Skip to main content
NCBI home page
Veterinary Research Forum logoLink to Veterinary Research Forum
. 2023 Mar 15;14(3):113–119. doi: 10.30466/vrf.2022.545086.3328

Phylogenetic analysis of canine parvovirus isolates from west Mediterranean region of Türkiye

Sibel Hasircioğlu 1,*
PMCID: PMC10073807  PMID: 37033776

Abstract

Canine parvovirus type 2 (CPV-2) causes hemorrhagic enteritis, and is one of the most important and contagious pathogens of dogs. In this study, we aimed to determine the prevalence and antigenic variants of CPV enteritis in dogs. Fecal samples were collected from 35 dogs with mucoid to hemorrhagic diarrhea in the Western Mediterranean region of Türkiye between October 2019 and March 2021. DNA was isolated from the samples and examined using PCR analysis. Twenty-eight out of 35 dogs (80.00%) were detected to be positive for CPV. Of these, three had already been vaccinated. The partial VP2 genes of 15 CPV positive samples producing strong bands in agarose gels were sequenced. All strains were identified as CPV-2b, and the amino acid changes were identified. Discriminative amino acid changes were detected for different amino acid positions clearly defining new CPV-2b variants. Of the 15 isolates, three had previously unreported synonymous mutations. Phylogenetic analysis indicated that the strains obtained in this study were closely related to isolates from the Mersin province of Türkiye, except for three isolates that had synonymous mutations and were located in a separate branch from the other CPV-2b genetic variants previously detected in Mersin Province and Urfa Province in Türkiye. This study demonstrates the increase in the prevalence rates for CPV-2b circulating in vaccinated and nonvaccinated dogs. Taking into account the data from phylogenetic trees which highlights differences between the vaccine strains and the isolates, re-designing immunization strategies needs necessary.

Key Words: Canine, Parvovirus, Strain, VP2 gene

Introduction

Canine parvovirus type 2 (CPV-2) is one of the most important viral pathogens of dogs causing hemorrhagic gastroenteritis, and myocarditis. The clinical symptoms are fever, leukopenia, hemorrhagic diarrhea, dehydration, and anorexia. The disease is very contagious, and progresses with a mortality of 10.00% in adult dogs and 91.00% in puppies.1,2,3 The CPV-2 belongs to the family Parvoviridae, subfamily Parvovirinae, and genus Proto-parvovirus.2 It is a non-enveloped, icosahedral, linearized, single-stranded DNA virus. The viral genome is 5.30 kb in length and contains two open reading frames (ORFs).4,5 The first ORF codes for two non-structural proteins (NS1 and NS2) and the second one codes for two structural proteins, VP1 and VP2. NS1 is responsible for viral replication and the induction of cell apoptosis, while the function of NS 2 is currently unknown.6 The main capsid protein, VP2, is a key molecule for determining host range, antigenic properties, and receptor binding. Therefore, it is very important to detect certain residues within VP2 to identify variants of CVP-2. During CPV-2 infection, VP3 is derived from the VP2 protein by host proteolytic cleavage, as is presented only on complete (DNA-containing) virions.7 The virus is genetically related to the feline panleukopenia virus.8

Canine parvovirus first emerged in the late 1970s.9 Three variants were detected, namely CPV-2a (426Asn), CPV-2b (426Asp), and CPV-2c (426Glu) on the basis of amino acid conformation on the capsid protein.8 These variants have completely replaced the original CPV-2. Currently the original CPV-2 is not found in dog population and is only present in vaccine formulations.10

Since its discovery in the 1970s, CPV-2 and its variants have been circulating rapidly in the dog population world-wide. Despite the development of vaccines that included its variants and the certain efficacy of the vaccine in preventing CPV-2 disease, high prevalence rates of CPV-2 were reported in previous studies carried out in various countries. Recently, the prevalence rates of CPV-2 in dogs have been detected to be 76.69% (158/206) in Japan,11 100% (59/59) in Vietnam,12 82.00% (33/40) in Pakistan,13 70.42% (50/71) in Colombia,14 and 55.70% (34/61) in China.15 In most of these studies, new variants of CPV-2 have been found. Therefore, the prevalence of CPV-2 and surveillance of circulating viruses needs to be re-evaluated. In this study, we aimed to determine the prevalence and antigenic variants of CPV enteritis in dogs from the west Mediterranean region of Türkiye. Using these data, material and moral losses caused by the virus will be prevented, and control programs can be planned and implemented accordingly.

Materials and Methods

DNA extraction and PCR amplification. Fecal samples were collected from 35 puppies of different breeds and sexes, aged one to twenty months, both vaccinated and nonvaccinated, brought to the Animal Hospital Clinics of Mehmet Akif Ersoy University, Faculty of Veterinary Medicine, Burdur. The Animal Care Committee of the University of Mehmet Akif Ersoy, Burdur, Türkiye, approved this study (Approval No. 93773921-555). Fecal samples were collected from dogs with clinical symptoms of gastroenteritis brought to the animal hospital from private veterinary clinics or clinics in the west Mediterranean region of Türkiye and the surrounding provinces: Burdur, Isparta, and Antalya. The samples were stored in a deep freezer at – 80.00 ˚C until DNA extraction. After the fecal samples were mixed and crushed at a ratio of 1:10 in 10x antibiotic phosphate-buffered saline (PBS), they were centrifuged at 3,000 rpm for 20 min. Viral DNA was extracted from the fecal samples using a virus nucleic acid isolation kit (GeneDireX, Taoyuan, Taiwan) following the manufacturer’s instructions. The DNA extraction products were stored at – 20.00 ˚C until used in PCR tests. The primer pairs Hfor/Hrev were used to amplify the sequences between 3556 to 4166 nucleotides, including discriminative sequential patterns of the capsid protein genes. For 630 bp fragment amplification PCR, 5.00 µL of Mg free Taq DNA polymerase buffer (Thermo Fisher Scientific, Waltham, USA), 2.00 µL of MgCl2 (25.00 mM) (Thermo Fisher Scientific), 7.00 µL of deoxynucleotide triphosphates (10x; 2.00 mM each) (Thermo Fisher Scientific), 10.00 pmol µL-1 of each primer Hfor CAGGTGATGAATTTGCTACA and Hrev CATTTGGATAAACTGGTGGT (Sentebiolab, Ankara, Türkiye) and 1.25 U of Taq DNA polymerase (Thermo Fisher Scientific) were used. The PCR method was as reported by Buonavoglia et al.16 The PCR analysis was performed with following steps; pre-denaturation for 5 min at 95.00 ˚C; 35 denaturation cycles were carried out for 1 min at 95.00 ˚C; annealing was carried out for 1 min at a suitable temperature for each primer pair; extension was carried out for 1 min at 72.00 ˚C; and the final extension was carried out for 10 min at 72.00 ˚C. PCR products were separated by electrophoresis on 1.00% agarose gels. The gels were photographed with a gel documentation system (DNR Bio Imaging Systems, Modi'in-Maccabim-Re'ut, Israel). There were 35 samples, of which the 15 samples with the best PCR results were sequenced (Fig. 1).

Fig. 1.

Fig. 1

Open in a new tab

Amplification products (Hfor and Hrev) of the isolates Lane 1: 1.00 kb DNA Marker; Lane 2: Isolate MZ545656; Lane 3: Isolate MZ545657; Lane 4: Isolate MZ545658; Lane 5: Isolate MZ-545659; Lane 6: Isolate MZ545660; Lane 7: Isolate MZ545661; Lane 8: Isolate MZ545662; Lane 9: Isolate MZ545663; Lane 10: Isolate MZ545664; Lane 11: Isolate MZ545665; Lane 12: Isolate MZ545666; Lane 13: Isolate MZ545667; Lane 14: Isolate MZ-545668; Lane 15: Isolate MZ545669; Lane 16: Isolate MZ545670; Lane 17: Positive control; Lane 18: Positive control

Purification of PCR products, DNA sequencing reactions, and phylogenetic analysis. Fifteen PCR products were purified using Exonuclease I (20.00 U µL-1; Thermo Fisher Scientific) and Shrimp Alkaline Phosphatase (Thermo Fisher Scientific). For DNA sequencing reactions, BigDye™ Terminator v3.1 Cycle Sequencing Kits (Thermo Fisher Scientific) were used. Finally, PCR products were analyzed using an ABI 3500 Genetic Analyzer (Applied Biosystems, Carlsbad, USA). Newly obtained sequences were edited by BioEdit version 7.2.5 (https://www.informer.com).17 Consensus sequences were created and searched in Gen-Bank® using BLAST program, to define the reference sequences included in the phylogenetic analysis. Nucleotide sequences and amino acid sequences of selected references were downloaded from GenBank® in FASTA format and aligned separately using CLUSTAL-W/ BioEdit version 7.2.5.17 The amino acid sequences of our strains, obtained from ExPASy translate tool (https://web.expasy.org/translate/), were used to examine the effects of mutations arising from amino acid changes. Finally, a phylogenetic tree was constructed was using the Maximum-Likelihood method with 1,000 boot-strap replications, in MEGA-X version 11.0.8 (https:// www.megasoftware.net ).18,19

Results

Twenty-eight out of 35 dogs (80.00%) were recorded as being PCR positive. Of them, three, aged 1 to 4 months, were vaccinated (Table 1). Based on CLUSTAL-W and ExPASy translate tool analysis, all strains were identified as new CPV-2b (Table 2), a result which was confirmed by a discriminative amino acid changes table, as described by Decaro and Buonavoglia (Table 3).8 The amino acid changes Val 232 to Ile, T 267 to A, Ser 297 to Ala, Ala 300 to Gly, Asp 305 to Tyr, Asp 323 to Asn, Tyr 324 to Ile, Asn 375 to Asp, Asn 426 to Asp, and Thr 440 to Ala were detected in 15 of the isolates (100%), and are listed in Table 2 for the isolates with the NCBI accession numbers MZ545656, MZ545657, MZ545658, MZ545659, MZ545660, MZ545661, MZ545662, MZ545663, MZ545664, MZ545665, MZ545666, MZ545667, MZ545668, MZ545669, and MZ545670. A synonymous mutation due to a single nucleotide change from A to G at amino acid position 318 between the nucleo-tides 3740 and 3742 changes the resulting amino acid CAA to CAG which encodes both glutamine or glutamic acid was reported for the first time in three of the isolates (20.00%), with NCBI accession numbers MZ545658, MZ54566, and MZ545670 (Table 2). Finally, a phylogenetic tree was constructed using the Maximum-Likelihood method of with 1,000 bootstrap replications in MEGA-X.18,19 Phylogenetic analysis showed that the CPV-2b genetic variants sequenced in this study were closely related to Mersin isolates, except for isolates 5 (MZ545658), 10 (MZ54566), and 15 (MZ545670), which had synonymous mutations and were located in a separate branch from those obtained in our study and those from Mersin/Urfa Province completed in Türkiye, previously (Fig. 2).

Table 1.

Identification of 15 samples sequenced

Sample ID No. Age (month) Sex Vaccination Genotype
1 MZ545656 2.00 Male - 2b
2 MZ545657 1.00 Female - 2b
3 MZ545658 1.50 Male - 2b
4 MZ545659 4.00 Male + 2b
5 MZ545660 1.00 Female - 2b
6 MZ545661 3.00 Male - 2b
7 MZ545662 2.00 Male - 2b
8 MZ545663 2.50 Male - 2b
9 MZ545664 3.00 Female - 2b
10 MZ545665 4.00 Female + 2b
11 MZ545666 1.00 Male + 2b
12 MZ545667 1.00 Female - 2b
13 MZ545668 2.00 Male - 2b
14 MZ545669 3.00 Female - 2b
15 MZ545670 4.00 Male + 2b
Open in a new tab

Table 2.

Effects of amino acid changes in the isolates

Amino acid positions 232 267 297 300 305 323 318 324 375 426 440
Nucleotide 3480-3482 3584-3586 3675-3677 3684-3686 3699-3701 3753-3755 3740 3756-3757 3909-3911 4062-4064 4105-4106
Amino acid changes GTA (Val)- ATA (Ile) TTT -TAT TCT (Ser)- GCT (Ala) GCT (Ala) - GGT (Gly) GAT (Asp) -TAT (Tyr) GAC (Asp)- AAC (Asn) CAA -CAG TAT (Tyr) - ATT (Ile) AAT (Asn)- GAT (Asp) AAT (Asn) - GAT (Asp) /GAA (Glu) ACA (Thr) - GCA (Ala)
MZ545656 ATA TAT GCT (Ala) GGT(Gly) TAT (Tyr) AAC (Asn) CAA ATT (Ile) GAT (Asp) GAT (Asp) GCA (Ala)
MZ545657 ATA TAT GCT (Ala) GGT(Gly) TAT (Tyr) AAC (Asn) CAA ATT (Ile) GAT (Asp) GAT (Asp) GCA (Ala)
MZ545658 ATA TAT GCT (Ala) GGT(Gly) TAT (Tyr) AAC (Asn) CAG ATT (Ile) GAT (Asp) GAT (Asp) GCA (Ala)
MZ545659 ATA TAT GCT (Ala) GGT(Gly) TAT (Tyr) AAC (Asn) CAA ATT (Ile) GAT (Asp) GAT (Asp) GCA (Ala)
MZ545660 ATA TAT GCT (Ala) GGT(Gly) TAT (Tyr) AAC (Asn) CAA ATT (Ile) GAT (Asp) GAT (Asp) GCA (Ala)
MZ545661 ATA TAT GCT (Ala) GGT(Gly) TAT (Tyr) AAC (Asn) CAG ATT (Ile) GAT (Asp) GAT (Asp) GCA (Ala)
MZ545662 ATA TAT GCT (Ala) GGT(Gly) TAT (Tyr) AAC (Asn) CAA ATT (Ile) GAT (Asp) GAT (Asp) GCA (Ala)
MZ545663 ATA TAT GCT (Ala) GGT(Gly) TAT (Tyr) AAC (Asn) CAA ATT (Ile) GAT (Asp) GAT (Asp) GCA (Ala)
MZ545664 ATA TAT GCT (Ala) GGT(Gly) TAT (Tyr) AAC (Asn) CAA ATT (Ile) GAT (Asp) GAT (Asp) GCA (Ala)
MZ545665 ATA TAT GCT (Ala) GGT(Gly) TAT (Tyr) AAC (Asn) CAA ATT (Ile) GAT (Asp) GAT (Asp) GCA (Ala)
MZ545666 ATA TAT GCT (Ala) GGT(Gly) TAT (Tyr) AAC (Asn) CAA ATT (Ile) GAT (Asp) GAT (Asp) GCA (Ala)
MZ545667 ATA TAT GCT (Ala) GGT(Gly) TAT (Tyr) AAC (Asn) CAA ATT (Ile) GAT (Asp) GAT (Asp) GCA (Ala)
MZ545668 ATA TAT GCT (Ala) GGT(Gly) TAT (Tyr) AAC (Asn) CAA ATT (Ile) GAT (Asp) GAT (Asp) GCA (Ala)
MZ545669 ATA TAT GCT (Ala) GGT(Gly) TAT (Tyr) AAC (Asn) CAA ATT (Ile) GAT (Asp) GAT (Asp) GCA (Ala)
MZ545670 ATA TAT GCT (Ala) GGT(Gly) TAT (Tyr) AAC (Asn) CAG ATT (Ile) GAT (Asp) GAT (Asp) GCA (Ala)
MZ545671 ATA TTT TCT (Ser) GCT (Ala) GAT (Asp) GAC AAT (Asn) TAT (Tyr) GAT (Asp) AAT (Asn) ACA (Thr)
Open in a new tab

Table 3.

Amino acid changes in FPV and CPV variantsa

Aminoacid residue 80 87 93 101 b 103 232 297 300 305 323 375 426 c 555 564 568
Nucleotide position 3024-3026 3045-3047 3063-3065 3087-3089 3093-3095 3480-3482 3675-3677 3684-3686 3699-3701 3753-3755 3909-3911 4062-4064 4449-4451 4476-4478 4488-4490
Aminoacid changes AAA(Lys)AGA(Arg) ATG(met)TTG(Leu) AAA(Lys)AAC(Asn)AAT(Asn) ATT(Ile)ACT(Thr) GUA(Val)GCA(Ala) GTA(Val)ATA(Ile) TCT(Ser)GCT(Ala) GCT(Ala)GGT(Gly) GAT(Asp)TAT(Tyr) GAC(Asp)AAC(Asn) AAT(Asn)GAT(Asp) AAT(Asn)GAT(Asp)GAA(Glu) GTA(Val)ATA(Ile) AAT(Asn)AGT(Ser) GCT(Ala)GGT(Gly)
FPV Lys Met Lys Ile Val Val Ser Ala Asp Asp Asp Asn Val Asn Ala
CPV-2 Arg Met Asn Ile Ala Ile Ser Ala Asp Asn Asn Asn Val Ser Gly
CPV-2a Arg Leu Asn Thr Ala Ile Ser Gly Tyr Asn Asp Asn Ile Ser Gly
CPV-2B Arg Leu Asn Thr Ala Ile Ser Gly Tyr Asn Asp Asp Val Ser Gly
New CPV-2a Arg Leu Asn Thr Ala Ile Ala Gly Tyr Asn Asp Asn Val Ser Gly
New CPV-2b Arg Leu Asn Thr Ala Ile Ala Gly Tyr Asn Asp Asp Val Ser Gly
Asp-300 (2a/2b) Arg Leu Asn Thr Ala Ile Ala Asp Tyr Asn Asp Asn(2a)Asp(2b) Val Ser Gly
CPV-2c Arg Leu Asn Thr Ala Ile Ala Gly Tyr Asn Asp Glu Val Ser Gly
Open in a new tab

a Positions are referred to the amino acid and nucleotide sequences of strain CPV-b (accession no. M38245).

b Codon affected by SNPs used to design type-specific probes differentiating CPV-2 from CPV-2a/2b/2c.

c Codon affected by SNPs used to design type-specific probes differentiating CPV-2a from CPV-2b and CPV-2b from CPV-2c.

Fig. 2.

Fig. 2

Open in a new tab

Phylogenetic tree of the 15 canine parvovirus (CPV2) strains in our study based on 615-bp-long portion of the CPV2 sequence. MEGA-X 11.0.8 was used to construct a Maximum-Likelihood tree and the reliability of the tree was assessed by 1,000 bootstrap replications. The sequences were from our isolates (MZ545656, MZ545657, MZ545658, MZ545659, MZ545660, MZ545661, MZ5-45662, MZ545663, MZ545664, MZ545665, MZ545666, MZ5456-67, MZ545668, MZ545669, and MZ545670), reference sequences from Türkiye (KF373611, KF385387, KF500484, KF500488, KF50-0489, KF500490, KF500498, KF500501, KF500504, KF500506, KF500507, KF500508, KM262060, KM267070, MG780278, MG7-80279, MG780280, MG780281, MG780283, MG780285, KF500492, MG780275, MG780286, MG780287, MG780290, MG780291, MG-780292, MG780277, and MG780288) and reference sequences from various other parts of the world (DQ182623, AY742934, AB054224, KF373599, KM262066, KM262082, EU659121, JX41-1926, FJ005260, EF599097, FJ869135, EU009206, FJ222822, JN625223, JN867605, KM262062, AF306447, FJ869134, FJ005252, GU362934, EF599096, AY742935, DQ340434, AB054215, AY7-42938, DQ340409, KM262076, M38246, D78585, JF280912, JF280911, EU018144, GU212791, FJ197847, GU212792, FJ011-098, FJ011097, EU498680, and EU498681)

Discussion

Epidemiological studies carried out worldwide have provided information about the distribution of three anti genic variants of CPV in the dog population over the past 20 years. These studies found that the original CPV-2 has disappeared in the dog population, and there is no difference among the antigenic variants in terms of patho-genicity.20 There have been a limited number of molecular studies conducted into the distribution of CPV-2 antigenic variants in dogs during the last 20 years in Türkiye.

The CPV-2a was reported to have a significantly higher prevalence than CPV-2b in Türkiye.21-23 This is the third CPV molecular characterization study published from Turkiye. The isolates in this study were collected from the west Mediterranean region of Türkiye, and the sequencing results were compared to those of strains isolated from Türkiye and worldwide. In order to estimate the viral phylogenetic relationships, a phylogenetic tree was constructed using partial CVP-2 gene sequences. All 15 isolates sequenced in this study were new CPV-2b while the most common variant was reported as type 2a in previous studies from Türkiye.21-23 The CPV-2b variant has lower prevalence than CPV-2a and CPV-2c in Europe.24 However, studies from Italy and Australia indicated that CPV-2b has emerged again in recent years, after a long hiatus.24,25 Battilani et al. found that CPV-2b was more genetically stable than CPV-2a, as its sequence analysis showed the highest fraction of non-synonymous mutations, highlighting the significant pheno-typic effects of the accumulated mutations over time.24 An increased prevalence of CPV-2b was also reported in our study from the west Mediterranean region.26 These findings indicate that CPV-2b is evolving rapidly. The CPV-2 antigenic variants should therefore be regularly monitored using molecular surveillance to prevent new CPV-2b-induced outbreaks in the dog population in Türkiye.

All of the 15 isolates subjected to sequencing analysis were identical, with V232I, T267A, S297A, A300G, D305Y, D323N, Y324I, N375D, N426D, and Y440A amino acid mutations. Only three of the isolates, MZ545658, MZ54566, and MZ545670, had previously unreported synonymous mutations due to single nucleotide changes from A to G at amino acid position 318 between nucleotides 3740 and 3742, resulting in an amino acid change from CAA to CAG, which encodes both glutamine and glutamic acid. This amino acid change detected in this study may have induced subgroup formation (Fig. 2) and the emergence of the new CPV-2b variants. Additional studies should be carried out to understand whether this amino acid change affects the pathogenicity of this virus.

Amino acid substitutions located in the greatest variable GH loop comprising aa 267-498 of the VP2 protein have been reported.27-29 Similarly, amino acid changes at residues T267A, S297A, A300G, D305Y, D323N, Y324I, N375D, N426D, and Y440A were also detected in our study. It has been suggested in previous studies that amino acid changes in residue 267 are important for the transmission and infectivity of the virus, and changes in amino acid residue 323 are responsible for binding to the canine transferrin receptor, affecting the circulation of the virus among different hosts.30-33 In this study, as in previous studies from China, India, Korea, Japan, and Türkiye, a common mutation in residue Y324I was also detected, and this residue may play a role in CPV host range.26,34-36 As also reported by Mittal et al., these mutations may lead to the emergence of new CPV-2b variants, and reduce the efficacy of vaccines used in west Mediterranean provinces.37 Due to the continuing evolution of CPV- 2, RFLP is needed for the detection of shorter mutations on the capsid protein of CPV-2 in samples isolated recently.21,27,38,39 To detect the antigenic differences in vaccine strain isolates, the three isolates obtained from vaccinated dogs in this study will be subjected to RFLP analysis in future studies. The presence of parvovirus infection in vaccinated dogs has been reported in many of previous studies.24,25,37,40-43 The main cause of vaccination failure has been demonstrated to be due to the interfering role of maternal antibodies, especially in puppies.44 However, due to the ongoing evolution of the virus and the detection of the new variants currently circulating in the canine population all around the world, the efficacy of vaccines used against to CPV infection is questioned,.11,45,46 It has also been found that the pre-exposure to CPV-2 prior to vaccination could be a factor contributing to the occurrence of parvovirus infection in puppies.24 In the present study, CPV infection was detected in three vaccinated puppies of one to four months of age, with the new 2b variant with synonymous mutations (Table 1). The strains of canine parvovirus obtained from dogs in present study constituted a completely different branch in the phylogenetic tree than the vaccine strains (Fig. 2). Additional studies are needed to completely understand the antigenic differences between vaccine and field strains. Different strategies have been proposed to overcome vaccination failure caused by maternal derived antibody interference such as high-titer vaccines47 and intranasal vaccination.48 It is also necessary to conduct further vaccine development studies on this topic.

In the present study, sequence comparison showed 100% nucleotide identities among our CVP positive isolates, which had V232I, T267A, S297A, A300G, D305Y, D323N, Y324I, N375D, N426D, and Y440A amino acid mutations. These results indicated that a new CPV-2b variant is prevalent in the west Mediterranean region of Türkiye. Three of the isolates had previously unreported synonymous mutations, resulting in subgroup formation in a phylogenetic tree for CPV-2b, constructed using data from our study and reference strains selected from Türkiye. These results suggest that further studies are needed to understand the possible effects of these specific mutations on the pathogenicity of CPV-2. In order to prevent CPV-2b outbreaks in the west Mediterranean region of Türkiye, vaccines should be updated in response to the new variants currently circulating in the canine population, and molecular surveillance studies should be performed regularly to monitor the emergence and spread of the new CPV-2 variants.

Conflict of interest

There is no conflict of interest.

Acknowledgments

I would like to thank the veterinary clinics involved in the sampling and Aquatayf Biyoteknoloji Laboratories, İstanbul, Türkiye, for conducting the DNA sequencing reactions and phylogenetic analysis.

References

  • 1.Gargari S. The detection and molecular characterization of canine parvovirus type-2 in dogs with gastroenteritis symptoms [Turkish]. PhD Thesis. Ankara, Turkey: Ankara University Health Sciences Institution; 2015. [Google Scholar]
  • 2.Khatri R, Poonam , Mohan H, et al. Epidemiology, pathogenesis, diagnosis and treatment of canine parvovirus disease in dogs: a mini review. J Vet Sci Med Diagn. 2017;6:3 . doi: 10.4172/2325-9590.1000233. [Google Scholar]
  • 3.Nandi S, Sharma GK, Gupta V, et al. Global scenario of canine parvovirus mutants: epidemiology, diagnostics and immunoprophylactic agents. JSM Vet Med Res. 2019;2 [Google Scholar]
  • 4.Dei Giudici S, Cubeddu T, Giagu A, et al. First molecular characterization of canine parvovirus strains in Sardinia, Italy. Arch Virol. 2017;(11):3481–3486. doi: 10.1007/s00705-017-3457-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Reed AP, Jones EV, Miller TJ. Nucleotide sequence and genome organization of canine parvovirus. J Virol. 1988;(1):266–276. doi: 10.1128/jvi.62.1.266-276.1988. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Gupta SK, Sahoo AP, Rosh N, et al. Canine parvovirus NS1 induced apoptosis involves mitochondria, accumulation of reactive oxygen species and activation of caspases. Virus Res. 2016;213:46–61. doi: 10.1016/j.virusres.2015.10.019. [DOI] [PubMed] [Google Scholar]
  • 7.Simpson AA, Chandrasekar V, Hébert B, et al. Host range and variability of calcium binding by surface loops in the capsids of canine and feline parvoviruses. J Mol Biol. 2000;(3):597–610. doi: 10.1006/jmbi.2000.3868. [DOI] [PubMed] [Google Scholar]
  • 8.Decaro N, Buonavoglia C. Canine parvovirus--a review of epidemiological and diagnostic aspects, with emphasis on type 2c. Vet Microbiol. 2012;(1):1–12. doi: 10.1016/j.vetmic.2011.09.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Appel MJ, Scott FW, Carmichael LE. Isolation and immunization studies of a canine parco-like virus from dogs with haemorrhagic enteritis. Vet Rec. 1979;(8):156–159. doi: 10.1136/vr.105.8.156. [DOI] [PubMed] [Google Scholar]
  • 10.Decaro N, Elia G, Desario C, et al. A minor groove binder probe real-time PCR assay for discrimination between type 2-based vaccines and field strains of canine parvovirus. J Virol Methods. 2006;(1-2):65–70. doi: 10.1016/j.jviromet.2006.03.030. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Takano T, Hamaguchi S, Hasegawa N, et al. Predominance of canine parvovirus 2b in Japan: an epidemiological study during 2014-2019. Arch Virol. 2021;(11):3151–3156. doi: 10.1007/s00705-021-05200-0. [DOI] [PubMed] [Google Scholar]
  • 12.Nguyen Manh T, Piewbang C, Rungsipipat A, et al. Molecular and phylogenetic analysis of Vietnamese canine parvovirus 2c originated from dogs reveals a new Asia-IV clade. Transbound Emerg Dis. 2021;(3):1445–1453. doi: 10.1111/tbed.13811. [DOI] [PubMed] [Google Scholar]
  • 13.Ahmed N, Riaz A, Zubair Z, et al. Molecular analysis of partial VP-2 gene amplified from rectal swab samples of diarrheic dogs in Pakistan confirms the circulation of canine parvovirus genetic variant CPV-2a and detects sequences of feline panleukopenia virus (FPV) Virol J. 2018;(1):45 . doi: 10.1186/s12985-018-0958-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Duque-García Y, Echeverri-Zuluaga M, Trejos-Suarez J, et al. Prevalence and molecular epidemiology of Canine parvovirus 2 in diarrheic dogs in Colombia, South America: A possible new CPV- 2a is emerging? Vet Microbiol. 2017;201:56–61. doi: 10.1016/j.vetmic.2016.12.039. [DOI] [PubMed] [Google Scholar]
  • 15.Hao X, He Y, Wang C, et al. The increasing prevalence of CPV-2c in domestic dogs in China. PeerJ. 2020;8 doi: 10.7717/peerj.9869. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Buonavoglia C, Martella V, Pratelli A, et al. Evidence for evolution of canine parvovirus type 2 in Italy. J Gen Virol. 2001;(Pt 12):3021–3025. doi: 10.1099/0022-1317-82-12-3021. [DOI] [PubMed] [Google Scholar]
  • 17.Thompson JD, Higgins DG, Gibson TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994;(22):4673–4680. doi: 10.1093/nar/22.22.4673. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Rossi RJ. Mathematical statistics: an introduction to likelihood based inference. John New York, USA: Wiley & Sons. 2018:223–239. [Google Scholar]
  • 19.Tamura K, Stecher G, Kumar S. MEGA11: molecular evolutionary genetics analysis version 11. Mol Biol Evol. 2021;(7):3022–3027. doi: 10.1093/molbev/msab120. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Moon HS, Lee SA, Lee SG, et al. Comparison of the pathogenicity in three different Korean canine parvovirus 2 (CPV-2) isolates. Vet Microbiol. 2008;(1-2):47–56. doi: 10.1016/j.vetmic.2008.02.016. [DOI] [PubMed] [Google Scholar]
  • 21.Timurkan M, Oğuzoğlu T. Molecular characterization of canine parvovirus (CPV) infection in dogs in Turkey. Vet Ital. 2015;(1):39–44. doi: 10.12834/VetIt.263.908.3. [DOI] [PubMed] [Google Scholar]
  • 22.Yeşilbağ K, Yilmaz Z, Ozkul A, et al. Aetiological role of viruses in puppies with diarrhea. Vet Rec. 2007;(5):169–170. doi: 10.1136/vr.161.5.169. [DOI] [PubMed] [Google Scholar]
  • 23.Yilmaz Z, Pratelli A, Torun S. Distribution of antigen types of canine parvovirus type 2 in dogs with hemorrhagic enteritis in Turkey. Turk J Vet Anim Sci. 2005;29:1073–1076. [Google Scholar]
  • 24.Battilani M, Modugno F, Mira F, et al. Molecular epidemiology of canine parvovirus type 2 in Italy from 1994 to 2017: recurrence of the CPV-2b variant. BMC Vet Res. 2019;(1):393 . doi: 10.1186/s12917-019-2096-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Kwan E, Carrai M, Lanave G, et al. Analysis of canine parvoviruses circulating in Australia reveals predominance of variant 2b and identifies feline parvovirus-like mutations in the capsid proteins. Transbound Emerg Dis. 2021;(2):656–666. doi: 10.1111/tbed.13727. [DOI] [PubMed] [Google Scholar]
  • 26.Dinçer E. Molecular characterization and phylogenetic analysis of canine parvovirus 2 in Dogs, Mersin Province, Turkey. Etlik Vet Mikrobiyol Derg. 2017;(2):96–100. [Google Scholar]
  • 27.Battilani M, Ciulli S, Tisato E, et al. Genetic analysis of canine parvovirus isolates (CPV-2) from dogs in Italy. Virus Res. 2002;(1-2):149–157. doi: 10.1016/s0168-1702(01)00431-2. [DOI] [PubMed] [Google Scholar]
  • 28.Gallo Calderón M, Wilda M, Boado L, et al. Study of canine parvovirus evolution: comparative analysis of full-length VP2 gene sequences from Argentina and inter-national field strains. Virus Genes. 2012;(1):32–39. doi: 10.1007/s11262-011-0659-8. [DOI] [PubMed] [Google Scholar]
  • 29.Truyen U. Evolution of canine parvovirus- -a need for new vaccines? Vet Microbiol. 2006;(1):9–13. doi: 10.1016/j.vetmic.2006.04.003. [DOI] [PubMed] [Google Scholar]
  • 30.Agbandje M, Parrish CR, Rossmann MG. The structure of parvoviruses. Semin Virol. 1995;(5):299–309. [Google Scholar]
  • 31.Hueffer K, Parrish CR. Parvovirus host range, cell tropism and evolution. Curr Opin Microbiol. 2003;(4):392–398. doi: 10.1016/s1369-5274(03)00083-3. [DOI] [PubMed] [Google Scholar]
  • 32.Pérez R, Bianchi P, Calleros L, et al. Recent spreading of a divergent canine parvovirus type 2a (CPV-2a) strain in a CPV-2c homogenous population. Vet Microbiol. 2012;(2-4):214–219. doi: 10.1016/j.vetmic.2011.09.017. [DOI] [PubMed] [Google Scholar]
  • 33.Xu J, Guo HC, Wei YQ, et al. Phylogenetic analysis of canine parvovirus isolates from Sichuan and Gansu provinces of China in 2011. Transbound Emerg Dis. 2015;(1):91–95. doi: 10.1111/tbed.12078. [DOI] [PubMed] [Google Scholar]
  • 34.Jeoung SY, Ahn SJ, Kim D. Genetic analysis of VP2 gene canine parvovirus isolates in Korea. J Vet Med Sci. 2008;(7):719–722. doi: 10.1292/jvms.70.719. [DOI] [PubMed] [Google Scholar]
  • 35.Mukhopadhyay HK, Matta SL, Amsaveni S, et al. Phylogenetic analysis of canine parvovirus partial VP2 gene in India. Virus Genes. 2014;(1):89–95. doi: 10.1007/s11262-013-1000-5. [DOI] [PubMed] [Google Scholar]
  • 36.Soma T, Taharaguchi S, Ohinata T, et al. Analysis of VP2 protein gene of canine parvovirus strains from affected dogs in Japan. Res Vet Sci. 2013;(2):368–371. doi: 10.1016/j.rvsc.2012.09.013. [DOI] [PubMed] [Google Scholar]
  • 37.Mittal M, Chakravarti S, Mohapatra JK, et al. Molecular typing of canine parvovirus strains circulating from 2008 to 2012 in an organized kennel in India reveals the possibility of vaccination failure. Infect Genet Evol. 2014;23:1–6. doi: 10.1016/j.meegid.2014.01.015. [DOI] [PubMed] [Google Scholar]
  • 38.Chen B, Zhang X, Zhu J, et al. Molecular epidemiological survey of canine parvovirus circulating in China from 2014 to 2019. Pathogens. 2021;(5) doi: 10.3390/pathogens10050588. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Polat PF, Şahan A, Aksoy G, et al. Molecular and restriction fragment length polymorphism analysis of canine parvovirus 2 (CPV-2) in dogs in southeast Anatolia, Turkey. Onderstepoort J Vet Res. 2019;(1):e1–e8. doi: 10.4102/ojvr.v86i1.1734. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Kapil S, Cooper E, Lamm C, et al. Canine parvovirus types 2c and 2b circulating in North American dogs in 2006 and 2007. J Clin Microbiol. 2007;(12):4044–4047. doi: 10.1128/JCM.01300-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Decaro N, Cirone F, Desario C, et al. Severe parvovirus in a 12-year old dog that had been repeatedly vaccinated. Vet Rec. 2009;(19):593. doi: 10.1136/vr.164.19.593. [DOI] [PubMed] [Google Scholar]
  • 42.Decaro N, Desario C, Parisi A et al. Genetic analysis of canine parvovirus type 2c. Virology. 2009;(1):5–10. doi: 10.1016/j.virol.2008.12.016. [DOI] [PubMed] [Google Scholar]
  • 43.Decaro N, Desario C, Elia G, et al. Evidence for immunisation failure in vaccinated adult dogs infected with canine parvovirus type 2c. New Microbiol. 2008;(1):125–130. [PubMed] [Google Scholar]
  • 44.Decaro N, Buonavoglia C, Barrs VR. Canine parvovirus vaccination and immunisation failures: Are we far from disease eradication? Vet Microbiol. 2020;247:108760. doi: 10.1016/j.vetmic.2020.108760. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Ghajari M, Pourtaghi H, Lotfi M. Phylogenetic analysis of canine parvovirus 2 subtypes from diarrheic dogs in Iran. Iran J Vet Res. 2021;(4):347–351. doi: 10.22099/IJVR.2021.40878.5925. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Galvis CC, Jimenez-Villegas T, Reyes Romero DP, et al. Molecular diversity of the VP2 of Carnivore proto-parvovirus 1 (CPV-2) of fecal samples from Bogotá. J Vet Sci. 2022;(1):e14. doi: 10.4142/jvs.21181. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Burtonboy S, Charlier P, Hertoghs J, et al. Performance of high titre attenuated canine parvovirus vaccine in pups with maternally derived antibody. Vet Rec. 1991;(16):377–381. doi: 10.1136/vr.128.16.377. [DOI] [PubMed] [Google Scholar]
  • 48.Martella V, Cavalli A, Decaro N, et al. Immunogenicity of an intranasally administered modified live canine parvovirus type 2b vaccine in pups with maternally derived antibodies. Clin Diagn Lab Immunol. 2005;(10):1243–1245. doi: 10.1128/CDLI.12.10.1243-1245.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Veterinary Research Forum are provided here courtesy of Faculty of Veterinary Medicine, Urmia University, Urmia, Iran

RESOURCES