Skip to main content
NCBI home page
Physiology and Molecular Biology of Plants logoLink to Physiology and Molecular Biology of Plants
. 2023 Mar 25;29(3):361–376. doi: 10.1007/s12298-023-01299-4

Identification of HQT gene family and their potential function in CGA synthesis and abiotic stresses tolerance in vegetable sweet potato

Milca Banda Medison 1, Rui Pan 1, Ying Peng 1, Rudoviko Galileya Medison 1, Abdullah Shalmani 2, XinSun Yang 3, Wenying Zhang 1,✉
PMCID: PMC10073390  PMID: 37033766

Abstract

Hydroxycinnamate-CoA quinate hydroxycinnamoyl transferase (HQT) enzyme affect plant secondary metabolism and are crucial for growth and development. To date, limited research on the genome-wide analysis of HQT family genes and their regulatory roles in chlorogenic acid (CGA) accumulation in leafy vegetable sweet potato is available. Here, a total of 58 HQT family genes in the sweet potato genome (named IbHQT) were identified and analyzed. We studied the chromosomal distribution, phylogenetic relationship, motifs distribution, collinearity, and cis-acting element analysis of HQT family genes. This study used two sweet potato varieties, high CGA content Fushu 7-6-14-7 (HC), and low CGA content Fushu 7-6 (LC). Based on the phylogenetic analysis, clade A was unique among the identified four clades as it contained HQT genes from various species. The chromosomal location and collinearity analysis revealed that tandem gene duplication may promote the IbHQT gene expansion and expression. The expression patterns and profile analysis showed changes in gene expression levels at different developmental stages and under cold, drought, and salt stress conditions. The expression analysis verified by qRT-PCR revealed that IbHQT genes were highly expressed in the HC variety leaves than in the LC variety. Furthermore, cloning and gene function analysis unveiled that IbHQT family genes are involved in the biosynthesis and accumulation of CGA in sweet-potato. This study expands our understanding of the regulatory role of HQT genes in sweet-potato and lays a foundation for further functional characterization and genetic breeding by engineering targeted HQT candidate genes in various sweet-potato varieties and other species.

Supplementary Information

The online version contains supplementary material available at 10.1007/s12298-023-01299-4.

Keywords: Ipomoea batatas, Abiotic stress, Chlorogenic acid, Hydroxycinnamate-CoA quinate hydroxycinnamoyl transferase

Introduction

The HQT genes belong to the plant acyl-CoA-dependent BAHD superfamily (D’Auria 2006; Lallemand et al. 2012) and play a significant role in the phenylpropanoid pathways. The HQT genes play a substantial role in the accumulation of phenolic compounds such as Chlorogenic acid (CGA) (Arnold et al. 2019; Cardenas et al. 2021; Claude et al. 2021) which is one of the most important groups of dietary antioxidants. The presence of Hydroxycinnamate-CoA shikimate/quinate transferase (HQT) genes is vital in plant metabolism (Sonnante et al. 2010) hence influencing the health-promoting properties of edible plants. In addition, HQT is a major phenolic sink that contributes over 90% to the accumulation of CGA (Payyavula et al. 2015; Mudau et al. 2018).

Several studies have shown that the accumulation of CGA in plants is affected by the expression levels of HQT genes. For example, overexpression of the HQT gene increase the content of CGA by 85%, while silencing of this gene resulted in a 98% reduction of CGA content in tomato (Niggeweg et al. 2004). Similarly, RNAi suppression of the HQT gene in tobacco and tomato results in 98% reduction in CGA levels (Comino et al. 2009). The synthesis of CGA in Robusta coffee was closely correlated with the expression levels of HQT (Lepelley et al. 2007). In addition, high HQT expression was also detected in artichoke tissues and it was positively correlated with the CGA content while the reduction of CGA content (82%) in artichoke was caused by the HQT gene silencing (Sonnante et al. 2010; Moglia et al. 2016). These studies revealed that overexpression of HQT genes in different species increases the content of phenolic compounds, particularly CGA.

Previous studies have demonstrated the role of HQT genes in plants’ adaptive responses to environmental stress conditions. For instance, overexpression of HQT genes in transgenic tomato resulted in increased CGA content, tolerance for oxidative stress, and resistance to a bacterial pathogen (Niggeweg et al. 2004). On the other hand, HQT genes improved the resistance of Chilli peppers to pectobacterium carotovorum.subsp. carotovorum (Pcc) infection (Tchatchou et al. 2019). The abiotic stress conditions such as UV radiation induces the biosynthesis of CGA (Clé et al. 2008) as a mechanism of plant defense against abiotic stress conditions. The transcription level of HQT and HCT genes was higher under UV light radiation (Comino et al. 2009), suggesting a significant role of HQT and HCT genes under light stress condition. These results show that the expression of genes encoding HQT is activated during abiotic stress conditions, hence they are significant in protecting plants against abiotic stress conditions. Despite their importance to plant and human health, the HQT gene family members have not yet been identified in the leafy vegetable sweet potato.

Sweet-potato (Convolvulaceae family) is widely cultivated because of its excellent source of nutrients and high content of phenolic acids and flavonoids in their leaves (Jo et al. 2020; Luo et al. 2021). Sweet-potato is a rich source of the phenolic compound with CGA being the major component of these phenolics (Jung et al. 2011; Luo et al. 2021). It has been shown that the HQT gene has a key role in the biosynthesis of CGA in Lonicera Japonica (Zhang et al. 2017). However, only a few HQT family genes have been characterized (Moglia et al. 2016) and there is scanty genomic data on HQT family genes in leafy vegetable sweet potato. Sweet potato is sensitive to environmental stress conditions that affect their growth and development (Atayee and Noori 2020; Laurie and Bairu 2022; Pan et al. 2022b). Moreover, there is a lack of clear information regarding the role of HQT family genes in abiotic stress tolerance in the leafy vegetable sweet potato.

In this study, we performed genome-wide identification and characterization of HQT family genes in sweet potato. We identified a total of 58 HQT genes and investigated their chromosomal distribution, phylogenetic analysis, MEME motifs, collinearity analysis, and cis-acting element analysis. In addition, expression profile analysis under different developmental stages and stress conditions was performed and the gene expression levels were verified by qRT-PCR. Furthermore, one highly expressed gene, IbHQT-g47130 was selected for cloning and gene function verification. This study provides details of IbHQT family genes (Table S1) and their regulatory role in leafy vegetable sweet-potato. This information can be used to further investigate the physical and molecular functions of HQT family genes in various species and could be incorporated into various breeding programs.

Materials and methods

Plant materials

Two leafy vegetable sweet potato varieties, HC and LC with significant genotype differences were selected and collected from the Hubei Academy of Agricultural Sciences (Wuhan, China) fields for our study. The plants were transplanted into pots filled with soil in the growth chamber at the School of Agriculture of Yangtze University, Jingzhou city, Hubei province, China. The temperature was maintained at 28 ± 2 °C under a photoperiod of 16-h light and 8-h dark conditions. The plants were watered every 2–3 d and were later used for HQT gene expression analysis and sweet potato callus transformation experiments.

Acquisition and identification of HQT gene family members in sweet potato

The sweet potato genomic sequences were obtained from the sweet potato genomic resource (http://sweetpotato.plantbiology.msu.edu/). HQT proteins of Arabidopsis thaliana were retrieved from the website (http://www.arabidopsis.org) and used as a query to perform a BLAST search against the sweet-potato genomic database with the cut-off value (≤ e−20). Then the candidate HQT proteins were correctly identified using the Pfam database (http://pfam.xfam.org) and HMMER software. To further confirm that the identified candidate sweet potato HQT gene family members contained the HQT domains, NCBI-Conserved Domain Database (CDD) (https://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi) was used. Based on the transcriptome database, sequences with full-length HQT genes containing the HQT domain were finally chosen as members of the IbHQT gene family. To determine the molecular weight (MW), isoelectric points (pI), and polypeptide length of the selected members, the ExPASy Prot-Param tool (https://web.expasy.org/proparam/) was employed. Furthermore, the average relative expression levels were determined through the use of FPKM values of the genes to generate a Heatmap using R-packages.

Phylogenetic tree, gene structure, and conserved motifs of the sweet potato HQT

The ClustalX2 program of MEGA7 software was used to perform multiple protein sequence alignments of IbHQT genes which were classified into different groups according to already known Arabidopsis HQT proteins. The protein sequences were then used to construct a Phylogenetic tree by Neighbor-Joining (NJ) model (Yang et al. 2019). The reliability of the obtained tree was tested using bootstrapping with replication values set to 1500. The phylogenetic tree was then edited using Figtree v1.4.4 software. MEME online program (http://meme-suite.org/meme/tools/meme) was used to carry out conserved motif analysis of HQT gene sequences for motif identification (Li et al. 2021). The maximum number of parameters was 5 and the amino acid length was between 6 and 50.

Chromosomal distribution and collinearity analysis of HQT gene family members

The HQT genes were mapped on various chromosomes based on the chromosomal location obtained from the GFF file of the sweet-potato genome (http://www.ipomoea-genome.org/). Then Tbtools@v1.082 software was used to visualize the results. Using the default parameters of the Multiple Collinearity Scan toolkit (MCScanX) (Liu et al. 2020), the potential tandem and segmental duplication events were identified. Based on the whole genome protein sequences and the phenylpropanoid pathway of sweet potato and the annotation information, MCScanX (Li et al. 2020) was used to analyze the IbHQT gene members, then Circos software was used for visualization.

Analysis of cis-acting elements and transcription factor binding sites in the promotor regions of HQT gene family members

Following the sweet-potato genome and sweet-potato genomic sequence annotations information, the 2000 bp upstream of the start codon of each sequence of IbHQT family genes were extracted and submitted to the PlantCare database (http://bioinformatics.psb.ugent.be/webtools/plantcare/html) (Qin et al. 2021) for cis-element prediction analysis. The results from the PlantCare analysis were then clarified and visualization was carried out using TBtools.

Transcriptome analysis

The raw data was filtered using fastp software (https://github.com/OpenGene/fastp) to ensure quality by removing the adapter sequence and trimming the low-quality bases in 3’-ends of reads (Q˂20 and length 50 bp) (Wei et al. 2022). To yield clean data, quality checking was performed with fastQC. Then sweet potato genome (http://sweetpotato.plantbiology.msu.edu/) was employed to clean read mapping by HISAT2. Obtained clean mapping files were compressed and sorted by Samtools, then StringTie was employed for reads assembly and abundance estimation. The false discovery rate (FDR) and fragments per kilobase of exon per million fragments mapped reads (FPKM) were used to identify differentially expressed genes (DEGs) using DESeq2 software (Love et al. 2014) with DESeq2 (fold change ≥ 2 and FDR ≤ 0.05). Furthermore, clusterProfiler with FDR ≤ 0.05 was used to perform the Kyoto Encyclopedia of Genes and Genomes (KEGG) and Gene Ontology (GO) (Klopfenstein et al. 2018).

RNA extraction, expression profiling, and qRT-PCR assays

Tender leaves of both HC and LC plants were collected and used for total RNA extraction using steadyPure Universal RNA Extraction Kit (Accurate Biology (Hunan) Co.Ltd China). First-strand cDNA synthesis was performed using Goldenstar TMRT6 cDNA Synthesis kit ver.2 (TSINGKE Biotech, China).

The SRA database of NCBI was used to obtain the raw sequence reads, after adapter removal and quality checking. The raw sequence reads in individual libraries were then aligned into a reference genome resulting in the Sequence Alignment Map (SAM) files. Using SAM tools (Jo et al. 2020) the SAM files were converted to Binary Call Format (BAM) files, which were classified and used for reads count and Transcripts per Million (TPM) calculated by edgeR package and DESeq2 in R software. The IbHQT gene expression analysis was done in both HC and LC varieties at two-time intervals in three replicates.

To confirm the HQT gene expression patterns, 10 genes were selected randomly and 10 pairs of primers were designed using Primer-BLAST software (http://www.ncbi.nlm.nih.gov/tools/primer-blast/) and the sequences were sent to Qingke sequencing company (Wuhan, China) for synthesis (Table S2). Using the RNA extracted from both sweet-potato varieties, qRT-PCR was then performed using 2* ® Master qPCR Mix (SYBR Green, TSINGKE Biotech, China) following the manufacturer’s instructions. The internal control β-actin (Wang et al. 2016) was used to assess the expression value of IbHQT genes. The reaction was conducted in 10 μL volume in QuantStudioTM Real-Time PCR Software thermal cycler (Applied Biosystem by life technologies). Independent biological triplicates were used, and the relative expression levels of the candidate HQT genes were calculated using the 2−ΔΔCT method (Park et al. 2020).

Vector construction and transformation of sweet potato leaf disks

Snap gene viewer (GSL Biotech LLC [https://www.snapgene.com/snapgene-viewer]) was used to design primers to amplify the full-length cDNA sequence of IbHQT-g47130 (Table S3). PCR was carried out using TaKaRa LA Taq®DNA Polymerase according to the manufacturer’s instructions. The PCR reaction was performed in a final volume of 50 μL including 10 × buffer (Mg2+): 5 μL, dNTP: 8 μL, HQT forward (10 μM): 1 μL, HQT reverse primer (10 μM):1 μL, LA Taq: 0.5 μL, cDNA: 2 μL and ddH2O: 32.5 μL.

The recovered PCR product was ligated into the corresponding restriction sites of the pMD18-T vector from the TAKARA Company. The reaction was then transformed into DH-5α competent cells (Invitrogen) for transformation with the entry vector. Single clones were selected and inoculated and M13 primer sequences: M13-F: 5′-GAGCGGATAACAATTTCACACAGG-3′, M13 R:5′-CGCCAGGGTTTTCCCAGTCACGAC-3′ which were used to select the pMD18-IbHQT-g47130 for sequencing. The sequencing results were checked using Geneious Prime version 2021.1.1 (https://www.geneious.com/download). Plasmid DNA from the confirmed sequenced bacteria solutions was extracted using TIANprep Mini Plasmid Kit (Tiangen Biotech [Beijing] Co., LTD) to obtain the pMD18-T-gene recombinant plasmid. After recovering the pMD18-IbHQT-g47130 plasmid, restriction enzymes were used to double digest the recovered product. Then, the Nimble Cloning kit was used to ligate the digested gene fragment to the pNC-Cam1304-MCS35S expression vector.

For RNAi- mediated gene silencing, primers were designed to amplify fragments of the target gene ranging from 200 to 600 bp from the mRNA sequence of the target gene considering the number of homology bases to other sequences. The cDNA of HC variety was used for PCR amplification which consisted of an initial denaturation step for 2 min at 95 °C, 30 cycles of 15 s at 94 °C 30 s at 60 °C, 1 min at 72 °C and finally of 2 min at 72 °C. The PCR product was recovered and cloned into the pNC-Cam 2304-RNAi cloning vector using Nimble cloning kit. The pNC-Cam 2304-RNAi vector containing PCR product was then transformed into E.coli competent cells and positive single colonies were verified by PCR using intron primers (intronF: gtcgaacatgaataaacaaggt and intrionR: tcgtcttacacatcacttgtc). The recombinant plasmids for both overexpression and silencing vectors were introduced into the Agrobacterium tumefaciens strain GV3101 chemically competent cells (Biomed, BC304). For gene overexpression, the bacterium was cultured in LB medium supplemented with 50 μg/mL Kanamycin and 50 μg/mL Rifampicin overnight. The A.tumefaciens containing the silencing vector was cultured in LB medium supplemented with 50 μg/mL Kanamycin, 50 μg/mL chloramphenicol, and 50 μg/mL Rifampicin overnight. Then, sweet-potato leaves were infected with the bacterial solutions for transgenic research.

Sweet-potato tender and healthy leaves (3–5 days old) of LC and HC variety were selected and treated with 70% ethanol and sodium hydrochloride solution (10% NaClO). Samples were then rinsed with distilled water. The small leaf pieces (3–5 mm) were cut and cultured in Murashige and Skoog (MS) medium supplemented with 1.0 mg/L 6-BA and 0.1 mg/L NAA and incubated at 28 °C in dark for two days. After two days-preculture, the leaves were then treated with the transgenic Agrobacterium for 10 min before being transferred into an MS medium containing 1.0 mg/L 6-BA and 0.1 mg/L NAA for two days to induce callus induction. The residual bacterium was removed using 3 MS medium containing 600, 300, and 150 mg/L CEF, respectively, and the leaves were rinsed in from high to low concentration for 10 min at each concentration level.

The leaves were then co-cultured in a delayed MS medium and then transferred to a differentiation medium for resistance screening and were sub-cultured onto fresh medium every two weeks until callus growth.

CGA quantification in overexpressed and silenced callus

The CGA concentration in overexpressed, silenced, and wild-type callus cultures were extracted according to the orthogonal table test which includes indexes such as alcohol concentration, material to liquid ratio, and extraction time. These factors affect the extraction of CGA from sweet potato leaves (Li et al. 2011). Following the orthogonal table test method with some modifications, the transgenic sweet-potato callus samples were mixed with 70% ethanol at a ratio of 1:20, then vacuum distilled by a rotary evaporator for 120 min. The obtained solution was filtered, and 50 µg/mL of the CGA standard was prepared. CGA content was measured using a spectrophotometer at OD 333.

Statistical analysis

The statistical analyses were performed using GraphPad Prism version 9.3.1. All graphs were calculated by Tukey’s multiple comparison test (P < 0.05). The variation was recorded as mean ± SE (****: P < 0.0001, ***: P < 0.001, **: P < 0.01, *: P < 0.05).

Results

Identification of HQT gene family members in sweet-potato

A total of 58 IbHQT genes were obtained from the sweet-potato genome and two BLAST methods, Pfam and CDD databases were used to confirm the presence of the HQT domain (Table 1). The chromosome number, chromosomal location, protein length, molecular weight (MW), and isoelectric point (pI) were the major predicted physical and chemical properties of the identified genes. The chromosomes were arranged in chronological order (from one to fifteen) and were named LG1–LG15. HQT gene protein length varied from 108 to 465 amino acids (aa). The molecular weight (MW) of proteins varied from 119.28 to 17.31 kDa, and pI varied from 4.95 to 9.67. The IbHQT-g20809 in LG5 (30,215,616–30,221,182), had the longest sequence with 465 aa and the highest molecular weight of 119.28 MW. The shortest sequence was observed for IbHQT-g55359 on LG13 (29,406,422–29,408,164), and the lowest molecular weight was observed for IbHQT-g26782 on LG7 (11,132,207–11,133,731) (Table 1). In addition, the average protein length, molecular weight, and isoelectric point for all members were 379.55 aa, 47.69 kDa, and 7.66, respectively, indicating that most of the IbHQT have properties of a basic protein. The predicted subcellular localization showed that most of the IbHQT family genes were localized in cytoplasm (28 members) followed by peroxisome (12 members) representing 48% and 20%, respectively, suggesting that HQT genes are substantial in promoting important metabolic processes in a plant cell. It was also noted that only 1 member (IbHQT-g59252) was localized in vacuole while both chloroplast and golgi apparatus had 6 members. Furthermore, extracellular space and mitochondrion had three and two members, respectively.

Table 1.

Characteristics of the identified HQT gene family members in sweet potato

Gene ID Chromosomes Location Protein length MW (kDa) pI Subcellular location
g50840 LG12 29,485,313–29,486,916 371 47.09 8.63 Cytoplasm
g20600 LG5 29,018,503–29,021,236 430 47.01 6.53 Cytoplasm
g50839 LG12 29,479,964–29,481,656 320 49.06 9.28 Cytoplasm
g30997 LG8 4,070,429–4,072,774 434 42.44 6.51 Chloroplast
g59252 LG14 27,563,693–27,565,674 434 52.54 6.46 Vacuole
g46369 LG11 36,982,607–36,986,374 146 49.2 6.2 Golgi apparatus
g32357 LG8 14,526,857–14,528,389 435 49.12 7.55 Cytoplasm
g32326 LG8 14,193,434–14,195,108 411 49.38 6.74 Cytoplasm
g46368 LG11 36,976,571–36,978,654 437 47.96 8.09 Golgi apparatus
g32327 LG8 14,199,344–14,202,716 412 49.03 7.84 Cytoplasm
g50851 LG12 29,544,649–29,545,756 402 35.62 7.76 Cytoplasm
g50843 LG12 29,499,930–29,501,456 440 48.86 8.34 Cytoplasm
g54740 LG13 25,658,625–25,661,622 390 53.25 7.26 Cytoplasm
g50856 LG12 29,591,070–29,593,116 399 44.71 7.21 Cytoplasm
g38506 LG10 2,306,809–2,309,149 450 47.48 6.77 Cytoplasm
g50837 LG12 29,470,465–29,472,676 419 48.41 8 Cytoplasm
g7869 LG2 26,851,002–26,852,578 453 50.4 6.64 Peroxisome
g50865 LG12 29,642,476–29,644,051 442 48.7 8.46 Cytoplasm
g30999 LG8 4,077,104–4,079,104 441 49.39 6.24 Golgi apparatus
g53740 LG13 19,106,048–19,108,444 386 44 7.88 Cytoplasm
g38514 LG10 2,378,404–2,383,304 462 49.21 8.44 Cytoplasm
g54739 LG13 25,652,590–25,654,732 416 53.01 8.38 Chloroplast
g20349 LG5 27,348,609–27,350,278 371 43.65 8.79 Mitochondrion
g50761 LG12 28,973,991–28,976,075 349 46.61 7.97 Cytoplasm
g16523 LG4 28,692,852–28,694,688 395 51.76 7.82 Peroxisome
g50841 LG12 29,490,159–29,492,286 423 48.44 8.3 Cytoplasm
g7899 LG2 27,065,726–27,067,610 354 45.7 8.38 Peroxisome
g20809 LG5 30,215,616–30,221,182 465 119.28 7.95 Cytoplasm
g54737 LG13 25,643,850–25,645,892 387 44.15 8.53 Mitochondrion
g54741 LG13 25,663,336–25,665,372 410 47.61 7.26 Chloroplast
g14245 LG4 10,617,104–10,622,759 353 49.27 9.31 Chloroplast
g14431 LG4 12,145,533–12,148,191 382 49.9 9.45 Golgi apparatus
g38515 LG10 2,386,337–2,388,354 386 50.53 6.85 Cytoplasm
g38507 LG10 2,314,459–2,316,407 379 51.77 6.79 Cytoplasm
g30998 LG8 4,074,417–4,076,344 378 33.98 6.32 Extracellular space
g35367 LG9 9,334,133–9,340,046 379 53.09 6.88 Cytoplasm
g54738 LG13 25,649,278–25,651,392 403 50.69 8.15 Chloroplast
g54875 LG13 26,507,966–26,511,395 458 50.4 5.34 Cytoplasm
g14430 LG4 12,133,847–12,140,201 463 51.92 9.7 Plasma membrane
g35775 LG9 12,592,606–12,596,687 388 44.87 9.66 Golgi apparatus
g14435 LG4 12,169,924–12,175,660 387 70.26 9.24 Peroxisome
g10403 LG3 7,024,724–7,028,232 383 49.33 7.71 Peroxisome
g38840 LG10 4,618,177–4,621,570 309 52.86 8.09 Chloroplast
g10392 LG3 6,918,784–6,920,203 388 49.33 8.45 Peroxisome
g10395 LG3 6,933,604–6,935,017 392 45.71 8.95 Peroxisome
g38535 LG10 2,514,386–2,516,576 390 39.85 5.94 Cytoplasm
g10398 LG3 6,961,044–6,962,611 312 49.65 8.15 Peroxisome
g24136 LG6 24,376,371–24,379,931 407 48.89 9.19 Extracellular space
g10402 LG3 7,014,294–7,020,631 393 47.06 7.91 Golgi apparatus
g10399 LG3 6,982,814–6,984,318 344 40.14 7.62 Peroxisome
g36083 LG9 14,918,901–14,919,974 183 18.2 4.95 Peroxisome
g14420 LG4 12,001,496–12,006,377 359 26.37 9.67 Extracellular space
g51779 LG13 4,447,382–4,450,527 301 47.78 5.97 Cytoplasm
g26783 LG7 11,134,987–11,136,571 357 35.63 7.29 Peroxisome
g26782 LG7 11,132,207–11,133,731 414 17.31 7.51 Cytoplasm
g47130 LG12 1,638,508–1,642,483 373 41.07 5.43 Cytoplasm
g55359 LG13 29,406,422–29,408,164 108 48.57 6.9 Cytoplasm
g14473 LG4 12,479,955–12,481,683 161 48.57 6.73 Cytoplasm
Open in a new tab

Key protein length (aa); MW: Protein molecular weight (kDa); pI: isoelectric point

Phylogenetic analysis of sweet-potato HQT transcription factor family

A total of 71 HQT family genes from Ipomoea batatas (Ib), Lonicera hypoglauca (Lh), Lonicera macranthoides (Lm), Lonicera japonica (Lj), Platycodon grandifloras (Pg), Cynara cardunculus var. scolymus [Cc (Globe artichoke)], Chichorium intybus (Ci), Nicotiana tabacum (Nt), Nicotiana attenuate (Na), Solanum lycopersicum (SI) and Erythroxylum Coca (Ec) were used to evaluate the phylogenetic relationship of HQT gene family members in above species by constructing the phylogenetic tree (Fig. 1). The identified HQT genes were clustered into four subclasses and the subclades were named clade A, clade B, clade C, and clade D. The Clade A had HQT family genes from all eight species and a total of 10 IbHQT genes were clustered into clade A. Clades B, C, and D had 24, 19, and 5 IbHQT proteins, respectively.

Fig. 1.

Fig. 1

Open in a new tab

A Phylogenetic tree of the HQT gene family from eight different species with four clades represented by different colors. Clade A, green color, Clade B, red color, Clade C, blue color, and Clade D, blown color (color figure online)

Gene structure and conserved motif analysis

To understand the protein sequence features and specific distribution of conserved motifs in the HQT family genes, 10 conserved motifs were explored using the MEME online tool (http://meme-suite.org/meme/tools/meme). Every individual HQT family gene member contained a total of eight conserved motifs on average. A total of 13 HQT family gene members out of 23 members in clade A contained all the 10 motifs. It was observed that motif four that is, DVJKKALAKALVSYYPLAGRL (Fig. S1) was absent in IbHQT-g26783, IbHQT-g47130, and LhHQT. Motif-7 was unique to clade A and appeared to be conserved in the C-terminus of the protein sequence. Furthermore, most of the HQT family genes in all the clades belonged to the PLN02481 superfamily (Fig. 2). Based on the phylogenetic analysis and the conserved motif analysis, members with close evolutionary association had similar conserved motifs, indicating possession of similar biological functions. Slight differences in the conserved motifs among members of the same subfamily may be due to evolution and/or recombination mutations.

Fig. 2.

Fig. 2

Open in a new tab

Structure of HQT genes in leafy vegetable sweet potato and other eight species, showing motif pattern and logos, the position of HQT conserved domain in the protein sequences, and subfamily groups of HQT genes

Chromosomal distribution and collinearity analysis of HQT genes

Based on the sweet-potato genome database, a map showing the physical position of 58 IbHQT genes on the chromosomes was created. The 58 IbHQT genes exhibited uneven distribution on all fifteen chromosomes named LG1 to LG15. LG12 contained 10 IbHQT family genes, followed by LG13 with 9 genes, and then LG4 with 7 genes. LG3, LG8, and LG10 contained 6 members each, while LG2, LG7, and LG11 had 2 members each. However, there were no IbHQT genes in LG1 and LG15 (Fig. 3a). There were 9 groups of IbHQT genes with tandem replication events, LG3, LG4, LG7, LG8, LG10, LG11, LG12, and LG13. The highest number of tandem repeats was observed in LG8 with two groups of tandem repeats. The tandem duplication of genes in different chromosomes also correlated with the phylogenetic tree analysis. The replication groups in LG3 and LG7 belonged to cluster A, the tandem replication groups in LG4, LG10, and LG13 belonged to cluster B, while those in LG8 and LG12 were only present in cluster C of the phylogenetic tree.

Fig. 3.

Fig. 3

Open in a new tab

Gene location and duplication events on chromosomes. a Chromosomal location of leafy vegetable IbHQT genes. The scale indicates the gene position on the chromosome. b Collinearity analysis of IbHQT gene family on 15 chromosomes. The red lines show the tandem and segmental duplications of HQTs in the sweet potato genome (color figure online)

To further examine the gene duplication events in the IbHQT family genes, we analyzed the collinearity relationship between IbHQT genes within different chromosomes. LG4 had one tandem duplication and one segmental duplication. It was noticed that IbHQT-g10392, IbHQT-g10395, IbHQT-g10398, IbHQT-g10402, and IbHQT-g10403 had tandem duplication on the same chromosome (LG3). No further duplication pairs were observed in the remaining chromosomes (Fig. 3b).

Analysis of cis-acting elements in the promoter regions of HQT genes

To further investigate the possible regulatory motif present in the IbHQT family gene, promoter sequences from all the genes were used for cis-acting element prediction analysis by PlantCARE online tool. The light-responsive, abscisic acid (ABA)-responsive, auxin-responsive, low-temperature responsive, gibberellic acid (GA) responsive, methyl jasmonate (MeJA) responsive elements and the elements involved in drought-inducibility, endosperm expression, defense and stress conditions, anoxic specific inducibility, differentiation of the palisade mesophyll cells, elements related to meristem expression, MYB binding site involved in flavonoid biosynthesis gene regulation and MYBHv1 binding sites cis-acting elements were identified in IbHQT gene family members. Our results showed that all the HQT family genes showed the presence of light-responsive elements with a wide range of motifs including GT1-motif, G-box, TCT-motif, 3-AF1 binding sites, etc. The majority had cis-elements involved in ABA, GA, and MeJA responsiveness (Fig. S2 and Table S4).

Expression profiling of HQT genes related to CGA accumulation

To determine the expression levels of IbHQT genes at different developmental stages of sweet-potato (65 d and 85 d), the transcriptome data of all IbHQT genes were retrieved from the NCBI database with the project number PRJNA592001. Overall, most of the IbHQT genes were highly expressed in HC at 85 days (Fig. 4). However, the expression patterns varied with the stage of growth and development suggesting specific roles of the IbHQT genes at various growth stages. For example, IbHQT-g54875 and IbHQT-g14435 were highly expressed at 65 d and 85 d, respectively, followed by IbHQT-g50843, IbHQT-g51779, and IbHQT-g47130, at 85 d, 65 d, 85 d, respectively. However, some HQT genes were relatively upregulated at both stages of development. It was observed that IbHQT-30997 and IbHQT-7899 were relatively upregulated at 65 d and 85 d, respectively, in the HC variety suggesting multiple and similar functions at different stages of growth and development (Fig. 4).

Fig. 4.

Fig. 4

Open in a new tab

Expression Patterns of IbHQT genes at two different developmental stages. HC_65 and HC_85 represent samples collected from the HC variety at 65 d and 85 d, respectively. Similarly, LC_65 and LC_85 represent samples collected from LC at 65 d and 85 d, respectively. The analysis was done in three replicates numbered 1–3. The color from red to blue represents relative expression levels from high to low (color figure online)

Ten genes were randomly selected for qRT-PCR verification of the transcriptome data. A total of 9 IbHQT genes were highly expressed in the HC variety, while the remaining one was high in the LC variety (Fig. 5a–j). A significant difference in expression levels was observed in IbHQT-g47130, IbHQT-g36083, IbHQT-g10398, IbHQT-g32327, IbHQT-g51779, and IbHQT-g10392 in the HC variety. Similarly, we have observed that IbHQT-g53740 was highly expressed in the LC variety with the least expression levels (0.27-fold) among the highly expressed genes. Notably, amongst the six highly expressed IbHQT genes in the HC variety, four of them IbHQT-g47130, IbHQTg10398, IbHQT-g51779, and IbHQT-g10392 belonged to cluster A in the phylogenetic tree and this cluster was suggested to be the most important among all the clusters according to the phylogenetic and collinearity analysis. From the results, the qRT- PCR analysis positively correlated with the transcriptome data, suggesting the reliability of our transcriptome analysis.

Fig. 5.

Fig. 5

Open in a new tab

Relative expression level of ten IbHQT gene family members, with six members highly expressed in the HC variety and only one member possessed a high expression level in the LC variety suggesting a significant difference between the two leafy vegetable sweet-potato varieties. All graphs were calculated by Tukey’s multiple comparison test (P < 0.05). The variation was recorded as mean ± SE (****: P < 0.0001, ***: P < 0.001, **: P < 0.01, *: P < 0.05)

Expression patterns of HQT genes under abiotic stress conditions.

The role of HQT genes in response to abiotic stress conditions in leafy vegetable sweet-potato is largely unknown. Therefore, to determine the functions of the IbHQT gene under abiotic stress conditions, we analyzed the expression patterns of IbHQT family genes under cold, drought, and salt stress conditions using transcriptome profiling data of IbHQT genes retrieved from the NCBI database with the project number PRJNA486421 for cold stress condition, PRJNA413661 for drought stress condition, and PRJNA631585 for salt stress condition (Fig. 6). Compared to the control, the expression levels of the genes under different abiotic stress conditions varied. For example, most of the highly upregulated genes under normal conditions were downregulated after exposure to stress conditions and vice-versa. A total of 15 IbHQT genes were highly expressed under cold stress condition, followed by eight genes that were slightly expressed. During drought stress condition, IbHQT-g10392, IbHQT-g7899, and IbHQT-g54737 were highly expressed followed by IbHQT-g54740, IbHQT-g20809, and the other six genes which were slightly expressed. However, it was observed that a few genes were upregulated with only IbHQT-g30999 being highly expressed under salt stress condition (Fig. 6).

Fig. 6.

Fig. 6

Open in a new tab

IbHQT gene expression levels under cold, drought and salt stress conditions compared to the control (normal) conditions. The transcriptome profiling data of IbHQT genes were retrieved from the NCBI database with the project number PRJNA486421 for cold stress condition, PRJNA413661 for drought stress condition, and PRJNA631585 for salt stress condition. The colors represent gene transcriptome level

Overexpression and silencing of IbHQT-g47130 affect expression levels and CGA synthesis in transgenic callus lines

To understand the involvement of IbHQT-g47130 in CGA accumulation, IbHQT-g47130 was successfully cloned (Fig. 7a, b). For transient expression, sweet-potato leaf disks from the LC variety were cultured in MS medium (Fig. 8a). The Blue Fluorescence showed the GFP gene expression in the infected callus (Fig. 8b, c). To confirm the effects of IbHQT-g47130 in the two sweet potato transgenic callus varieties, qRT-PCR was performed with control (wild type), overexpression, and silenced callus lines and the gene expression value was normalized using a β-actin as the reference gene (Fig. 8d). The qRT-PCR results showed that the relative expression level of IbHQT-g47130 in the overexpression callus line significantly increased compared to the wild-type (control) callus line. However, the gene expression levels of the silenced callus lines were significantly low compared to the control callus lines (Fig. 8e). These results confirmed that the insertion of IbHQT-g47130 from the HC variety into LC transgenic callus lines increases the expression of IbHQT-g47130 in the LC callus lines. On the other hand, silencing of IbHQT-g47130 reduces HQT gene expression levels.

Fig. 7.

Fig. 7

Open in a new tab

Gel electrophoresis following PCR verification. a Cloned sequence of the target HQT gene. b Positive recombinant plasmid in genetically engineered bacteria. The empty wells represent negative control

Fig. 8.

Fig. 8

Open in a new tab

Agrobacterium-mediated transformation of leafy vegetable sweet potato. a Three days old leaf disks from HC variety. b Two-week leaf disks infected with GV3101 strain containing pNC-Cam1304-g47130 overexpression vector. Blue fluorescence light was used to select the transgenic callus line. c Eight-week-old transgenic callus under blue light fluorescence for GFP gene verification. d Eight-week-old callus was corrected for transcript accumulation analysis by qRT-PCR, samples 1–3 represent the transgenic callus while samples 4–6 represent the wild-type callus. The actin reference gene was used as the internal control. e Relative expression level shows the significant differences between wild-type, overexpression, and silenced callus. f The content of CGA in wild-type, overexpression, and silenced callus compared to the standard CGA curve. Two Way Analysis of Variance (ANOVA) was employed to compare the differences between control and treated samples at P < 0.0001. The variation was recorded as mean ± SE (****: P < 0.0001, ***: P < 0.001, **: P < 0.01, *: P < 0.05)

To further study the effects of overexpression and silencing of IbHQT-g47130 in CGA biosynthesis and accumulation in sweet potato, the content of CGA in all the samples was determined using the orthogonal table test (Li et al. 2011) with some modifications. The test for overexpression, silenced, and wild-type callus lines were carried out in three replicates and the results were statistically analyzed. The highest level of CGA (0.07 µg/mL) was observed in the overexpressed leafy vegetable sweet potato callus lines, while the content of CGA in the wild-type callus was low (0.008 µg/mL). In addition, the accumulation of CGA in the silenced sweet potato callus lines was lower (0.0025 µg/mL) compared to the wild-type callus (0.009 µg/mL) (Fig. 8f). We have observed that there was a significant difference in CGA accumulation between the overexpression, silenced, and the wild-type callus lines. Our results, therefore, suggested that the overexpression of IbHQT genes in sweet-potato enhances biosynthesis and accumulation of CGA while silencing of IbHQT genes negatively affects the biosynthetic pathway of CGA hence reducing its accumulation.

Discussion

Sweet potato leaves are a rich source of bio compounds that have significant nutritional and pharmaceutical properties. These important properties are mainly due to the high content of phenolic acids and flavonoids, particularly CGA (Jung et al. 2011; Luo et al. 2021). So far, some studies have reported that HQT genes in some species influence the accumulation of CGA (Moglia et al. 2016; Cheevarungnapakul et al. 2019). For instance, silencing of the HQT gene in a tomato plant resulted in a 98% reduction of the CGA content (Niggeweg et al. 2004) which is the most abundant isomer among the phenolic acids in plants (Naveed et al. 2018). However, scanty data is available for  the regulatory role of HQT family genes in leafy vegetable sweet potato. Therefore, we performed the genome-wide identification and characterization of HQT family genes and their genomic role in CGA accumulation in leafy sweet potato.

HQT is one of the classes of hydroxycinnamoyl transferases which belongs to the plant acyl-CoA-dependent BAHD superfamily (D’Auria 2006; Lallemand et al. 2012). The BAHD family transfers an acyl group from a Coenzyme-A activated acid to an acceptor molecule, thereby enabling the biosynthesis of phenolic acids in plants (Zhang et al. 2017). The phylogenetic analysis of BAHD in previous studies identified a total of five clades based on genetically or biochemically characterized members, of which HQT gene family members were identified in a single clade (D’Auria 2006). The biochemically characterized BAHD acyltransferases from Medicago,Populus, Oryza, and Arabidopsis thaliana identified eight clades (Tuominen et al. 2011). In our study four clades were identified from 71 HQT family genes from Ipomoea batatas (Ib), Lonicera hypoglauca (Lh), Lonicera macranthoides (Lm), Lonicera japonica (Lj), Platycodon grandifloras (Pg), Cynara cardunculus var. scolymus [Cc (Globe artichoke)], Chichorium intybus (Ci), Nicotiana tabacum (Nt), Nicotiana attenuate (Na), Solanum lycopersicum (SI) and Erythroxylum Coca (Ec), which were used to evaluate the evolutionary relationship and functions of all the 58 IbHQT gene family members together with 13 representative proteins from other species. Clade A had HQT family members from all 8 species and a total of 10 IbHQT genes were present, suggesting the significance of this clade since it shares the evolutionary relationship with other species.

The chromosomal distribution and collinearity analysis gave key information regarding the function and evolution of genes. Previous research revealed that gene duplication events occur during gene evolution and expansion (Pan et al. 2022a). In this study, for example, the absence of HQT gene was noticed in LG1 and LG15 which may have occurred due to the absence of tandem duplication chromosome shift or fragment losses during the evolution process. Both segmental and tandem duplications of gene family members resulted in the expansion of the whole gene family. The collinearity analysis in previous research shows that most of the gene family members possess several tandem duplications in various chromosomes (Huang et al. 2020; Zhang et al. 2021; Zhao et al. 2021). However, only 2 chromosomes (LG3 and LG4) in sweet-potato possess tandem duplication and 2 chromosomes (LG13 and LG4) exhibited segmental duplication. Our results suggested that the presence of more tandem duplication on LG3 chromosome, maybe the reason for the high CGA content in sweet potato.

A wide number of BAHD genes identified in several species are involved in various biological processes including plant biotic or abiotic stress resistance and plant growth and development (Cheng et al. 2013). Similarly, it was observed that banana BAHD (MaBAHD) family genes are involved in abiotic stress signaling responses including cold, salt, and osmotic stress conditions (Xu et al. 2021). These results indicated that the BAHD family genes which include HQT genes are involved in plant resistance to abiotic stress conditions which is consistent with our transcriptome analysis. Based on our study, most of the IbHQT genes were upregulated during cold stress condition followed by drought, and salt stress conditions suggesting the significance of IbHQT genes under drought and cold stress conditions. Compared to cold and drought stress condition, a few genes were upregulated under salt stress indicating limited responsiveness of most of the IbHQT genes under salinity conditions in sweet potato. This is not consistent with other previous research which showed that CGA increased significantly in honeysuckle leaves under hydroponic NaCl stress condition due to the increase in HQT family gene mRNA transcription (Yan et al. 2016). This difference might occur due to genetic variations in different species.

Since our main objective was to evaluate the role of HQT family genes in the biosynthesis of CGA in sweet potato, both overexpression and silencing of the HQT gene was employed to verify its function. Previous studies have shown that callus cultures can be used effectively to measure changes in phenolic acids including CGA (Siahpoush et al. 2011; Fazal et al. 2016; Ullah et al. 2019). To generate overexpression and silenced sweet potato callus, IbHQT-g47130 overexpression, and silencing vectors were constructed. To determine whether IbHQT-g47130 gene expression affect the biosynthesis and accumulation of CGA, the content of CGA in overexpression, silenced, and wild-type callus was measured. The relative expression level of IbHQT-g47130 in the overexpression callus line was onefold higher compared to the wild-type (control) callus line which confirmed that insertion of IbHQT-g47130 from the HC variety into LC transgenic callus lines increases expression of IbHQT-g47130 in the LC callus lines, which in turn resulted in high CGA accumulation. Similar to our findings, high expression levels of HQT-overexpressed callus in L. japonica resulted in a 30% increase in the accumulation of CGA than wild-type callus (Zhang et al. 2017). Furthermore, digital gene expression analysis was employed in Lonicera. macranthoides to identify the key genes associated with CGA biosynthesis and accumulation. Amongst the five identified genes, a high number of HQT genes were found to be associated with CGA biosynthesis (Chen et al. 2015), indicating its positive role in CGA biosynthesis. In Lonicera japonica, the amino acid sequence, enzyme activity, and accumulation of CGA demonstrated that cDNA coding an HQT is involved in the biosynthesis of CGA (Peng et al. 2010). Furthermore, cloning of cDNA encoding HQT that synthesizes CGA was characterized in tomato and tobacco plants. The results showed that overexpression of HQT resulted in a high accumulation of CGA without affecting the content of other phenolic compounds (Niggeweg et al. 2004).

It has been shown that HQT genes are involved in CGA biosynthesis and their down-regulation results in a significant reduction in the content of CGA in potato and tomato plants (Niggeweg et al. 2004; Payyavula et al. 2015). Silencing of HQT in L. japonica resulted in lower expression levels, hence 83% reduction in the accumulation of CGA was observed in the silenced callus (Zhang et al. 2017). Consistent with the previous findings, this study revealed that silencing of IbHQT-g47130 reduces both gene expression levels and CGA accumulation. The gene expression levels of the silenced lines were 0.2-fold lower than the wild-type callus line and there was a significant difference in CGA content in wild type callus and silenced callus. Similarly, silencing of NtHQT resulted in a 12 times decrease in polyphenols (Chang et al. 2009). In addition, the virus-induced silencing of HQT in globe artichoke resulted in a significant decrease in levels of CGA and a diCQAs while a significant increase was observed after transient overexpression of the HQT in Nicotiana benthamiana (Moglia et al. 2016). We observed that the levels of CGA were higher in the overexpression callus, intermediate in the wild-type callus, and low in the silenced callus which implied a positive correlation between IbHQT-g47130 expression and CGA accumulation. Suggesting that the overexpression of IbHQT-g47130 enhances the biosynthesis and accumulation of CGA in sweet potato. Taken together, previous studies and our results show that overexpression and silencing of HQT genes affect the accumulation of phenolic acids (CGA) in plants.

Conclusion

In this study, a total of 58 IbHQT genes were identified from leafy vegetable sweet potato, and their classification and gene structures were determined. The expression patterns of IbHQT gene family members in HC and LC sweet potato varieties at different developmental stages were evaluated. Overall, it was observed that expression of the IbHQT gene family varied indicating the diverse function of the IbHQT gene family in plant growth and development. The expression profiles of IbHQT genes in response to abiotic stress conditions suggested the involvement of IbHQT genes in plant abiotic response signaling. Furthermore, the transient overexpression and silencing of IbHQT-g47130 in sweet-potato callus revealed a positive correlation between IbHQT genes and biosynthesis and accumulation of CGA in sweet potato. After data validation, we concluded that our systematic analysis provides fundamental information on the functions of the HQT gene family and lays a foundation for further analysis of HQT genes in sweet potato and other species.

Supplementary Information

Below is the link to the electronic supplementary material.

12298_2023_1299_MOESM1_ESM.xlsx (12.5KB, xlsx)

Supplementary Table S1 Gene IDs and assigned names for the 58 identified sweet-potato HQT genes (XLSX 12 KB)

12298_2023_1299_MOESM2_ESM.xlsx (12.6KB, xlsx)

Supplementary Table S2 A list of primers for qRT-PCR (XLSX 13 KB)

12298_2023_1299_MOESM3_ESM.xlsx (11KB, xlsx)

Supplementary Table S3 Primers for IbHQT-g47130 cDNA amplification (XLSX 11 KB)

12298_2023_1299_MOESM4_ESM.xlsx (86.6KB, xlsx)

Supplementary Table S4 Characterization of HQT genes in the promotor region (XLSX 87 KB)

12298_2023_1299_MOESM5_ESM.tif (1.9MB, tif)

Supplementary Fig. S1 Conserved motifs analysis of ‘DVJKKALAKALVSYYPLAGRL’ sequence denoted by serial number ‘motif 4’ (TIF 1950 KB)

12298_2023_1299_MOESM6_ESM.tif (4.9MB, tif)

Supplementary Fig. S2 Analysis of cis-acting elements in the promoter region of IbHQT genes. A large number of cis-acting elements are represented in different colors and the elements are shown on the right (TIF 5052 KB)

Author contributions

MBM, investigation, validation, writing-original draft, writing-review & editing; RP, formal analysis, validation, writing-review & editing; YP, validation; RGM, validation, writing-original draft, writing-review & editing; AS, writing-review & editing; XSY, Resources, funding acquisition; WZ, conceptualization, writing-review & editing, funding acquisition, and supervision. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Key R & D Program of China (Grant Nos. 2018YFD1000700, 2018YFD1000705, 2019YFD1001300, 2019YFD1001305).

Declarations

Conflict of interest

The authors declare that there are no conflicts of interest.

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  1. Arnold PA, Kruuk LEB, Nicotra AB. How to analyse plant phenotypic plasticity in response to a changing climate. New Phytol. 2019;222:1235–1241. doi: 10.1111/nph.15656. [DOI] [PubMed] [Google Scholar]
  2. Atayee AR, Noori MS. Alleviation of cold stress in vegetable crops. J Sci Agric. 2020;4:38–44. doi: 10.25081/jsa.2020.v4.6110. [DOI] [Google Scholar]
  3. Cardenas CL, Costa MA, Laskar DD, et al. RNA i modulation of chlorogenic acid and lignin deposition in nicotiana tabacum and insufficient compensatory metabolic cross-talk. J Nat Prod. 2021;84:694–706. doi: 10.1021/acs.jnatprod.1c00054. [DOI] [PubMed] [Google Scholar]
  4. Chang J, Luo J, He G. Regulation of polyphenols accumulation by combined overexpression/silencing key enzymes of phyenylpropanoid pathway. Acta Biochim Biophys Sin (shanghai) 2009;41:123–130. doi: 10.1093/abbs/gmn014. [DOI] [PubMed] [Google Scholar]
  5. Cheevarungnapakul K, Khaksar G, Panpetch P, et al. Identification and functional characterization of genes involved in the biosynthesis of caffeoylquinic acids in sunflower (Helianthus annuus L.) Front Plant Sci. 2019 doi: 10.3389/fpls.2019.00968. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Chen Z, Tang N, You Y, et al. Transcriptome analysis reveals the mechanism underlying the production of a high quantity of chlorogenic acid in young leaves of lonicera macranthoides Hand.-Mazz. PLoS ONE. 2015;10:1–18. doi: 10.1371/journal.pone.0137212. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Cheng AX, Gou JY, Yu XH, et al. Characterization and ectopic expression of a populus hydroxyacid hydroxycinnamoyltransferase. Mol Plant. 2013;6:1889–1903. doi: 10.1093/mp/sst085. [DOI] [PubMed] [Google Scholar]
  8. Claude SJ, Park S, Park SJ. Transcriptome-wide identification and quantification of caffeoylquinic acid biosynthesis pathway and prediction of its putative bahds gene complex in a. Spathulifolius. Int J Mol Sci. 2021 doi: 10.3390/ijms22126333. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Clé C, Hill LM, Niggeweg R, et al. Modulation of chlorogenic acid biosynthesis in Solanum lycopersicum; consequences for phenolic accumulation and UV-tolerance. Phytochemistry. 2008;69:2149–2156. doi: 10.1016/j.phytochem.2008.04.024. [DOI] [PubMed] [Google Scholar]
  10. Comino C, Hehn A, Moglia A, et al. The isolation and mapping of a novel hydroxycinnamoyltransferase in the globe artichoke chlorogenic acid pathway. BMC Plant Biol. 2009;9:1–13. doi: 10.1186/1471-2229-9-30. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. D’Auria JC. Acyltransferases in plants: a good time to be BAHD. Curr Opin Plant Biol. 2006;9:331–340. doi: 10.1016/j.pbi.2006.03.016. [DOI] [PubMed] [Google Scholar]
  12. Djami-Tchatchou AT, Matsaunyane LBT, Kalu CM, Ntushelo K. Gene expression and evidence of coregulation of the production of some metabolites of chilli pepper inoculated with Pectobacterium carotovorum ssp. carotovorum. Funct Plant Biol. 2019;46:1114–1122. doi: 10.1071/FP18244. [DOI] [PubMed] [Google Scholar]
  13. Fazal H, Abbasi BH, Ahmad N, et al. Correlation of different spectral lights with biomass accumulation and production of antioxidant secondary metabolites in callus cultures of medicinally important Prunella vulgaris L. J Photochem Photobiol B Biol. 2016;159:1–7. doi: 10.1016/j.jphotobiol.2016.03.008. [DOI] [PubMed] [Google Scholar]
  14. Huang J, Sun W, Ren J, et al. Genome-wide identification and characterization of actin-depolymerizing factor (Adf) family genes and expression analysis of responses to various stresses in zea mays l. Int J Mol Sci. 2020;21:1–17. doi: 10.3390/ijms21051751. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Jo Y, Kim SM, Choi H, et al. Sweet potato viromes in eight different geographical regions in Korea and two different cultivars. Sci Rep. 2020;10:1–16. doi: 10.1038/s41598-020-59518-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Jung JK, Lee SU, Kozukue N, et al. Distribution of phenolic compounds and antioxidative activities in parts of sweet potato (Ipomoea batata L.) plants and in home processed roots. J Food Compos Anal. 2011;24:29–37. doi: 10.1016/j.jfca.2010.03.025. [DOI] [Google Scholar]
  17. Klopfenstein DV, Zhang L, Pedersen BS, et al. GOATOOLS: a python library for gene ontology analyses. Sci Rep. 2018;8:1–17. doi: 10.1038/s41598-018-28948-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Lallemand LA, Zubieta C, Lee SG, et al. A structural basis for the biosynthesis of the major chlorogenic acids found in coffee. Plant Physiol. 2012;160:249–260. doi: 10.1104/pp.112.202051. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Laurie SM, Bairu MW. Analysis of the nutritional composition and drought tolerance traits of sweet potato : selection criteria for breeding lines. Plants. 2022 doi: 10.3390/plants11141804. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Lepelley M, Cheminade G, Tremillon N, et al. Chlorogenic acid synthesis in coffee: An analysis of CGA content and real-time RT-PCR expression of HCT, HQT, C3H1, and CCoAOMT1 genes during grain development in C. canephora. Plant Sci. 2007;172:978–996. doi: 10.1016/j.plantsci.2007.02.004. [DOI] [Google Scholar]
  21. Li G, Yu S, Yang XS, Chen QF. Study on extraction technology for chlorogenic acid from sweet potato leaves by orthogonal design. Procedia Environ Sci. 2011;8:403–407. doi: 10.1016/j.proenv.2011.10.063. [DOI] [Google Scholar]
  22. Li J, Wang T, Han J, Ren Z. Genome-wide identification and characterization of cucumber bHLH family genes and the functional characterization of CsbHLH041 in NaCl and ABA tolerance in Arabidopsis and cucumber. BMC Plant Biol. 2020;20:1–20. doi: 10.1186/s12870-020-02440-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Li K, Duan L, Zhang Y, et al. Genome-wide identification and expression profile analysis of trihelix transcription factor family genes in response to abiotic stress in sorghum [Sorghum bicolor (L.) Moench] BMC Genomics. 2021;22:1–17. doi: 10.1186/s12864-021-08000-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Liu X, Zhang H, Ma L, et al. Genome-wide identification and expression profiling analysis of the trihelix gene family under abiotic stresses in medicago truncatula. Genes (Basel) 2020;11:1–18. doi: 10.3390/genes11111389. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014;15:1–21. doi: 10.1186/s13059-014-0550-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Luo D, Mu T, Sun H. Profiling of phenolic acids and flavonoids in sweet potato (Ipomoea batatas L.) leaves and evaluation of their anti-oxidant and hypoglycemic activities. Food Biosci. 2021;39:100801. doi: 10.1016/j.fbio.2020.100801. [DOI] [Google Scholar]
  27. Moglia A, Acquadro A, Eljounaidi K, et al. Genome-wide identification of bahd acyltransferases and in vivo characterization of HQT-like enzymes involved in caffeoylquinic acid synthesis in globe artichoke. Front Plant Sci. 2016;7:1–15. doi: 10.3389/fpls.2016.01424. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Mudau SP, Steenkamp PA, Piater LA, et al. Metabolomics-guided investigations of unintended effects of the expression of the hydroxycinnamoyl quinate hydroxycinnamoyltransferase (hqt1) gene from Cynara cardunculus var. scolymus in Nicotiana tabacum cell cultures. Plant Physiol Biochem. 2018;127:287–298. doi: 10.1016/j.plaphy.2018.04.005. [DOI] [PubMed] [Google Scholar]
  29. Naveed M, Hejazi V, Abbas M, et al. Chlorogenic acid (CGA): a pharmacological review and call for further research. Biomed Pharmacother. 2018;97:67–74. doi: 10.1016/j.biopha.2017.10.064. [DOI] [PubMed] [Google Scholar]
  30. Niggeweg R, Michael AJ, Martin C. Engineering plants with increased levels of the antioxidant chlorogenic acid. Nat Biotechnol. 2004;22:746–754. doi: 10.1038/nbt966. [DOI] [PubMed] [Google Scholar]
  31. Pan C, Wang S, Yang C, et al. Genome-wide identification and expression profiling analysis of Wnt family genes affecting adipocyte differentiation in cattle. Sci Rep. 2022;12:1–14. doi: 10.1038/s41598-021-04468-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Pan R, Buitrago S, Peng Y, et al. Genome-wide identification of cold-tolerance genes and functional analysis of IbbHLH116 gene in sweet potato. Gene. 2022;837:146690. doi: 10.1016/j.gene.2022.146690. [DOI] [PubMed] [Google Scholar]
  33. Park SU, Kim YH, Lee CJ, et al. Comparative transcriptome profiling of two sweetpotato cultivars with contrasting flooding stress tolerance levels. Plant Biotechnol Rep. 2020;14:743–756. doi: 10.1007/s11816-020-00650-5. [DOI] [Google Scholar]
  34. Payyavula RS, Shakya R, Sengoda VG, et al. Synthesis and regulation of chlorogenic acid in potato: Rerouting phenylpropanoid flux in HQT-silenced lines. Plant Biotechnol J. 2015;13:551–564. doi: 10.1111/pbi.12280. [DOI] [PubMed] [Google Scholar]
  35. Peng X, Li W, Wang W, Bai G. Cloning and characterization of a cDNA coding a hydroxycinnamoyl-CoA quinate hydroxycinnamoyl transferase involved in chlorogenic acid biosynthesis in lonicera japonica. Planta Med. 2010;76:1921–1926. doi: 10.1055/s-0030-1250020. [DOI] [PubMed] [Google Scholar]
  36. Qin N, Gao Y, Cheng X, et al. Genome-wide identification of CLE gene family and their potential roles in bolting and fruit bearing in cucumber (Cucumis sativus L.) BMC Plant Biol. 2021;21:1–18. doi: 10.1186/s12870-021-02900-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Siahpoush A, Ghasemi N, Shams Ardakani M, Asghari G. Production of chlorogenic acid in Varthemia persica DC (var. persica) callus cultures. Res Pharm Sci. 2011;6:63–69. [PMC free article] [PubMed] [Google Scholar]
  38. Sonnante G, D’Amore R, Blanco E, et al. Novel hydroxycinnamoyl-coenzyme a quinate transferase genes from artichoke are involved in the synthesis of chlorogenic acid. Plant Physiol. 2010;153:1224–1238. doi: 10.1104/pp.109.150144. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Tuominen LK, Johnson VE, Tsai CJ. Differential phylogenetic expansions in BAHD acyltransferases across five angiosperm taxa and evidence of divergent expression among Populus paralogues. BMC Genomics. 2011 doi: 10.1186/1471-2164-12-236. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Ullah MA, Tungmunnithum D, Garros L, et al. Monochromatic lights-induced trends in antioxidant and antidiabetic polyphenol accumulation in in vitro callus cultures of Lepidium sativum L. J Photochem Photobiol B Biol. 2019;196:111505. doi: 10.1016/j.jphotobiol.2019.05.002. [DOI] [PubMed] [Google Scholar]
  41. Wang F, Tong W, Zhu H, et al. A novel Cys2/His2 zinc finger protein gene from sweetpotato, IbZFP1, is involved in salt and drought tolerance in transgenic Arabidopsis. Planta. 2016;243:783–797. doi: 10.1007/s00425-015-2443-9. [DOI] [PubMed] [Google Scholar]
  42. Wei Q, Lan K, Liu Y, et al. Transcriptome analysis reveals regulation mechanism of methyl jasmonate-induced terpenes biosynthesis in Curcuma wenyujin. PLoS ONE. 2022;17:e0270309. doi: 10.1371/journal.pone.0270309. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Xu Y, Tie W, Yan Y, et al. Identification and expression of the BAHD family during development, ripening, and stress response in banana. Mol Biol Rep. 2021;48:1127–1138. doi: 10.1007/s11033-020-06132-9. [DOI] [PubMed] [Google Scholar]
  44. Yan K, Cui M, Zhao S, et al. Salinity stress is beneficial to the accumulation of chlorogenic acids in honeysuckle (Lonicera Japonica Thunb.) Front Plant Sci. 2016;7:1–10. doi: 10.3389/fpls.2016.01563. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Yang Z, Sun J, Chen Y, et al. Genome-wide identification, structural and gene expression analysis of the bZIP transcription factor family in sweet potato wild relative Ipomoea trifida. BMC Genet. 2019;20:1–18. doi: 10.1186/s12863-019-0743-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Zhang J, Lin LM, Cheng WW, et al. Genome-wide identification and expression analysis of glycosyltransferase gene family 1 in Quercus robur L. J Appl Genet. 2021;62:559–570. doi: 10.1007/s13353-021-00650-3. [DOI] [PubMed] [Google Scholar]
  47. Zhang J, Wu M, Li W, Bai G. Regulation of chlorogenic acid biosynthesis by hydroxycinnamoyl CoA quinate hydroxycinnamoyl transferase in Lonicera japonica. Plant Physiol Biochem. 2017;121:74–79. doi: 10.1016/j.plaphy.2017.10.017. [DOI] [PubMed] [Google Scholar]
  48. Zhao K, Chen S, Yao W, et al. Genome-wide analysis and expression profile of the bZIP gene family in poplar. BMC Plant Biol. 2021;21:1–16. doi: 10.1186/s12870-021-02879-w. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

12298_2023_1299_MOESM1_ESM.xlsx (12.5KB, xlsx)

Supplementary Table S1 Gene IDs and assigned names for the 58 identified sweet-potato HQT genes (XLSX 12 KB)

12298_2023_1299_MOESM2_ESM.xlsx (12.6KB, xlsx)

Supplementary Table S2 A list of primers for qRT-PCR (XLSX 13 KB)

12298_2023_1299_MOESM3_ESM.xlsx (11KB, xlsx)

Supplementary Table S3 Primers for IbHQT-g47130 cDNA amplification (XLSX 11 KB)

12298_2023_1299_MOESM4_ESM.xlsx (86.6KB, xlsx)

Supplementary Table S4 Characterization of HQT genes in the promotor region (XLSX 87 KB)

12298_2023_1299_MOESM5_ESM.tif (1.9MB, tif)

Supplementary Fig. S1 Conserved motifs analysis of ‘DVJKKALAKALVSYYPLAGRL’ sequence denoted by serial number ‘motif 4’ (TIF 1950 KB)

12298_2023_1299_MOESM6_ESM.tif (4.9MB, tif)

Supplementary Fig. S2 Analysis of cis-acting elements in the promoter region of IbHQT genes. A large number of cis-acting elements are represented in different colors and the elements are shown on the right (TIF 5052 KB)

Articles from Physiology and Molecular Biology of Plants are provided here courtesy of Springer

RESOURCES