anti-SCD1 or anti-β actin antibodies. dox, doxycycline; SK6-I-pSCD1, SK6 cells overexpressing pSCD1. pSCD1, porcine stearoyl-CoA desaturase-1. *p < 0.05, **p < 0.001, and ***p < 0.0001

Cells from two transgenic colonies, Cl 1 and Cl 2, were seeded in 6-well plates and induced with dox at a dose of 4 μg/mL. The samples were harvested at indicated time points after dox induction (Fig. 3b). There was a significant increase in pSCD1 transcripts in transduced Cl 1 and Cl 2 cells upon induction with dox as compared to induction without dox in SK6-I-pSCD1 cells at all time points (Fig. 3b). The increase in pSCD1 mRNA levels in SK6-I-pSCD1 cells (dox+) was detected as early as 24 h postdox induction and maintained until 72 h. There was a substantial decrease, though not significant, in the pSCD1 mRNA levels 96 h after addition of dox to culture media, suggesting that fresh dox has to be replenished after every 48–72 h in the culture media.

The expression of pSCD1 also was confirmed by Western blot analysis (Fig. 3c), wherein a pSCD1-specific band corresponding to 37 kDa was seen in cell lysates of SK6-I-pSCD1 cells induced with dox. Interestingly, no band was observed in cell lysates of normal SK6 cells, indicating that SCD1 is expressed at very low or undetectable levels in these cells.

shRNA-suppressed Expression of pSCD1

Transfection of SK6-I-pSCD1 cells (overexpressing pSCD1) with PEG-pSCD1shRNA1 or PEG-pSCD1shRNA2 led to significant knockdown of pSCD1 as compared to PEG-scrambled shRNA (Fig. 4a). A similar trend was observed with Western blot analysis (Fig. 4b). PEG-pSCD1shRNA2 showed a better knockdown efficiency of pSCD1 than PEG-pSCD1shRNA1. A significant decrease in pSCD1 protein expression was observed in cell lysates of PEG-pSCD1shRNA2 as compared to PEG-scrambled shRNA (Fig. 4c). Therefore, we used PEG-pSCD1shRNA2 in our inducible all-in-one lentiviral system and for further experiments. To generate the inducible all-in-one lentiviral system for knocking down pSCD1, we cloned the GFP-pSCD1shRNA2-mir fragment from PEG-pSCD1shRNA2 in bidirectional pLVX-UCOE-Tre3G-GOI at BamHI-SphI sites replacing GOI-IRES-GFP to create bidirectional pLVX-UCOE-Tre3G-GFP-pSCD1shRNA2-mir (Fig. 4a).

Fig. 4.

Fig. 4

Open in a new tab

Knockdown of pSCD1 in SK6 and SK6-I-pSCD1 cells overexpressing pSCD1. SK6 cells or SK6-I-pSCD1 cells overexpressing pSCD1 were mock transfected or transfected with lentivector shRNA constructs, PEG-SCD1shRNA1, PEG-SCD1shRNA2 or PEG-scrambled shRNA at a dose of 2.0 μg using lipofectamine 3000. (a) % knockdown of pSCD1 mRNA. (b) Knockdown of pSCD1 protein by Western blot using anti-SCD1 or anti-β-actin antibodies. (c) Relative pSCD1 protein expression quantified and normalized to β-actin from three independent experiments and expressed as means ± SEM (image J). dox, doxycycline; pSCD1, porcine stearoyl-CoA desaturase-1; shRNA, short hairpin RNA; SK6-I-pSCD1, SK6 cells overexpressing pSCD1. *p < 0.05, **p < 0.001, and ***p < 0.0005, determined by two-tailed Student’s t-test

Functional Assessment of pSCD1 in SK6-I-pSCD1 Cells

The functionality of pSCD1 in SK6 and SK6-I-pSCD1 cells was assessed by fatty-acid analysis in the absence or the presence of supplemental palmitic acid and an inhibitor of SCD1 activity. We previously had demonstrated that supplemental palmitic acid enhanced bovine SCD1 gene expression, putatively through interaction with the intrinsic SCD1 promoter (Choi et al., 2016). Therefore, we first established the effect of supplemental palmitic acid and SCD1 inhibitor treatment in SK6 and SK6-I-pSCD1 cells on pSCD1 gene expression. There was not a significant difference between SCD1 transcripts in the absence or presence of palmitic acid (50 μM) and SCD1 inhibitor (2 μM) (Fig. 5a), indicating that supplemental palmitic acid has no effect on pSCD1 gene expression in the SK6-I-pSCD1 cell system. However, the SCD1 inhibitor significantly decreased the SCD1 protein level in SK6-I-pSCD1 cells induced with dox (p < 0.05) (Fig. 5b, c). In the absence of supplemental palmitic acid, palmitic acid, stearic acid (18:0), and oleic acid were the most abundant fatty acids in SK6 cells and comprised 20.5, 20.9, and 30.4 mol% of total fatty acids (Table 2). The less abundant fatty acid, palmitoleic acid, comprised 4.0 mol%. With the addition of 50 μM palmitic acid, cellular palmitic acid increased from 20.5 to 28.7 mol%.

Fig. 5.

Fig. 5

Open in a new tab

pSCD1 in SK6 and SK6-I-pSCD1 cells after palmitic acid treatment. (a) Fold increase in pSCD1 mRNA and (b) Western blot analysis using anti-β-actin or anti-SCD1 antibodies. (c) Relative pSCD1 protein expression was normalized to β-actin from three independent experiments and expressed as means ± SEM (image J). abcMeans within with common superscripts are not different (p > 0.05). 16:0, palmitic acid; dox, doxycycline;pSCD1, porcine stearoyl-CoA desaturase-1; SCD1Inh, SCD1 inhibitor

Table 2.

Fatty-acid composition of swine kidney (SK6) cells and SK6-I-pSCD1 cells. SK6 or SK6-I-pSCD1 cells (with or without dox) were incubated in the absence and presence of palmitic acid (16:0) and SCD1 inhibitor. SK6-I-pSCD1 cells (overexpressing pSCD1) were transfected with PEG-SCD1shRNA2. Data are means plus pooled SEM for n = 3 independent cell cultures

SK6 cell fatty-acid composition (mol%)
Treatment main effect 16:0 16:1n7 18:0 18:1n9 16:1n7/18:0 ratio
Effects of the palmitic acid ± SCD1 inhibitor
 SK6−16:0 20.5b 4.0a 20.9a 30.4a 0.193a
 SK6 + 16:0 28.7a 3.7a 19.8a 28.1ab 0.189a
 SK6 + 16:0 + SCD1 inhibitor 27.9a 2.8a 22.1a 25.9b 0.120a
Effects of pSCD1 ± palmitic acid
 SK6-I-pSCD1 − dox − 16:0 22.1b 5.3ab 17.6a 35.4a 0.299ab
 SK6-I-pSCD1 − dox + 16:0 26.1ab 6.7a 15.6a 28.1b 0.432a
 SK6-I-pSCD1 − dox + 16:0 + SCD1 inhibitor 31.6a 3.6b 19.6a 23.4b 0.185b
Effects of the dox ± palmitic acid ± SCD1 inhibitor
 SK6-I-pSCD1 + dox − 16:0 14.4c 10.9b 16.5a 31.1a 0.661ab
 SK6-I-pSCD1 + dox + 16:0 26.2b 14.3a 13.3a 24.7b 1.079a
 SK6-I-pSCD1 + dox + 16:0 + SCD1 inhibitor 35.9a 6.8c 15.5a 21.2b 0.447b
Effects of the pSCD1shRNA2 + dox ± palmitic acid ± SCD1 inhibitor
 SK6-I-pSCD1 + dox −16:0 + pSCD1shRNA2 16.3c 5.4a 20.0a 34.4a 0.268a
 SK6-I-pSCD1 + dox −16:0 + pSCD1shRNA2 24.2ab 5.0a 18.7a 31.7ab 0.268a
 SK6-I-pSCD1 + dox + 16:0 + pSCD1shRNA2 + SCD1 inhibitor 25.4a 3.7a 21.4a 27.8b 0.172a
Pooled SEM 1.15 0.60 0.56 0.72 0.049
Open in a new tab

pSCD1, porcine stearoyl-CoA desaturase-1.

a

Means within a column with common superscripts within a treatment and fatty acid are not different (p > 0.05).

The base-catalyzed fatty-acid methylation procedure used in this study methylates only esterified fatty acids (Smith et al., 1998), so any changes in the proportions of fatty acids with treatment reflected alterations in cellular neutral lipids and phospholipids. Proportions of palmitoleic acid and cis-vaccenic acid in cellular lipids were highest in SK6-I-pSCD1 cells (dox+), and incubated with supplemental palmitic acid (Fig. 6a). Transfection with PEG-pSCD1shRNA2 followed by treatment with SCD1 inhibitor strongly depressed the proportions of palmitoleic acid and cis-vaccenic acid (Fig. 6b). Palmitoleic acid is produced endogenously from the Δ9 desaturation of palmitic acid, which is subsequently elongated to cis-vaccenic acid. Therefore, depression in the proportion of these n-7 fatty acids under these conditions represents inhibition of pSCD1 gene expression plus a reduction in pSCD1 catalytic activity.

Fig. 6.

Fig. 6

Open in a new tab

Partial gas/liquid chromatograms showing FAME profiles of total cellular lipids of SK6-I-pSCD1 cells. FAME from transgenic SK6 cells for (a) SCD1 overexpression system and (b) SCD1 knockdown. The peaks in A and B reflect FAME detector signals (mEV). (c) Relationship between cellular palmitoleic acid and stearic acid. Data are proportions of palmitoleic acid (16:1n7) as a function proportion of stearic acid (18:0). (d) Fold change in palmitoleic acid. Data are expressed as means ± SEM from three independent experiments. abcMeans within with common superscripts are not different (p > 0.05). 16:0, palmitic acid; pSCD1, porcine stearoyl-CoA desaturase-1; I, inducible lentivirial vector

In the absence of dox, supplemental palmitic acid increased the proportion of cellular palmitic acid (p < 0.05) and induction with dox followed by treatment with the SCD1 inhibitor further increased palmitic acid (Table 2), indicating low pSCD1 activity under both conditions. The highest concentration of cellular palmitoleic acid was observed in SK6-I-pSCD1 cells (dox+) supplemented with palmitic acid.

The percentage of palmitoleic acid is inversely proportional to the percentage stearic acid (Fig. 6c), as the concentration of each is reciprocally established by SCD1 activity. Therefore, the palmitoleic:stearic acid ratio (an index of SCD1 activity) was the highest in SK6-I-pSCD1 cells (dox+), (overexpressing pSCD1) incubated with supplemental palmitic acid (Table 1). Similarly, the fold increase in palmitoleic acid was greatest in SK6-I-pSCD1 cells (dox+) incubated with supplemental palmitic acid (Fig. 6d). The fold increase in palmitoleic acid in SK6-I-pSCD1 cells was depressed by transfecting these cells with PEG-pSCD1shRNA2 followed by treatment with the SCD1 inhibitor.

Discussion

The conventional TET On/TET Off inducible lentiviral vector systems generally used to produce transgenic animals are based on two separate lentiviral vectors (Koponen et al., 2003; Park, 2007; Sheng et al., 2010). One vector encodes the inducible transcriptional activator (tetracycline responsive transactivator [rt-TA]) and the other vector encodes the GOI under the influence of a tetracycline-responsive promoter element (Tre3G). The expression of the transgene can thus be regulated in a quantitative and reversible manner by exposing the transgenic animal to varying amounts of tetracycline or its derivatives (dox) (Sheng et al., 2010). In the presence of dox, the rt-TA (Tet-On 3G) is expressed, which in turn will bind to Tre3G to drive the expression of transgene. However, the efficiency of the two-vector system is low as cotransduction of the target cells with both vectors is required. In that regard, our combination of the two vectors into one contributed to improved transduction efficiency and, in turn, increased porcine SCD1 expression in transduced SK6 cells (SK6-I-pSCD1 cells).

The SCD1 isoform is abundant in lipogenic tissues and is common to most species. The pSCD1 gene has been mapped to chromosome 14 (Uemoto et al., 2012), and has >80% homology with other mammalian SCD1 genes (Ren et al., 2004). SCD1 catalyzes the biosynthesis of MUFA from SFA derived from the diet or synthesized de novo (Paton and Ntambi, 2009). MUFA are major substrates for the synthesis of membrane phospholipids and triacylglycerols (Miyazaki et al., 2001; Tocher et al., 1998). We previously reported that SCD1 enzyme activity is 5- to 10-fold greater in porcine adipose tissue than in liver, muscle, and intestinal mucosal cells (Klingenberg et al., 1995). Similarly, Lengi and Corl (2008) reported that SCD1 mRNA levels were at least fivefold greater in porcine adipose tissue than in brain, liver, muscle, and heart. To our knowledge, no one has reported a comparison of SCD1 expression in porcine kidney to other tissues, nor are there any reports de novo fatty-acid biosynthesis in the porcine kidney. The kidney has the enzymatic capacity to convert glucose to fatty acids (Mehlman et al., 1967), which would have been essential in proliferating SK6 cells for the synthesis of membrane phospholipids.

The expression of SCD1 in the kidney is also important for ameliorating kidney dysfunction in disease. Wilson et al. (2003) demonstrated that kidney SCD1 gene expression was depressed in new-onset diabetic mice, and kidney SCD1 expression was further decreased in long-term diabetic mice. Wilson et al. (2003) concluded that the depression of SCD1 gene expression as the result and not the cause of the diabetic state. Palmitic acid-induced podocyte death was protected by pharmacologically stimulated SCD1 expression (Sieber et al., 2013; Sieber and Jehle, 2014); podocyte death in the kidney is critical in the pathogenesis of diabetic nephropathy. The very low level of SCD1 expression in the control SK6 suggests that this porcine kidney cell line does not reflect lipid metabolism in the kidney of whole animals. Nevertheless, the minimal SCD1 expression in control SK6 cells provided us with a low level of baseline SCD1 expression to more clearly demonstrate the effects of the pSCD1 transgene.

In the current study, transfection with the pSCD1 construct increased pSCD1 mRNA levels even in the absence of dox, but neither the control SK6 cells nor the pSCD1 dox(−) cells expressed detectable levels of pSCD1 protein. It is possible that SCD1 protein in the control and pSCD1 dox(−) SK6 cells was below our level of detection because these SK6 cell types apparently were capable of synthesizing MUFA. The mol% of oleic and palmitoleic acid in control, nontransduced SK6 cells were similar to the fatty-acid proportions observed in porcine tissues (Go et al., 2012; Klingenberg et al., 1995; St John et al., 1987b). The SCD1 inhibitor effectively decreased proportions of palmitoleic acid, but inexplicably also reduced pSCD1 protein. Uto et al. (2011) reported the synthesis of the SCD1 inhibitor and demonstrated that the inhibitor depressed SCD1 activity in human SCD1-transfected 293A cells. However, Uto et al. (2011) did not report SCD1 gene expression in the SCD1-transfected 293A cells in either the absence or the presence of the SCD1 inhibitor.

In previous research, we have used the palmitoleic:stearic acid ratio as an index of SCD1 enzyme activity (Smith et al., 2006). Only small amounts of palmitoleic and stearic acid naturally occur in diets of animals, and dietary factors that promote SCD1 activity increase tissue concentrations of palmitoleic acid and concomitantly decrease stearic acid. Similarly, in the current study, SK6 cells had the highest proportions of stearic acid and lowest proportions of palmitoleic acid; the converse was true for SK6-I-pSCD1 cells incubated with dox. Essentially identical results were obtained when data were expressed as fold increase in palmitoleic acid.

Previous researchers have transfected cells with SCD1 with varying results. Lu et al. (2014) demonstrated that transfection of bone marrow mesenchymal stem cells with enhanced SCD1 gene expression, but did not document changes in the fatty-acid composition. Nakaya et al. (2013) transfected 293A macrophages with mouse SCD1 and demonstrated small but significant increases in HDL-mediated cholesterol efflux. However, neither palmitoleic nor oleic acid proportions were increased in the SCD1 transgenic macrophages. Wu et al. (2010) demonstrated that SCD1 transfection of HEK 293 cells increased palmitoleic acid, cis-vaccenic acid, and 18:2 cis-9, trans-11 (all products of SCD1 activity) two- to threefold. Wang et al. (2014) reported that an SCD1 mammary-specific vector caused a 50% increase in palmitoleic acid and an 11% increase in oleic acid in goat ear skin-derived fibroblastic cells. We attribute the profound increases in palmitoleic acid (fourfold) in the current study to the stability of our SK6-I-pSCD1 cells.

Collectively, these data indicate that our lentiviral expression system was successfully established, and thereby stably and functionally expresses pSCD1 in SK6 cells. The lentiviral constructs utilized in this study can be further utilized to generate transgenic animals or other cell lines to enhance our understanding of the contribution of fatty-acid desaturation to the promotion of disease states such as obesity or steatosis.

Acknowledgements

This work was supported by the National Institute of Health (NIH-ORIP 8R24OD011188-02).

Abbreviations

CFU

colony forming units

CMV

cytomegalovirus promoter

CT

cycle threshold

CVD

cardiovascular disease

DMEM

Dulbelco's modified Eagle's medium

dox

doxycycline

EF1α

elongation factor-1α

FAME

fatty-acid methyl esters

FBS

fetal bovine serum

FID

flame-ionization detector

GAPDH

glyceraldehyde 3-phosphate dehydrogenase

GFP

green fluorescent protein

GOI

gene of interest

HEK

human embryonic kidney

IRES

internal ribosome entry site

LTR

long terminal repeat

miR

flanking and loop sequences from an endogenous miRNA

MOI

multiplicity of infection

MUFA

monounsaturated fatty acids

PES

polyethersulfone

PGK

phosphoglycerate kinase

RT-qPCR

real-time quantitative polymerase chain reaction

rtTA

reverse tetracycline-controlled transactivator

rt-TA

Tet responsive transactivator

SCD1

stearoyl-CoA desaturase-1

SFA

saturated fatty acids

shRNA

short hairpin RNA

SK6

swine kidney

Tre3G

tetracycline-responsive promoter element

UCOE

ubiquitous chromatin opening element

YWHAG

tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein gamma

YWHAZ

tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta

ZE

zeocin

Footnotes

Conflict of Interest The authors declare that they have no conflicts of interest.

References

  1. Adams TH, Walzem RL, Smith DR, Tseng S, & Smith SB (2010) Hamburger high in total, saturated and trans-fatty acids decreases HDL cholesterol and LDL particle diameter, and increases TAG, in mildly hypercholesterolaemic men. British Journal of Nutrition, 103:91–98. 10.1017/S0007114509991516 [DOI] [PubMed] [Google Scholar]
  2. Case SS, Price MA, Jordan CT, Yu XJ, Wang L, Bauer G, … Crooks GM (1999) Stable transduction of quiescent CD34(+)CD38(−) human hematopoietic cells by HIV-1-based lentiviral vectors. Proceedings of the National Academy of Sciences of the United States of America, 96:2988–2993. 10.1073/pnas.96.6.2988 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Chen J, He WR, Shen L, Dong H, Yu J, Wang X, … Qiu HJ (2015) The laminin receptor is a cellular attachment receptor for classical Swine Fever virus. Journal of Virology, 89:4894–4906. 10.1128/JVI.00019-15 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Choi SH, Park SK, Choi CW, Li XZ, Kim KH, Kim WY, … Smith SB (2016) The expression of adipogenic genes in adipose tissues of feedlot steers fed supplementary palm oil or soybean oil. Asian-Australasian Journal of Animal Sciences, 29:404–412. 10.5713/ajas.15.0011 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Chung KY, Lunt DK, Kawachi H, Yano H, & Smith SB (2007) Lipogenesis and stearoyl-CoA desaturase gene expression and enzyme activity in adipose tissue of short- and long-fed Angus and Wagyu steers fed corn- or hay-based diets. Journal of Animal Science, 85:380–387. 10.2527/jas.2006-087 [DOI] [PubMed] [Google Scholar]
  6. Demaree SR, Gilbert CD, Mersmann HJ, & Smith SB (2002) Conjugated linoleic acid differentially modifies fatty acid composition in subcellular fractions of muscle and adipose tissue but not adiposity of postweaning pigs. Journal of Nutrition, 132:3272–3279. 10.1093/jn/132.11.3272 [DOI] [PubMed] [Google Scholar]
  7. Enser M (1979) The role of insulin in the regulation of stearic acid desaturase activity in liver and adipose tissue from obese-hyperglycaemic (ob/ob) and lean mice. Biochemical Journal, 180:551–558. 10.1042/bj1800551 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Folch J, Lees M, & Sloane Stanley GH (1957) A simple method for the isolation and purification of total lipides from animal tissues. Journal of Biological Chemistry, 226:497–509. [PubMed] [Google Scholar]
  9. Gilmore LA, Crouse SF, Carbuhn A, Klooster J, Calles JA, Meade T, & Smith SB (2013) Exercise attenuates the increase in plasma monounsaturated fatty acids and high-density lipoprotein cholesterol but not high-density lipoprotein 2b cholesterol caused by high-oleic ground beef in women. Nutrition Research, 33:1003–1011. 10.1016/j.nutres.2013.09.003 [DOI] [PubMed] [Google Scholar]
  10. Gilmore LA, Walzem RL, Crouse SF, Smith DR, Adams TH, Vaidyanathan V, … Smith SB (2011) Consumption of high-oleic acid ground beef increases HDL-cholesterol concentration but both high- and low-oleic acid ground beef decrease HD Lparticle diameter in normocholesterolemic men. The Journal of Nutrition, 141:1188–1194. 10.3945/jn.110.136085 [DOI] [PubMed] [Google Scholar]
  11. Go G, Wu G, Silvey DT, Choi S, Li X, & Smith SB (2012) Lipid metabolism in pigs fed supplemental conjugated linoleic acid and/or dietary arginine. Amino Acids, 43:1713–1726. 10.1007/s00726-012-1255-5 [DOI] [PubMed] [Google Scholar]
  12. Golding MC, & Mann MR (2011) A bidirectional promoter architecture enhances lentiviral transgenesis in embryonic and extraembryonic stem cells. Gene Therapy, 18:817–826. 10.1038/gt.2011.26 [DOI] [PubMed] [Google Scholar]
  13. Horsch M, Beckers J, Fuchs H, Gailus-Durner V, Hrabě de Angelis M, Rathkolb B, … Kemter E (2014) Uromodulin retention in thick ascending limb of Henle’s loop affects SCD1 in neighboring proximal tubule: Renal transcriptome studies in mouse models of uromodulin-associated kidney disease. PLoS One, 9:e113125. 10.1371/journal.pone.0113125 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Hulver MW, Berggren JR, Carper MJ, Miyazaki M, Ntambi JM, Hoffman EP, … Muoio DM (2005) Elevated stearoyl-CoA desaturase-1 expression in skeletal muscle contributes to abnormal fatty acid partitioning in obese humans. Cell Metabolism, 2:251–261. 10.1016/j.cmet.2005.09.002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Kang K, Miyazaki M, Ntambi JM, & Pariza MW (2004) Evidence that the anti-obesity effect of conjugated linoleic acid is independent of effects on stearoyl-CoA desaturase1 expression and enzyme activity. Biochemical and Biophysical Research Communications, 315:532–537. 10.1016/j.bbrc.2004.01.087 [DOI] [PubMed] [Google Scholar]
  16. King DA, Behrends JM, Jenschke BE, Rhoades RD, & Smith SB (2004) Positional distribution of fatty acids in triacylglycerols from subcutaneous adipose tissue of pigs fed diets enriched with conjugated linoleic acid, corn oil, or beef tallow. Meat Science, 67:675–681. 10.1016/j.meatsci.2004.01.006 [DOI] [PubMed] [Google Scholar]
  17. Klingenberg IL, Knabe DA, & Smith SB (1995) Lipid metabolism in pigs fed beef tallow or high-oleic acid sunflower oil. Comparative Biochemistry and Physiology-Part B: Biochemistry & Molecular Biology, 110:183–192. [DOI] [PubMed] [Google Scholar]
  18. Koponen JK, Kankkonen H, Kannasto J, Wirth T, Hillen W, Bujard H, & Yla-Herttuala S (2003) Doxycycline-regulated lentiviral vector system with a novel reverse transactivator rtTA2S-M2 shows a tight control of gene expression in vitro and in vivo. Gene Therapy, 10:459–466. 10.1038/sj.gt.3301889 [DOI] [PubMed] [Google Scholar]
  19. Kris-Etherton PM, Pearson TA, Wan Y, Hargrove RL, Moriarty K, Fishell V, & Etherton TD (1999) High-monounsaturated fatty acid diets lower both plasma cholesterol and triacylglycerol concentrations. American Journal of Clinical Nutrition, 70:1009–1015. 10.1093/ajcn/70.6.1009 [DOI] [PubMed] [Google Scholar]
  20. Landau JM, Sekowski A, & Hamm MW (1997) Dietary cholesterol and the activity of stearoyl CoA desaturase in rats: Evidence for an indirect regulatory effect. Biochimica et Biophysica Acta, 1345:349–357. 10.1016/S0005-2760(97)00010-6 [DOI] [PubMed] [Google Scholar]
  21. Lengi AJ, & Corl BA (2008) Comparison of pig, sheep and chicken SCD5 homologs: Evidence for an early gene duplication event. Comparative Biochemistry and Physiology-Part B: Biochemistry and Molecular Biology, 150:440–446. 10.1016/j.cbpb.2008.05.001 [DOI] [PubMed] [Google Scholar]
  22. Livak KJ, & Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods, 25:402–408. 10.1006/meth.2001.1262 [DOI] [PubMed] [Google Scholar]
  23. Lu Y, Zhou Z, Tao J, Dou B, Gao M, & Liu Y (2014) Overexpression of stearoyl-CoA desaturase 1 in bone marrow mesenchymal stem cells enhance the expression of induced endothelial cells. Lipids in Health and Disease, 13:53. 10.1186/1476-511X-13-53 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Manjunath N, Wu H, Subramanya S, & Shankar P (2009) Lentiviral delivery of short hairpin RNAs. Advanced Drug Delivery Reviews, 61:732–745. 10.1016/j.addr.2009.03.004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Mehlman MA, Walter P, & Lardy HA (1967) Paths of carbon in gluconeogenesis and lipogenesis. VII. The synthesis of precursors for gluconeogenesis from pyruvate and bicarbonate by rat kidney mitochondria. The Journal of Biological Chemistry, 242:4594–4602. [PubMed] [Google Scholar]
  26. Miyazaki M, Kim YC, Gray-Keller MP, Attie AD, & Ntambi JM (2000) The biosynthesis of hepatic cholesterol esters and triglycerides is impaired in mice with a disruption of the gene for stearoyl-CoA desaturase 1. The Journal of Biological Chemistry, 275:30132–30138. 10.1074/jbc.M005488200 [DOI] [PubMed] [Google Scholar]
  27. Miyazaki M, Kim YC, & Ntambi JM (2001) A lipogenic diet in mice with a disruption of the stearoyl-CoA desaturase 1 gene reveals a stringent requirement of endogenous monounsaturated fatty acids for triglyceride synthesis. Journal of Lipid Research, 42:1018–1024. [PubMed] [Google Scholar]
  28. Miyoshi H, Smith KA, Mosier DE, Verma IM, & Torbett BE (1999) Transduction of human CD34+ cells that mediate long-term engraftment of NOD/SCID mice by HIV vectors. Science, 283:682–686. 10.1126/science.283.5402.682 [DOI] [PubMed] [Google Scholar]
  29. Nakaya K, Ayaori M, Uto-Kondo H, Sotherden GM, Nishida T, Katamoto H, … Ikewaki K (2013) Overexpression of stearoyl-coenzyme A desaturase 1 in macrophages promotes reverse cholesterol transport. Biochimica et Biophysica Acta, 1831:1402–1411. 10.1016/j.bbalip.2013.05.009 [DOI] [PubMed] [Google Scholar]
  30. Ntambi JM (1992) Dietary regulation of stearoyl-CoA desaturase 1 gene expression in mouse liver. The Journal of Biological Chemistry, 267:10925–10930. [PubMed] [Google Scholar]
  31. Ntambi JM, & Miyazaki M (2003) Recent insights into stearoyl-CoA desaturase-1. Current Opinion in Lipidology, 14:255–261. 10.1097/01.mol.0000073502.41685.c7 [DOI] [PubMed] [Google Scholar]
  32. Ntambi JM, & Miyazaki M (2004) Regulation of stearoyl-CoA desaturases and role in metabolism. Progress in Lipid Research, 43:91–104. 10.1016/S0163-7827(03)00039-0 [DOI] [PubMed] [Google Scholar]
  33. Park F (2007) Lentiviral vectors: Are they the future of animal transgenesis? Physiological Genomics, 31:159–173. 10.1152/physiolgenomics.00069.2007 [DOI] [PubMed] [Google Scholar]
  34. Paton CM, & Ntambi JM (2009) Biochemical and physiological function of stearoyl-CoA desaturase. American Journal of Physiology-Endocrinology and Metabolism, 297:E28–E37. 10.1152/ajpendo.90897.2008 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Posner BM, Cobb JL, Belanger AJ, Cupples LA, D’Agostino RB, & Stokes J 3rd (1991) Dietary lipid predictors of coronary heart disease in men. The Framingham study. Archives of Internal Medicine, 151:1181–1187. 10.1001/archinte.1991.00400060105018 [DOI] [PubMed] [Google Scholar]
  36. Ren J, Knorr C, Huang L, & Brenig B (2004) Isolation and molecular characterization of the porcine stearoyl-CoA desaturase gene. Gene, 340:19–30. 10.1016/j.gene.2004.06.017 [DOI] [PubMed] [Google Scholar]
  37. Sheng Y, Lin CC, Yue J, Sukhwani M, Shuttleworth JJ, Chu T, & Orwig KE (2010) Generation and characterization of a Tet-On (rtTA-M2) transgenic rat. BMC Developmental Biology, 10:17. 10.1186/1471-213X-10-17 [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Sieber J, & Jehle AW (2014) Free fatty acids and their metabolism affect function and survival of podocytes. Frontiers in Endocrinology, 5:186. 10.3389/fendo.2014.00186 [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Sieber J, Lindenmeyer MT, Kampe K, Campbell KN, Cohen CD, Hopfer H, … Jehle AW (2010) Regulation of podocyte survival and endoplasmic reticulum stress by fatty acids. American Journal of Physiology-Renal Physiology, 299:F821–F829. 10.1152/ajprenal.00196.2010 [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Sieber J, Weins A, Kampe K, Gruber S, Lindenmeyer MT, Cohen CD, … Jehle AW (2013) Susceptibility of podocytes to palmitic acid is regulated by stearoyl-CoA desaturases 1 and 2. The American Journal of Pathology, 183:735–744. 10.1016/j.ajpath.2013.05.023 [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Silva JM, Li MZ, Chang K, Ge W, Golding MC, Rickles RJ, … Hannon GJ (2005) Second-generation shRNA libraries covering the mouse and human genomes. Nature Genetics, 37:1281–1288. 10.1038/ng1650 [DOI] [PubMed] [Google Scholar]
  42. Smith DR, Knabe DA, Cross HR, & Smith SB (1996a) A diet containing myristoleic plus palmitoleic acids elevates plasma cholesterol in young growing swine. Lipids, 31:849–858. 10.1007/BF02522980 [DOI] [PubMed] [Google Scholar]
  43. Smith DR, Knabe DA, & Smith SB (1996b) Depression of lipogenesis in swine adipose tissue by specific dietary fatty acids. Journal of Animal Science, 74:975–983. 10.2527/1996.745975x [DOI] [PubMed] [Google Scholar]
  44. Smith SB, Hively TS, Cortese GM, Han JJ, Chung KY, Casteñada P, … Mersmann HJ (2002) Conjugated linoleic acid depresses the delta9 desaturase index and stearoyl coenzyme A desaturase enzyme activity in porcine subcutaneous adipose tissue. Journal of Animal Science, 80:2110–2115. 10.1093/ansci/80.8.2110 [DOI] [PubMed] [Google Scholar]
  45. Smith SB, Lunt DK, Chung KY, Choi CB, Tume RK, & Zembayashi M (2006) Adiposity, fatty acid composition, and delta-9 desaturase activity during growth in beef cattle. Animal Science Journal, 77:478–486. 10.1111/j.1740-0929.2006.00375.x [DOI] [Google Scholar]
  46. Smith SB, Mersmann HJ, Smith EO, & Britain KG (1999) Stearoyl-coenzyme A desaturase gene expression during growth in adipose tissue from obese and crossbred pigs. Journal of Animal Science, 77:1710–1716. 10.2527/1999.7771710x [DOI] [PubMed] [Google Scholar]
  47. Smith SB, Yang A, Larsen TW, & Tume RK (1998) Positional analysis of triacylglycerols from bovine adipose tissue lipids varying in degree of unsaturation. Lipids, 33:197–207. 10.1007/s11745-998-0196-8 [DOI] [PubMed] [Google Scholar]
  48. St John LC, Lunt DK, & Smith SB (1991) Fatty acid elongation and desaturation enzyme activities of bovine liver and subcutaneous adipose tissue microsomes. Journal of Animal Science, 69: 1064–1073. 10.2527/1991.6931064x [DOI] [PubMed] [Google Scholar]
  49. St John LC, Rule DC, Knabe DA, Mersmann HJ, & Smith SB (1987a) Fatty acid-binding protein activity in tissues from pigs fed diets containing 0 and 20% high oleate oil. Journal of Nutrition, 117:2021–2026. 10.1093/jn/117.12.2021 [DOI] [PubMed] [Google Scholar]
  50. St John LC, Young CR, Knabe DA, Thompson LD, Schelling GT, Grundy SM, & Smith SB (1987b) Fatty acid profiles and sensory and carcass traits of tissues from steers and swine fed an elevated monounsaturated fat diet. Journal of Animal Science, 64:1441–1447. 10.2527/jas1987.6451441x [DOI] [PubMed] [Google Scholar]
  51. Sweeten MK, Cross HR, Smith GC, Savell JW, & Smith SB (1990) Lean beef: Impetus for lipid modifications. Journal of the Academy of Nutrition and Dietetics, 90:87–92. [PubMed] [Google Scholar]
  52. Terpstra C, Woortmeyer R, & Barteling SJ (1990) Development and properties of a cell culture produced vaccine for hog cholera based on the Chinese strain. Deutsche Tierarztliche Wochenschrift, 97:77–79. [PubMed] [Google Scholar]
  53. Tocher DR, Leaver MJ, & Hodgson PA (1998) Recent advances in the biochemistry and molecular biology of fatty acyl desaturases. Progress in Lipid Research, 37:73–117. [DOI] [PubMed] [Google Scholar]
  54. Uemoto Y, Nakano H, Kikuchi T, Sato S, Ishida M, Shibata T, … Suzuki K (2012) Fine mapping of porcine SSC14 QTL and SCD gene effects on fatty acid composition and melting point of fat in a Duroc purebred population. Animal Genetics, 43:225–228. 10.1111/j.1365-2052.2011.02236.x [DOI] [PubMed] [Google Scholar]
  55. Uto Y, Ueno Y, Kiyotsuka Y, Miyazawa Y, Kurata H, Ogata T, … Ohsumi J (2011) Discovery of novel SCD1 inhibitors: 5-alkyl-4,5-dihydro-3H-spiro[1,5-benzoxazepine-2,4′-piperidine] analogs. European Journal Of Medicinal Chemistry, 45:4788–4796. 10.1016/j.ejmech.2011.02.002 [DOI] [PubMed] [Google Scholar]
  56. van Gennip HG, van Rijn PA, Widjojoatmodjo MN, & Moormann RJ (1999) Recovery of infectious classical swine fever virus (CSFV) from full-length genomic cDNA clones by a swine kidney cell line expressing bacteriophage T7 RNA polymerase. Journal of Virological Methods, 78:117–1128. 10.1016/S0166-0934(98)00171-2 [DOI] [PubMed] [Google Scholar]
  57. Wang L, You J, Zhong B, Ren C, Zhang Y, Li M, … Wang F (2014) Scd1 mammary-specific vector constructed and overexpressed in goat fibroblast cells resulting in an increase of palmitoleic acid and oleic acid. Biochemical and Biophysical Research Communications, 443:389–394. 10.1016/j.bbrc.2013.11.091 [DOI] [PubMed] [Google Scholar]
  58. Waters KM, & Ntambi JM (1994) Insulin and dietary fructose induce stearoyl-CoA desaturase 1 gene expression of diabetic mice. The Journal of Biological Chemistry, 269:27773–27777. [PubMed] [Google Scholar]
  59. Wilson KH, Eckenrode SE, Li QZ, Ruan QG, Yang P, Shi JD, … She JX (2003) Microarray analysis of gene expression in the kidneys of new- and post-onset diabetic NOD mice. Diabetes, 52:2151–2159. 10.2337/diabetes.52.8.2151 [DOI] [PubMed] [Google Scholar]
  60. Wu Z, Li D, & Gou K (2010) Overexpression of stearoyl-CoA desaturase-1 results in an increase of conjugated linoleic acid (CLA) and n-7 fatty acids in 293 cells. Biochemical and Biophysical Research Communications, 398:473–476. 10.1016/j.bbrc.2010.06.102 [DOI] [PubMed] [Google Scholar]
  61. Xu J, Eilat-Adar S, Loria C, Goldbourt U, Howard BV, Fabsitz RR, … Lee ET (2006) Dietary fat intake and risk of coronary heart disease: The strong heart study. The American Journal of Clinical Nutrition, 84:894–902. 10.1093/ajcn/84.4.894 [DOI] [PubMed] [Google Scholar]
  62. Yang A, Larsen TW, Smith SB, & Tume RK (1999) Delta9 desaturase activity in bovine subcutaneous adipose tissue of different fatty acid composition. Lipids, 34:971–978. 10.1007/s11745-999-0447-8 [DOI] [PubMed] [Google Scholar]
  63. Zhang F, Frost AR, Blundell MP, Bales O, Antoniou MN, & Thrasher AJ (2010) A ubiquitous chromatin opening element (UCOE) confers resistance to DNA methylation-mediated silencing of lentiviral vectors. Molecular Therapy, 18:1640–1649. 10.1038/mt.2010.132 [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES