Polycystin-2 Associates With Malignancy in Meningiomas

Abstract

The involvement of polycystin-2 (PC2) in cell survival pathways raises questions about its role in carcinogenesis. Aberrant expression of PC2 has been associated with malignancy in various tumors. No evidence exists referring to PC2 expression in meningiomas. The aim of this study was to investigate the expression levels of PC2 in meningiomas and compare them with normal brain samples including leptomeninges. PC2 immunohistochemical expression was quantitatively analyzed in archival tissue from 60 patients with benign (WHO grade 1) and 22 patients with high-grade (21: WHO grade 2 and 1: grade 3) meningiomas. Specifically, the labeling index [the percentage of positive (labeled) cells out of the total number of tumor cells counted] was determined. PC2 mRNA levels were evaluated by quantitative real-time polymerase chain reaction. PC2 immunostaining was not detected in the leptomeninges. Gene expression analysis revealed increased levels of PC2 in WHO grade 1 (P = 0.008) and WHO grade 2 (P = 0.0007) meningiomas compared with that of normal brains. PC2 expression was significantly associated with an ascending grade of malignancy by both immunohistochemistry and quantitative real-time polymerase chain reaction (P < 0.05). Recurrent meningiomas displayed higher levels of PC2 compared with primary meningiomas (P = 0.008). Although no significant association of PC2 with the overall survival of the patients was found (P > 0.05), it was noticed that the patients with WHO grade 2 meningiomas with low expression of PC2 survived longer compared with the patients with WHO grade 1 meningioma with high expression of PC2 (mean survival 49.5 and 28 months, respectively). The above results indicate a possible association of PC2 with malignancy in meningiomas. However, the mechanisms underlying PC2 implication in meningioma pathogenesis should be further elucidated.

Polycystin-2 (PC2) (PKD2) belongs to the transient receptor potential (TRP) polycystin cation channels, named by their causative role in polycystic kidney disease.1 PC2 is found in the primary cilia and endoplasmic reticulum membrane in a broad spectrum of cell types and affects cytoplasmic concentrations of calcium (Ca²⁺⁾, thus regulating cellular homeostasis and tissue morphology.2–4 Potential interactions of PC2 with auxiliary proteins such as PC1,5 fibrocystin,6 actin,7 or receptors, for example, inositol 1,4,5-trisphosphate receptor,8 ryanodine receptor,9 and epidermal growth factor receptor10 as well as other TRP channels, namely transient receptor potential vanilloid-4 (TRPV4)11 and transient receptor potential canonical 1,12 have been reported to regulate PC2 channel activity. In addition, PC2 is detected in other subcellular compartments including the Golgi apparatus and mitotic spindles, implying a role beyond calcium transmission, for example, cell division.13

PC2 localization in cell membranes has been associated with the modulation of signaling cascades related to cell survival, apoptosis, and autophagy.14,15 Specifically, PC2 channels located in primary cilia—either as homotetramers or as PC1/PC2, PC2/TRPV4, PC2/transient receptor potential canonical 1 complexes—have been shown to mediate a mechanically dependent Ca²⁺ influx and transduction of signals from extracellular stimuli to a cellular response including proliferation, differentiation, migration, and polarity.2,13,14

Recent findings have shown that up-regulation of PC2 protects cells against stress-induced cell death under pathologic conditions whereas loss of PC2 results in a Ca²⁺-mediated decrease in cell viability in response to stress and increased levels of stress-induced apoptosis.15 However, changes in Ca²⁺ concentrations may contribute to tumor growth and progression as deregulation of downstream effectors sensitive to changes in Ca²⁺ homeostasis may in turn, promote cancer hallmarks, for example, enhanced survival, proliferation, and invasion. The role of TRP channels in this process, as Ca²⁺-selective ion channels have been extensively studied in the last years.16

Regarding PC2, recent data show that augmentation of its expression has been correlated with the pathogenesis of certain types of solid tumors. Specifically, PC2 high expression has been associated with a higher grade of renal cell carcinoma.17 Furthermore, PC2 overexpression results in the up-regulation of the mTOR pathway in colorectal cancer (CRC) cells and associates with adverse pathologic parameters of CRC, including invasiveness and mucinous carcinomas.18 In vitro findings reveal a PC2-dependent mechanism underlying laryngocarcinoma cell invasion and metastasis19 and a PC2-activated proliferation of nasopharyngeal carcinoma (NPC) cells by upregulating expression of Skp2/c-Myc, thus deteriorating the development of NPC.20 Moreover, accumulating evidence introduce PC2 as a novel prognostic and diagnostic tool in cancer detection17–20 Interestingly, the implication of primary cilia signaling in some tumor pathogenesis has also been reported.21

Meningiomas are the common slow-growing type of primary central nervous system tumor, which originates from arachnoid cap cells. The grading of meningiomas includes benign meningiomas (WHO grade 1), atypical meningiomas (WHO grade 2), and anaplastic (malignant) meningiomas (WHO grade 3).22 Meningiomas grade 1 do not display brain invasion and do not otherwise fulfill criteria for either atypical or anaplastic grades. Meningothelial, fibrous, and transitional meningiomas are the most common grade 1 meningioma. Atypical meningiomas (WHO grade 2) are tumors with increased mitotic activity (4 mitoses/10 high-powered fields). This type of meningioma can also be diagnosed based on the additive criteria of 3 of the other 5 histologic features: spontaneous necrosis, sheeting (loss of whorling or fascicular architecture), prominent nucleoli, high cellularity, and small cells (tumor clusters with high nuclear: cytoplasmic ratio). In addition, brain invasion is a criterion for the diagnosis of atypical meningioma. Anaplastic (malignant) meningiomas (WHO grade 3) show distinct features of malignancy that include either the presence of 20 or more mitoses/10 high-power fields or the presence of frank anaplasia, defined as carcinoma, melanoma, or sarcoma-like histology. Because of these features, a firm diagnosis for anaplastic meningiomas requires the presence of either classic meningothelial histology in portions of the tumor, a clinical history of lower-grade meningioma in the same location previously, and/or supportive immunohistochemical, ultrastructural, or genetic data.22

Recent evidence reveals that meningiomas can express primary cilia, but they do not transduce ciliary Hedgehog signals.23 In the present study, we investigated PC2 expression in patients with meningiomas of different histopathological subtypes and malignancy grades and compared them with normal brain tissues including leptomeninges. The results were associated with the patient’s clinicopathological characteristics and survival.

PATIENTS AND METHODS

Demographic Data and Neuropathology

A total of 82 Greek patients with meningiomas (61 females, 21 males; age range, 21 to 84 y; mean age, 60.06 ± 14.13 y) who underwent surgery at Neurosurgery Department, School of Medicine, University of Patras during a 10-year period, were included in this study. The formalin-fixed, paraffin-embedded tissue blocks were retrieved from the archives of the Department of Pathology, School of Medicine, University of Patras. The tissue material was evaluated by routine methods for histopathology, including the Ki67 index as a proliferation marker, and graded according to the diagnostic criteria of the WHO classification system. Histologic types included meningothelial (n = 40), fibrous (n = 7), psammomatous (n = 5), transitional (n = 5), microcystic (n = 1), secretory (n = 1), angiomatous (n = 1), atypical (n = 20), clear cell (n = 1), and anaplastic meningioma (n = 1). Follow-up was evaluated as the number of months from the date of the diagnostic surgical procedure to that of death or the date of the last follow-up (December 2020). The median follow-up period was 42 months (range, 18 to 124 mo). Normal human brain tissue was obtained postmortem (2 males, 56 and 28 y). All ethical guidelines and rules were followed to protect patient privacy. This study has been approved by the Ethics Committee, University of Patras and all process was in accordance with the Helsinki declaration (as revised in Edinburgh 2000).

Immunohistochemistry

All tissues for immunohistochemistry were fixed in formalin and embedded in paraffin. Consecutive (semiserial) 4 μm sections of tissue samples were collected on poly-L-lysine coated slides. One section for each sample was stained with H and E. For immunohistochemical studies, the histologic sections were deparaffinized in xylene and rehydrated in graded alcohols up to water. Antigen retrieval was performed by microwaving the slides in 0.01 M citrate buffer (pH, 6). Endogenous peroxidase activity was quenched by treatment with 1% hydrogen peroxide for 20 minutes. Incubation with an appropriate protein-blocking solution was performed. Sections were subsequently incubated with primary antibodies: monoclonal mouse anti-PC2 (clone D-3) antibody (cat. no. sc-28331; dilution 1:100) (Santa Cruz Biotechnology) and Ki67 (MIB-1) (Dako). Detection was carried out using the Envision Plus Detection System kit, according to the manufacturer’s instructions (DakoCytomation), with 3,3΄-diaminobenzidine as a chromogen (which yielded brown reaction products). Sections were counterstained with Mayer hematoxylin solution, dehydrated, and mounted. To ensure antibody specificity, negative controls included the omission of primary antibodies and substitution with nonimmune serum. Positive human kidney tissue for PC2 was used as a positive control.

Scoring of Immunohistochemical Staining

To assess the fraction of immunolabeled cells with cytoplasmic and/or nuclear staining for PC2 in specimens from each patient case, the labeling index (LI) was determined by 2 observers (M.A. and V.K.), independently and blinded to sample type. This index was defined as the percentage of PC2-immunopositive (labeled) cells out of 100 tumor cells manually counted in 10 nonoverlapping, random fields (×400 total magnification) with the aid of an ocular grid. Interobserver agreement for evaluation of immunostaining was within 15% (Cohen kappa = 0.82).24 Immunopositive endothelial cells were excluded from the cell counts. Microphotographs were obtained using a Nikon DXM 1200C digital camera mounted on a Nikon Eclipse 80i microscope and ACT-1C software (Nikon Instruments Inc.).

Gene Expression Analysis of Polycystin-2 by Quantitative Real-time Polymerase Chain Reaction

Total messenger RNA (mRNA) from normal brain and meningioma tissues was extracted using the commercially available kit, NucleoSpin total RNA FFPE Kit (MACHEREY-NAGEL, GmbH & Co.), according to the manufacturer’s instructions. A moderate amount of contaminating DNA from RNA preparations was removed by a DNA-free kit (Invitrogen). Purified RNA was treated with rDNase I (2 Units/μL) and 0.1 volume 10x DNase I Buffer. After the inactivation of the DNase enzyme with the DNase inactivation reagent, the RNA was centrifuged at 10,000 rpm for 1.5 minutes and transferred to a fresh tube. A total of 1 μg of RNA was reverse transcribed at 42°C for 15 minutes and 85°C for 5 seconds, according to PrimeScript RT Reagent kit (Perfect Real Time) (TAKARA) and followed by quantitative real-time polymerase chain reaction (qRT-PCR) amplification using the KAPA SYBR FAST qPCR Master Mix (2x) kit (KAPA BIOSYSTEMS), according to the manufacturer’s instructions. For standardization of the amount of RNA, the expression of glyceraldehyde-3-phosphate dehydrogenase in each sample was quantified. The sequence of each primer was obtained either from the National Centre for Biotechnology Information (NCBI:http://www.ncbi.nlm.nih.gov/) or from published reports and was synthesized by Eurofins. Sequences of primers are presented in Table 1. Cycling conditions were 95°C for 3 minutes, followed by 40 cycles of 95°C for 3 seconds and 57°C for 30 seconds. The relative changes in gene expression were analyzed by the 2^-ΔΔCT method and visualized by electrophoresis on 2% agarose gels incorporating 0.01% GreenSafe DNA Gel Stain (Canvax Biotech). The PCRs were performed in triplicate on an MX3000p (Stratagene) cycler. LinRegPCR software was used to quantify detected signals.

TABLE 1.

Sequences of Primers

Gene	Reference	Primer	Sequence 5΄-3΄
PKD2	Gargalionis et al17	Forward Reverse	GCGAGGTCTCTGGGGAAC TACACATGGAGCTCATCATGC
GAPDH	NM- 002046.7	Forward Reverse	CCCATGTTCGTCATGGGTGT TGGTCATGAGTCCTTCCACGATA

Statistical Analysis

The statistical significance of differences in LIs between groups (where N ≥10) was examined with nonparametric statistical techniques using Kruskal-Wallis analysis of variance tests and the Wilcoxon rank-sum post hoc tests. The median LI (MLI) and interquartile range of LIs were determined for the set of cases comprising each group of patients. The interquartile range was delimited by the 25th and 75th population percentiles. Correlation analysis was performed by utilizing Kendall τ (or Spearman ρ) rank correlation to assess the significance of associations between LIs. The MLI was used as a cut-off point to classify tumors as exhibiting low or high PC2 expression. Overall survival was analyzed using the Kaplan-Meier method and differences between subgroups (LI low versus LI high expression) were compared with the log-rank test. The 2 sample’s student t test was used to compare the levels of PC2 expression found by quantitative real-time polymerase chain reaction (qRT-PCR) in different grades of tumors. P values <0.05 were considered significant. Data analysis and graphs were prepared using scientific data analysis and graphing platform (Prism; GraphPad Software).

RESULTS

Polycystin-2-immunoexpression in Meningiomas and Leptomeninges

Meningothelial cells of meninges found in normal brain specimens and in some tumors were PC2-immunonegative. In contrast, PC2 immunoreactivity was detected in tumor cells of most of the meningiomas included in this study (95.4%). The immunolocalization was cytoplasmic and/or nuclear (Figs. 1C–E) implying a role of PC2 beyond the cytoplasm and into the nucleus. Furthermore, endothelial cells of some vessels were PC2-immunopositive. Different immunostaining profiles between different grades of malignancy were found. Specifically, WHO grade 1 meningioma displayed low to moderate immunoreactivity whereas high-grade meningiomas (WHO grade 2, grade 3) demonstrated moderate to strong immunoreactivity. However, intratumoral staining heterogeneity was also observed (Fig. 1F). Immunohistochemistry performed in normal brain tissue, which included the floor of the third ventricle showed PC2 immunoreactivity in α-tanycytes (Fig. 1G). Immunostaining was absent in negative control sections (Fig. 1H) whereas strong PC2 immunostaining was detected in the positive control of human kidney tissue (Fig. 1I).

FIGURE 1.

qRT-PCR analysis of PC2 expression using total RNA from normal brain and meningioma tissues. A, The product for PC2 (149 bp) and GAPDH (145 bp) are indicated in agarose gel. B, The values depict the mean +/− SD of representative meningiomas WHO grade 1 and WHO grade 2 from different patients. Statistical significance was calculated by student t test; Statistical differences (*P<0.05, **P<0.01, and ***P<0.001) between different grade and normal tissues, and between different grades are indicated with asterisks, respectively. C, Mainly nuclear immunolocalization for PC2 is detected in tumor cells in this benign (WHO grade 1) meningioma. D, Abundant cytoplasmic PC2 immunoreactivity (LI = 80) in an anaplastic meningioma (WHO grade 3). E, Tumor cells nearby the dura meninge are strongly PC2-immunopositive in a high-grade meningioma (WHO grade 2). Note that PC2-immunolocalization is cytoplasmic and/or nuclear in some cells (asterisks). F, Intratumoral heterogeneity for PC2-immunoexpression in a meningioma WHO grade 1; the most of tumor cells display PC2 immunostaining whereas a cluster of cells is PC2-immunonegative (arrows). G, Expression of PC2 in α-tanycytes (arrows) located in the floor of the third ventricle. H, Immunostaining is absent in negative control sections. I, Human kidney tissue was used as a positive control for PC2. Counterstain, hematoxylin; original magnification ×400; scale bar 50 μm. GAPDH indicates glyceraldehyde-3-phosphate dehydrogenase; L, DNA ladder; LI, labeling index; N; normal brain tissue; NTC; negative template control; PC2, polycystin-2; rRT-PCR, quantitative real-time polymerase chain reaction.

Analyses of the Immunohistochemical and Gene Expression Findings

The PC2 immunoreactivity was significantly greater in high-grade (WHO grade 2) meningiomas as compared with WHO grade 1 meningiomas (P = 0.002). Furthermore, recurrent meningiomas displayed significantly increased immunoexpression levels for PC2 compared with primary meningiomas (P = 0.008). However, no data about the association of PC2 expression with tumor recurrence was available. A comparison of MLIs for PC2 between different groups of patients is presented in Table 2. Quantitative analysis of PC2-immunoexpression between histologic subtypes showed that meningothelial meningiomas (WHO grade 1) demonstrated lower expression for PC2 compared with atypical (WHO grade 2) meningiomas (P = 0.01) (Fig. 2).

TABLE 2.

Quantitative Analysis of Immunohistochemical Expression for PC2 Using the LI in Meningiomas^*

Tumor group	No.	MLI, %	IQR, %	Minimum LI, %	Maximum LI, %
Grade
Benign (WHO grade 1)	60	40.00‡	20.00-60.00	0	80.00
High grade (WHO grade 2)	21	70.00	45.00-80.00	5.00	90.00
High grade (WHO grade 3)	1	—	—	80.00†	—
Primary meningiomas	70	40.00§	20.00-70.00	0	90.00
Recurrent meningiomas	12 (2, grade 1, 10, grade 2)	75.00	60.00-80.00	40.00	90.00

IQR is delimited by the 25th and 75th population percentiles.

^*The number of tumor specimens, each corresponding to a tumor case.

^†One single case of anaplastic meningioma (WHO grade 3) was included in this cohort of tumors.

^‡PC2 expression in benign (WHO grade 1) versus high-grade (WHO grade 2) meningiomas, P = 0.002

^§PC2 expression in primary versus recurrent meningiomas, P = 0.008.

IQR indicates interquartile range; LI, labeling index; MLI, median labeling index; PC2, polycystin-2; WHO, World Health Organization.

FIGURE 2.

Comparison of PC2-immunoexpression between histologic subtypes of meningiomas. The (nonparametric) Wilcoxon rank-sum test was used in groups of histologic subtypes where N ≥10. The level of significance was defined as P <0.05. Other grades 1: 1 microcystic meningioma (WHO grade 1), 1 angiomatous meningioma (WHO grade 1), 1 secretory meningioma (WHO grade 1); other high-grade: 1 clear cell meningioma (WHO grade 2) and 1 anaplastic (WHO grade 3) meningioma were included in these cohorts of tumors. PC2 indicates polycystin-2.

Gene expression analysis by qRT-PCR revealed significantly increased levels of PC2 in WHO grade 1 (P = 0.008) and WHO grade 2 (P = 0.0007) meningiomas compared with normal brain tissues. In addition, PC2 expression was significantly higher in WHO grade 2 meningiomas as compared with WHO grade 1 meningiomas (P = 0.01). Gene expression findings are presented in Figures 1A and B.

Polycystin-2-immunoexpression in Association With Clinicopathological Characteristics and Prognosis of the Patients

Survival curves according to the Kaplan-Meier method showed that PC2 levels (low vs high protein expression) were not associated with patient survival (log-rank P >0.05). However, it was noticed that the patients with WHO grade 2 meningiomas with low expression of PC2 survived longer compared with the patients with WHO grade 1 meningioma with high expression of PC2 (mean survival 49.5 and 28 months, respectively) but this observation was not confirmed statistically due to the small sample (N < 10) for each group of patients.

No association emerged between PC2 channel expression and Ki67 expression (P > 0.05). No significant correlations between PC2 LIs and the age of the patients (P > 0.05) were found. Comparison of MLIs for PC2 between males and females demonstrated no significant difference between the groups of patients (P > 0.05).

DISCUSSION

In this study, we demonstrate the cellular distribution of PC2 in meningiomas and provide evidence that abundant expression of PC2 is a molecular marker of malignancy in these tumors. Particularly, PC2 was expressed in the cytoplasm and/or nucleus of tumoral cells in the majority of meningiomas as opposed to meningothelial cells of the leptomeninges, which were PC2-immunonegative. Nevertheless, immunohistochemical staining in brain tissue on the floor of the third ventricle showed PC2 immunoreactivity in α-tanycytes, which are ciliated cells and are abundantly found in the floor of the third ventricle and extend also into the aqueduct and fourth ventricle25 confirming the presence of PC2 in cilia in the brain.

Gene expression analysis by qRT-PCR revealed significantly increased levels of PC2 in meningiomas compared with normal brain tissues. According to previous data, cells overexpressing PC2 accumulate the protein in intracellular compartments providing protection from apoptosis by lowering Ca²⁺ release from the endoplasmic reticulum.26 Indeed, recent knowledge shows that up-regulation of PC2 expression in response to cell stress protects against cell death in multiple tissue types.15 Thus, the cytoplasmic immunolocalization of PC2 in meningioma cells may indicate the activation of a mechanism, which promotes cell survival. Interestingly, nuclear localization of PC2 has been found in meningioma cells confirming previous data reporting the implication of PC2 in mitosis.13

Moreover, a statistically increased expression of PC2 in high-grade meningiomas (WHO grade 2) compared with benign (WHO grade 1) meningiomas was detected. Previous evidence has shown that increased PC2 levels have been correlated with enhanced cell viability and proliferation in tumors. Specifically, PC2 overexpression has been involved in the acquisition of aggressive phenotypes in renal cell carcinoma,17 CRC,18 laryngocarcinoma,19 and NPC20 and was associated with worse survival of the patients and advanced clinical stage.17–20

Recently, Findakly et al23 (2020) have shown that meningiomas of all grades can express the structure necessary for ciliary Hedgehog signal transduction—even though they do not transduce Hedgehog signals—but are less likely to do so when high-grade. Notably, Saigusa et al27 (2019) found that the loss of primary cilia in the mouse cortical collecting duct results in increased mRNA levels of PC2 and TRPV4 channel, which suggests an enhanced and unregulated Ca^2_ entry pathway with the loss of cilia. Considering the data and the results of our previous study, which present a TRPV4 significantly greater expression in high-grade (WHO grade 2 and 3) as compared with low-grade (WHO grade 1) meningiomas28 it is tempting to speculate that the loss of cilia in tumor cells of high-grade meningiomas may activate the greater expression of PC2 and TRPV4.

Further evidence demonstrates PC2-mediated invasion and metastasis of tumors by regulating epithelial-mesenchymal transition in laryngeal squamous cell carcinoma.19 We investigated this hypothesis in meningiomas by comparing the expression levels of PC2 in primary and recurrent meningiomas. Significantly increased expression of PC2 was detected in recurrent meningiomas. The above results underlie the association of PC2 with the invading cancer cells that feature aggressive phenotypes and should be taken into consideration during histopathological validation of these tumors.

Although PC2 expression was not associated with the patient’s survival, a comparison of the mean survival of patients with WHO grade 1 meningioma with high expression of PC2 (group A) to the mean survival of patients with WHO grade 2 meningiomas with low expression of PC2 (group B) revealed that the patients of the group A survived less than the patients of the group B indicating a prognostic value over histologic grade for PC2 in meningiomas. However, this finding requires confirmation with further research on a larger number of patients as there was a lack of ability to find significant results in this study. In addition, PC2 expression was found in the endothelium of tumor vessels, implying a role for PC2 in the angiogenesis of meningiomas.

CONCLUSION

Even though most meningiomas correspond to histologically benign (WHO grade 1) tumors, there is a small percentage that displays malignant features and invasion in normal brains.22 Therefore, any additional data with prognostic and/or predictive value contributes to the effective personalized treatment of these patients.