Skip to main content
STAR Protocols logoLink to STAR Protocols
. 2023 Mar 29;4(2):102196. doi: 10.1016/j.xpro.2023.102196

Protocol to identify the core gene supported by an essential gene in E. coli bacteria using a genome-wide suppressor screen

Isao Masuda 1,2,, Ya-Ming Hou 1,3,∗∗
PMCID: PMC10074243  PMID: 36995932

Summary

We describe here a genome-wide screening approach to identify the most critical core reaction among a network of many that are supported by an essential gene to establish cell viability. We describe steps for maintenance plasmid construction, knockout cell construction, and phenotype validation. We then detail isolation of suppressors, whole-genome sequencing analysis, and reconstruction of CRISPR mutants. We focus on E. coli trmD, which encodes an essential methyl transferase that synthesizes m1G37 on the 3′-side of the tRNA anticodon.

For complete details on the use and execution of this protocol, please refer to Masuda et al. (2022).1

Subject areas: Genetics, Genomics, Sequencing, Microbiology, Molecular Biology, Gene Expression, CRISPR

Graphical abstract

graphic file with name fx1.jpg

Highlights

  • Removing the essential gene while maintaining a temporary state of cell viability

  • Maintaining the temporary cell viability by expressing the gene in a temperature control

  • High-temperature inactivation of the gene allows genome-wide screening of suppressors

  • Mapping suppressor mutations identifies the core gene at the limit of cell viability


Publisher’s note: Undertaking any experimental protocol requires adherence to local institutional guidelines for laboratory safety and ethics.


We describe here a genome-wide screening approach to identify the most critical core reaction among a network of many that are supported by an essential gene to establish cell viability. We describe steps for maintenance plasmid construction, knockout cell construction, and phenotype validation. We then detail isolation of suppressors, whole-genome sequencing analysis, and reconstruction of CRISPR mutants. We focus on E. coli trmD, which encodes an essential methyl transferase that synthesizes m1G37 on the 3′-side of the tRNA anticodon.

Before you begin

This protocol provides a method to identify the most critical core gene of an essential gene that establishes the limit of cell viability. The key element of this protocol is a genome-wide screen for suppressors that would restore cell viability upon loss of an essential gene. Mapping suppressor mutations would then allow the identification of the core gene that must undergo mutations to compensate for the loss of cell viability due to loss of the essential gene. The key strategy of this approach is to create a knockout (KO) cell state where the essential gene of interest, and its associated gene products, are completely lost to provide a platform for screening of suppressor mutations. However, because each essential gene is required for cell viability, a simple KO cannot be made. The innovation of this protocol is the creation of a maintenance plasmid that expresses the essential gene of interest under a controllable promoter while harboring a temperature-sensitive (ts) origin of replication in a genomic background that has removed the essential gene. In bacteria such as E. coli, at the permissive temperature of 30°C, the maintenance plasmid continues to replicate, whereas at the non-permissive temperature 43°C, the maintenance plasmid is gradually eradicated over several cycles of growth and dilution. Thus, in the absence of the inducer that turns on expression of the plasmid-borne essential gene, and over several cycles of growth and dilution at the non-permissive temperature, the KO strain is progressively depleted of the essential gene and the associated products, eventually reaching the non-viable cell state. It is this non-viable cell state that sets the stage of a genome-wide screen for suppressor mutations.

Here we use the essential gene E. coli trmD (Ec trmD) as an example to describe the step-by-step protocol. Ec trmD encodes an essential tRNA methyl transferase that synthesizes m1G37 on the 3′-side of the tRNA anticodon.2 We have shown that the cell biology of Ec trmD is complex, playing an essential role throughout the entire elongation cycle of protein synthesis and making interactions with many components of the ribosomal machinery.3,4,5,6 This complexity makes it difficult to predict which gene is the core gene supported by Ec trmD. Using the protocol described here, we show that all suppressor mutations that restore cell viability upon loss of Ec trmD are mapped to the single gene – proS encoding the enzyme prolyl-tRNA synthetase.1 This leads to the notion that proS is the core gene supported by Ec trmD in a genome-wide approach to establish the limit of cell viability. The discovery of the relationship between proS and Ec trmD has provided important new insights into the inter-dependence between tRNA aminoacylation and tRNA epigenomic methylation.

We choose to use pKD46 as the maintenance plasmid,7 which has two desirable features (Figure 1). In one, it contains an arabinose (Ara)-regulatable promoter PBAD for expression of the gene of interest Ec trmD. In two, it has a ts origin of replication pSC101 ori and the replicase RepA 101, such that it can be replicated at the permissive temperature 30°C but eradicated at the non-permissive temperature 43°C. Thus, in a culturing condition at 43°C but lacking Ara, an Ec trmD-KO strain over several cycles of growth and dilution could be depleted of the pre-existing TrmD enzyme and the methylated m1G37-tRNA to generate a non-viable state. Once this non-viable state is reached, it can be used for screening of suppressors.

Figure 1.

Figure 1

An overall scheme of constructing a ts trmD-KO strain for suppressor screen

(A) To construct a ts trmD-KO strain. Starting from the WT MG1655 strain, introduce the pKD46-derived ts plasmid expressing Ec trmD (pKD46-Ec trmD). The resultant strain is the recipient for generating the trmD-KO strain by λ Red recombination to replace the genomic trmD with the Kan marker to be generated in (B).

(B) To construct a λ Red-compatible strain for trmD-KO. Starting from the WT MG1655 strain, introduce the pKD46 λ Red plasmid and a pACYC-derived maintenance plasmid that expresses Ec trmD (pACYC-Ec trmD) and is compatible with the λ Red plasmid. Through λ Red recombination, the genomic Ec trmD is replaced with the Kan marker, while cell viability is maintained by the pACYC-Ec trmD plasmid. This strain is used as the donor to introduce the Kan marker to a separate strain that expresses pKD46-Ec trmD plasmid to be constructed in (A). The red symbol ∗ marks the introduced genetic element.

Key resources table

REAGENT or RESOURCE SOURCE IDENTIFIER
Bacterial and virus strains

E. coli strain MG1655, a sub-strain of K12 ATCC Cat. #700926
Bacteriophage P1vir The Coli Genetic Stock Center (CGSC) CGSC #12133

Chemicals, peptides, and recombinant proteins

Phusion High-Fidelity (HF) DNA Polymerase Thermo Fisher Cat. #F530
NdeI New England Biolabs Cat. #R0111
PstI New England Biolabs Cat. #R0140
XhoI New England Biolabs Cat. #R0146
DpnI New England Biolabs Cat. #R0176
Shrimp alkaline phosphatase (rSAP) New England Biolabs Cat. #M0371
L-(+)-Arabinose Gold Biotechnology Cat. #A-300
T4 DNA ligase New England Biolabs Cat. #M0202
T4 polynucleotide kinase New England Biolabs Cat. #M0201
Ampicillin Fisher Scientific Cat. #BP1760
Chloramphenicol Gold Biotechnology Cat. #G-105
Kanamycin Gemini Bio Products Cat. #400-114P
Spectinomycin Gold Biotechnology Cat. #S-140
Anhydrous tetracycline hydrochloride Cayman Chemicals Cat. #10009542

Critical commercial assays

FastGene Optima HotStart ReadyMix Bulldog Bio Cat. #LS29

Experimental models: Organisms/strains

E. coli strain MG1655, a sub-strain of K12 ATCC Cat. #700926

Oligonucleotides

Oligo DNAs shown in each step Integrated DNA Technologies N/A

Recombinant DNA

pKD46 CGSC CGSC #7634
pKD46-Ec trmD Masuda et al.1 N/A
pACYCDuet-1 Millipore Cat. #71147
pACYC-Ec trmD Gamper et al.5 N/A
pKD4 CGSC CGSC #7632
pCP20 CGSC CGSC #7629
pCas9cr4 Addgene Cat #62655
pKDsgRNA-ack (as a PCR template) Addgene Cat #62654
pKDsgRNA-proSD98N Masuda et al.1 N/A
pKDsgRNA-p15a Addgene Cat #62656

Other

NucleoSpin Gel and PCR Clean-up Macherey-Nagel Cat. #740609
MicroPulser Electroporator Bio-Rad Cat. #1652100
PureLink Genomic DNA Mini Kit Invitrogen Cat. # K182001
Nextera XT DNA Library Preparation Kit Illumina Cat. #FC-131-1024
Wizard Plus SV Minipreps DNA Purification Systems Promega Cat. #A1460

Step-by-step method details

Construction of a temperature-sensitive (ts) maintenance plasmid for E. coli trmD (Ec trmD)

Inline graphicTiming: 1 week

Experiments described in this protocol are to perform in a BSL2 facility and to conform to the relevant regulatory standards. Users should acquire permissions from the relevant institutions. The section below describes the construction of a ts maintenance plasmid for expression of the essential gene of interest, which is Ec trmD here.

We describe steps for construction of a pKD46-derived maintenance plasmid for Ec trmD with a ts origin of replication (Figure 2A). Troubleshooting 1.

Note: The procedure shown here (Figure 2) is generalized for the public and is not completely identical to the published procedure.1

  • 1.
    Design primers.
    Note: Three pairs of primers are required: one is to amplify the Ec trmD gene, the second is to amplify the pKD46 plasmid, and the third is to amplify the cloning region by colony-PCR and to confirm the presence of the gene by sequencing.
    Note: Determine dimerization potential and secondary structure formation using webtool available, such as http://www.oligoevaluator.com/ provided by SIGMA-ALDRICH.
    • a.
      To amplify the Ec trmD gene (768 bp), design the forward (F) and reverse (R) primers to contain an NdeI restriction site (CATATG, underlined) and an XhoI restriction site (CTCGAG, underlined) at the 5′- and 3′ end of the ORF, respectively, with terminal extensions for enzyme digestion.
      Ec trmD F:
      5′-TGGCACCATATGTGGATTGGCATAATTAGCCTG-3′.
      Ec trmD R:
      5′-TTCAGACTCGAGTTACGCCATCCCATCATGTTTATG-3′.
      Note: The initiation AUG codon is nested within the NdeI restriction site, and the termination codon precedes the XhoI restriction site. These primers are specific to each gene.
    • b.
      To amplify the pKD46 plasmid backbone, design the outward primers to contain an NdeI restriction site and an XhoI restriction site (underlined) at the termini for ligation with Ec trmD, with terminal extensions for enzyme digestion.
      pKD46 F:
      5′-TGTCAACTCGAGAATGGCGATGACGCATCCTCAC-3′.
      pKD46 R:
      5′-TGGCACCATATGTTATAACCTCCTTAGAGCTCG-3′.
    • c.
      To confirm the inserted sequence into the pKD46 plasmid backbone by colony-PCR, design the inward primers to anneal to the external sites relative to the cloning region of pKD46.
      pKD46 check F:
      5′-CATATTGCATCAGACATTGCCG-3′.
      pKD46 check R:
      5′-CTATGTGCCATCTCGATACTCG-3′.
  • 2.
    PCR amplification.
    Note: Using the Phusion HF DNA polymerase (ThermoFisher, #F530), perform two separate PCR reactions: 1) amplification of the Ec trmD gene from E. coli genome with primers Ec trmD F and R, and 2) amplification of the pKD46 plasmid backbone from the intact pKD46 DNA with primers pKD46 F and R.
    • a.
      Run PCR using the following conditions.
      PCR setup
      Reagent for Ec trmD Reagent for pKD46 Final concentration Amount
      E. coli genomic DNA (100 ng/μL) pKD46 (50 ng/μL) 4 or 2 ng/μL 1 μL
      Primer Ec trmD F (10 μM) Primer pKD46 F (10 μM) 200 nM 0.5 μL
      Primer Ec trmD R (10 μM) Primer pKD46 R (10 μM) 200 nM 0.5 μL
      dNTPs (10 mM each) Same as left 250 μM each 0.625 μL
      5× Phusion Buffer Same as left 5.0 μL
      Phusion HF DNA Polymerase (ThermoFisher, #F530) Same as left 0.04 U/μL 0.5 μL
      ddH2O Same as left N/A 16.9 μL
      Total 25.0 μL N/A N/A
      Thermal cycling condition
      Steps Temperature Time Cycles
      Initial denaturation 94°C 4 min 1
      Denaturation 94°C 25 s 30 cycles
      Annealing 50°C 25 s
      Extension 72°C 1 min for Ec trmD
      5 min for pKD46
      Final extension 72°C 7 min 1
      Hold 4°C Forever
    • b.
      Analyze the PCR product by a 1.0% agarose gel. A single and distinct 0.8 kb band corresponding to the gene should be observed for Ec trmD. The size of the pKD46 plasmid backbone should be 4.5 kb.
    • c.
      Use a commercial kit (e.g., NucleoSpin Gel and PCR Clean-up from Macherey-Nagel, #740609) to purify each PCR product by elution in 25 μL sterilized water. Measure OD260 and determine the DNA concentration of each.
  • 3.
    Cloning.
    • a.
      Set up reactions as follows for restriction enzyme digestions of each purified DNA.
      Reaction setup
      Reagent Final concentration Amount
      Purified DNA fragment N/A N/A
      NdeI (NEB, #R0111) 1.5 U/μL 1.5 μL
      XhoI (NEB, #R0146) 1.5 U/μL 1.5 μL
      CutSmart buffer 2.0 μL
      ddH2O N/A To 20 μL
      Total N/A 20 μL
      Note: We normally use up to 2 μg DNA for the plasmid backbone, and up to 1 μg DNA for Ec trmD (or the gene of interest).
    • b.
      Incubate at 37°C for at least 3 h.
    • c.
      Add 1.0 μL Shrimp Alkaline Phosphatase (rSAP) (NEB, #M0371) to the reaction for the pKD46 backbone. Incubate for another 30 min to remove the phosphate group from the 5′ end of the DNA to minimize self-ligation.
    • d.
      Column-purify the PCR product using a commercial kit (Macherey-Nagel, #740609) and elute the PCR DNA in 20 μL sterilized water.
    • e.
      Measure OD260 and determine the DNA concentration.
    • f.
      Mix the purified DNAs as follows for ligation.
      Reaction setup
      Reagent Final concentration Amount
      pKD46 backbone DNA 0.03 pmol per 10 μL N/A
      Ec trmD DNA 0.09 pmol per 10 μL N/A
      T4 DNA ligase (NEB, #M0202) 40 U/μL 1 μL
      10× T4 DNA ligase buffer 1 μL
      ddH2O N/A To 10 μL
      Total N/A 10 μL
      Note: The vector:insert ratio is 1:3, according to NEB’s website: https://www.neb.com/protocols/0001/01/01/dna-ligation-with-t4-dna-ligase-m0202.
    • g.
      Incubate the ligation mix at 16°C for 12–16 h or at 20°C–22°C for 10 min, according to the website mentioned above.
    • h.
      Transform the whole sample into 100 μL E. coli DH5α chemically competent cells made by calcium chloride method,8 spread them on an LB+100 μg/mL ampicillin (Amp100) plate, and incubate the plate for selection at 30°C for 14–18 h.
    • i.
      Colony-PCR screening.
      • i.
        Pick several colonies and resuspend each in 25 μL sterile water.
      • ii.
        Run PCR using the following conditions.
        PCR setup
        Reagent Final concentration Amount per sample
        Primer pKD46 check F (10 μM) 500 nM 0.5 μL
        Primer pKD46 check R (10 μM) 500 nM 0.5 μL
        FastGene Optima HotStart ReadyMix (Bulldog Bio, #LS29) 5.0 μL
        ddH2O N/A 3.5 μL
        Water-resuspended colony N/A 0.5 μL
        Total N/A 10.0 μL
        Thermal cycling condition
        Steps Temperature Time Cycles
        Initial denaturation 94°C 4 min 1
        Denaturation 94°C 25 s 30
        Annealing 50°C 25 s
        Extension 72°C 2 min
        Final extension 72°C 3 min 1
        Hold 4°C Forever
        Note: Use the Phusion HF DNA polymerase.
        Note: The original pKD46 will generate a 2.4 kb band, whereas recombinant clones will generate a band of different size based on the length difference between the λ Red recombinase gene and the gene of interest. For Ec trmD, 1.3 kb band will be generated.
    • j.
      Confirm Ec trmD gene in the recombinant clones by sequencing of a purified colony-PCR product or the extracted plasmid DNA, using primers pKD46 Check F and R.
      Note: This is the final product of the ts maintenance plasmid pKD46-Ec trmD (abbreviated as pKD46-Ec trmD, Figures 1 and 2). Make a freezer stock.
      Optional: In step 3f, the vector:insert ratio can be increased to 1:10 if the cloning efficiency is low. In step 3g, the ligation time at 16°C can be shortened to 2 h, while maintaining efficient ligation.

Figure 2.

Figure 2

Construction of the λ Red-compatible pACYC-Ec trmD maintenance plasmid

(A) To construct the ts maintenance plasmid pKD46-Ec trmD. Start with the commercial pKD46 plasmid (CGSC, #7634), carrying genes for expression of the λ Red recombinase under the control of the PBAD promoter, the araC gene for the arabinose-controlled expression of the repressor under the control of the Pc promoter, the Amp marker, the pSC101 t origin of replication, and the repA101 gene for expression of the ts replication enzyme. A cassette of the plasmid containing regulatable genes is PCR-amplified and ligated with a separately PCR-amplified Ec trmD gene, resulting in the maintenance plasmid pKD46-Ec trmD as shown in Figure 1A.

(B) To construct the λ Red-compatible maintenance plasmid pACYC-Ec trmD. Start with the commercial pACYCDuet-1 plasmid (Millipore, #71147), carrying the p15a origin of replication that is compatible with the λ Red plasmid carrying a ts origin of replication. Amplify the cassette that contains the p15a origin of replication and ligate the cassette with the Ec trmD-containing cassette amplified from (A). This results in the pACYC-Ec trmD maintenance plasmid as shown in Figure 1B.

Construction of a λ Red-compatible maintenance plasmid for Ec trmD

Inline graphicTiming: 1 week

Although the pKD46-Ec trmD maintenance plasmid made above is used for suppressor screening, it is not compatible with the commercially available λ Red recombinase plasmid (CGSC, #7634) that is necessary to create an Ec trmD-KO strain. Therefore, the segment of araC-PC-PBAD-Ec trmD in the ts maintenance plasmid needs to be subcloned into a vector that is compatible with the commercially available λ Red plasmid. The pACYCDuet-1 vector is a good candidate, which has a p15a replication origin and chloramphenicol (Cm) resistance marker.

We describe steps for construction of a maintenance plasmid for Ec trmD that is compatible with the λ Red plasmid. This involves subcloning of araC-PC-PBAD-Ec trmD to pACYC (Figure 2B). Troubleshooting 1.

Note: The procedure shown here (Figure 2) is generalized for the public and is not completely identical to the published procedure.1

  • 4.
    Design primers.
    Note: Three pairs of primers are required: one is to amplify the araC-PC-PBAD-Ec trmD expression cassette, the second is to amplify the pACYC plasmid, and the third is to amplify the cloning region.
    • a.
      To amplify the araC-PC-PBAD-Ec trmD cassette, design primers to contain a PstI restriction site and an XhoI restriction site (underlined) at the 3′ end of araC and Ec trmD, respectively, with terminal extensions for enzyme digestion. Note that the reverse primer is gene-specific, which is identical to Ec trmD R.
      araC-trmD F:
      5′-TCGTAACTGCAGTTATGACAACTTGACGGCTACATC-3′.
      araC-trmD R (= Ec trmD R):
      5′-GACTGACTCGAGTTACGCCATCCCATCATGTTTATG-3′.
    • b.
      To amplify the pACYC plasmid backbone, design outward primers to contain a PstI restriction site and an XhoI restriction site (underlined) at the termini for ligation with the araC-PC-PBAD-Ec trmD cassette, with terminal extensions for enzyme digestion.
      pACYC F:
      5′-GCTTCACTCGAGTCTGGTAAAGAAACCGCTGC-3′.
      pACYC R:
      5′-GACTGACTGCAGCGCAATTAATGTAAGTTAGC-3′.
      Note: These primers will amplify the entire pACYCDuet-1 plasmid but exclude the lacI gene and the multi-cloning site.
    • c.
      To confirm the inserted sequence in the recombinant pACYC plasmid, design inward primers for colony-PCR to anneal to the external sites relative to the cloning region of pACYC.
      pACYC check F:
      5′-GTTGTAATTCTCATGTTAGTCATGC-3′.
      pACYC check R:
      5′-CCAAGGGGTTATGCTAGTTATTGCTCAG-3′.
  • 5.
    PCR amplification.
    Note: Perform two separate PCR reactions using the Phusion HF DNA polymerase. One reaction is to amplify the araC-PC-PBAD-Ec trmD cassette from pKD46-Ec trmD plasmid with primers araC-trmD F and R. The other reaction is to amplify the pACYC backbone from the intact pACYCDuet-1 plasmid with primers pACYC F and R. Follow the thermal cycling condition in step 2a, using 3 min extension time for araC-PC-PBAD-Ec trmD cassette and 5 min extension time for pACYC backbone.
    • a.
      Run PCR using the following setup.
      PCR setup
      Reagent for araC-PC-PBAD-Ec trmD cassette Reagent for pACYC Final concentration Amount
      pKD46-ts Ec trmD (50 ng/μL) pACYCDuet-1 (50 ng/μL) 2 ng/μL 1 μL
      Primer araC-trmD F (10 μM) Primer pACYC F (10 μM) 200 nM 0.5 μL
      Primer araC-trmD R (10 μM) Primer pACYC R (10 μM) 200 nM 0.5 μL
      dNTPs (10 mM each) Same as left 250 μM each 0.625 μL
      5× Phusion Buffer Same as left 5.0 μL
      Phusion HF DNA Polymerase Same as left 0.04 U/μL 0.5 μL
      ddH2O Same as left N/A 16.9 μL
      Total 25.0 μL N/A N/A
    • b.
      Analyze the PCR product on a 1.0% agarose gel. A distinct 2.0 kb band should be observed for the araC-PC-PBAD-Ec trmD cassette and a separate 2.4 kb band for the pACYC plasmid backbone.
    • c.
      Column-purify the PCR product using a commercial kit (Macherey-Nagel, #740609) and elute it in 25 μL sterilized water. Measure OD260 and determine the DNA concentration.
  • 6.
    Cloning.
    • a.
      Set up reactions as follows for restriction enzyme digestions of each purified DNA.
      Reaction setup
      Reagent Final concentration Amount
      Purified DNA fragment N/A N/A
      PstI (NEB, #R0140) 1.5 U/μL 1.5 μL
      XhoI (NEB, #R0146) 1.5 U/μL 1.5 μL
      NEBuffer 3.1 2.0 μL
      ddH2O N/A To 20 μL
      Total N/A 20 μL
      Note: We normally use up to 2 μg DNA for both the plasmid backbone and the araC-PC-PBAD-Ec trmD cassette.
    • b.
      Follow the cloning procedure indicated in steps 3b–3g.
    • c.
      Transform the entire reaction into 100 μL E. coli DH5α competent cells, spread the entire culture on an LB+34 μg/mL Cm (Cm34) plate, and incubate the plate for selection at 37°C for 12–16 h.
    • d.
      Colony-PCR screening.
      • i.
        Pick up several colonies and resuspend each in 25 μL sterile water.
      • ii.
        Run PCR using the following setup. Follow the thermal cycling condition described in step 3i, using 3 min extension time.
        PCR setup
        Reagent Final concentration Amount per sample
        Primer pACYC check F (10 μM) 500 nM 0.5 μL
        Primer pACYC check R (10 μM) 500 nM 0.5 μL
        FastGene Optima HotStart ReadyMix 5.0 μL
        ddH2O N/A 3.5 μL
        Water-resuspended colony N/A 0.5 μL
        Total N/A 10.0 μL
        Note: The original pACYC will generate a 1.8 kb band, whereas recombinant clones will show a band of different size based on the length difference. For araC-PC-PBAD-Ec trmD, a 2.3 kb band will be generated.
    • e.
      Confirm the inserted araC-PC-PBAD-Ec trmD cassette by sequencing of the purified colony-PCR product or the extracted plasmid DNA, using primers pACYC check F and R.
      Note: The product is the λ Red-compatible maintenance plasmid pACYC-Ec trmD (Figures 1 and 2). Make a freezer stock.

Elimination of Ec trmD from the chromosome and creation of a ts trmD-KO strain

Inline graphicTiming: 2 weeks

This section describes the creation of a ts trmD-KO strain by first introducing the ts maintenance plasmid to MG1655, followed by removing the trmD gene from the chromosome via λ Red recombination. Note that λ Red is a homologous-recombination-based technique for genetic engineering7 as outlined in Figure 3. The resulting strain provides the platform for genome-wide screening of suppressors of trmD-KO.

  • 7.
    Design primers.
    Note: Two pairs of oligo DNA primers are required: one is to amplify the kanamycin (Kan) marker cassette from pKD4 (CGSC, #7632) for recombination and the other is to confirm knockout of the chromosomal Ec trmD.
    • a.
      To amplify the Kan marker for homologous recombination, design primers to be Kan cassette-specific, preceded by a 5′-extension homologous to the target gene Ec trmD and its flanking sequences (underlined).
      Recombination F:
      5′-CCACCGGATAAACGGTAAAAGACGGCGCTGTGTAGGCTGGAGCTGCTTC-3′.
      Recombination R:
      5′-ATCCTGGGTAAACTGATATCTCGGGGGCATGGGAATTAGCCATGGTCCATATG-3′.
    • b.
      To confirm knockout of the chromosomal gene, design primers in 100–200 bps upstream and downstream of the Ec trmD ORF.
      Ec trmD check F:
      5′-TCGTCGATATGATGGAAACCGGATC-3′.
      Ec trmD check R:
      5′-CGGTTACGAATAGCGATAACCACGCC-3′.
  • 8.
    PCR amplification.
    • a.
      Run PCR using the following setup to amplify the Kan marker from pKD4. Follow the thermal cycling condition in step 2a, with 1.5 min extension time.
      PCR setup
      Reagent Final concentration Amount
      pKD4 (50 ng/μL) (CGSC, #7632) 2 ng/μL 1 μL
      Primer Recombination F (10 μM) 200 nM 0.5 μL
      Primer Recombination R (10 μM) 200 nM 0.5 μL
      dNTPs (10 mM each) 250 μM each 0.625 μL
      5× Phusion Buffer 5.0 μL
      Phusion HF DNA Polymerase 0.04 U/μL 0.5 μL
      ddH2O N/A 16.9 μL
      Total N/A 25.0 μL
    • b.
      Analyze the PCR product on a 1.0% agarose gel. A single 1.5 kb band should be observed.
    • c.
      Column-purify the PCR product using a commercial kit (Macherey-Nagel, #740609) and elute it in 25 μL sterilized water. Measure OD260 and determine the DNA concentration.
  • 9.
    Electro-competent cell preparation expressing λ Red recombinase.
    • a.
      Transform the λ Red-compatible maintenance plasmid pACYC-Ec trmD into E. coli strain MG1655 harboring the parent pKD46, the recombinase plasmid. Select transformants on an LB + Amp100 + Cm34 plate at 30°C.
    • b.
      Grow a single colony in a 1 mL LB + Amp100 + Cm34 liquid culture at 30°C for 12–16 h, shaking.
    • c.
      Inoculate the preculture to fresh 3 mL LB + Amp100 + Cm34 at 1:100 at 30°C.
    • d.
      At OD600 = 0.3 (usually ∼2 h after inoculation), add 0.2% L-(+)- arabinose (Ara0.2) and grow the culture at 30°C for another 30 min.
    • e.
      Chill the culture on ice for 25 min. Meanwhile, prepare a filter-sterilized 10% glycerol solution and chill it on ice.
    • f.
      Spin cells at 4,000 × g for 2 min, 4°C, and remove the supernatant.
    • g.
      Resuspend the pellet in the half volume of the cold 10% glycerol.
    • h.
      Repeat steps 9f, 9g, and one more time 9f.
    • i.
      Resuspend the pellet in 100 μL cold 10% glycerol and store at −80°C immediately until use.

Optional: In step 9d, Ara induction time should be titrated, although prolonged induction (>1 h) can be toxic to cells due to over-expression of the recombinase.

  • 10.
    Electroporation for recombination.
    • a.
      Mix 50 ng of purified DNA (ideally 1–2 μL) and 50 μL competent cells in an Eppendorf tube and incubate for 5 min on ice. Pre-warm a 1 mL LB medium per sample at 37°C.
    • b.
      Transfer the mixture to an electroporation cuvette.
    • c.
      Electroporate cells using the preset program Ec1 of Micropulser (BIO-RAD, #1652100). Immediately add the pre-warmed 1 mL LB to cells. Transfer cells as much as possible to a clean Eppendorf tube.
    • d.
      Outgrow cells for 1 h at 37°C.
    • e.
      Spin down cells, discard the supernatant, and resuspend the pellet in 100 μL LB. Split into 1:9, and spread one portion on one LB + Cm34 + Ara0.2 + 50 μg/mL Kan (Kan50) plate and the other portion on another plate. Incubate at 37°C for 12–16 h.
    • f.
      Colony-PCR screening.
      • i.
        Pick up several colonies and resuspend each in 25 μL sterile water.
      • ii.
        Run PCR using the following setup. Follow the thermal cycling condition described in step 3i, using 1.5 min extension time.

PCR setup

Reagent Final concentration Amount per sample
Primer Ec trmD check F (10 μM) 500 nM 0.5 μL
Primer Ec trmD check R (10 μM) 500 nM 0.5 μL
FastGene Optima HotStart ReadyMix 5.0 μL
ddH2O N/A 3.5 μL
Water-resuspended colony N/A 0.5 μL
Total N/A 10.0 μL

Note: In a successful KO clone, a distinct band from the one in the WT strain should be obtained, reflecting the difference in length between Ec trmD and the Kan marker. Using the primers described here, a 1.2 kb and 2.0 kb band will be obtained for WT and KO, respectively.

Note: If both types of bands are observed, this indicates a heterogeneous population of the colony. The KO cells should be purified as shown in the next step.

  • 11.
    Purification of the KO cell.
    • a.
      After confirmation of the gene KO on the chromosome, streak cells on an LB + Kan50 + Cm34 + Ara0.2 plate to grow at 43°C for 12–16 h.
    • b.
      Pick a few colonies from the plate and repeat the streak-purification step (step 11a) for each to thoroughly remove pKD46.
    • c.
      Isolate a single colony and amplify the trmD locus by colony-PCR as in step 3i, and confirm the sequence of the column-purified PCR product by sequencing using primers Ec trmD check F and R.

Inline graphicCRITICAL: Confirm that the clone does not grow in media containing Amp100, indicating the complete loss of pKD46.

Note: Make a freezer stock of this purified KO clone and use it for subsequent assays.

Optional: We have three additional strategies to generate the Ec trmD-KO condition. In one, we tag the gene for expression with a 6×His-tag to allow analysis of the gene product from the maintenance plasmid (Figure 4A). In the second, we tag the gene for expression with an ssrA-degron tag9 to facilitate rapid degradation to induce the KO state (Figures 4A–4C). The degron tag encodes the sequence for a 5-residue tag YALAA, the critical component of the degron motif AANDENYALAA, targeted by the ClpXP-mediated protein degradation. To apply this, the design of the Ec trmD R primer is modified accordingly.6 In the third, we express the eukaryotic counterpart of the essential gene in the maintenance plasmid, considering that the protein product of a eukaryotic gene in E. coli is usually more prone to rapid degradation. The eukaryotic counterpart of trmD is trm5, which functionally supports E. coli viability in place of trmD.10 We have confirmed that expression of human trm5 (Hs trm5) from the maintenance plasmid generates a protein product that is rapidly degraded, thus inducing the KO state much faster than expression of trmD and even faster than expression of trmD with a degron tag (Figure 4B).

Figure 3.

Figure 3

A general scheme of λ Red recombination

A Kan marker gene is amplified with flanking sequences that are homologous to the flanking sequences of Ec trmD on the chromosome. This Kan marker gene is introduced to the E. coli chromosome by electroporation in the presence of a λ Red-expression plasmid, which catalyzes homologous recombination to replace the chromosomal trmD with the marker gene. In E. coli and in all bacterial genomes, the trmD gene is in an operon that consists of the rpsP gene (encoding the small ribosomal protein S16), the rimM gene (encoding the assembly factor for the small ribosomal subunit), and the rplS gene (encoding the large ribosomal protein L19).

Figure 4.

Figure 4

Phenotype analysis of three E. coli trmD-KO strains each with a pACYC-derived maintenance plasmid

(A) The degron tag sequence for rapid degradation of the TrmD protein of Ec TrmD expressed from a maintenance plasmid. Orange, the TrmD C-terminal sequence; yellow, 6× His-tag; pink, the core degron tag YALAA.

(B) Representative growth cycles of three E. coli trmD-KO strains. One is maintained viable by the pACYC-Ec trmD plasmid (left), the second is maintained viable by the pACYC-Ec trmD-deg plasmid (center), and the third is maintained viable by a pACYC-Hs trm5 plasmid (right). Loss of growth is observed in multiple cycles of growth and dilution in the Ara– condition as compared to the Ara+ condition. A culture of each strain grown to saturation in the Ara+ condition was inoculated into an LB medium at 1:100 in the Ara+ and Ara– condition for monitoring growth by OD600. When the OD600 of the Ara+ culture reached 1.0 (as indicated by the ∗), the culture was diluted to OD600 of 0.05, which started the second cycle of growth. With the untagged TrmD, loss of growth was not observed in the first 8 h, whereas with the degron-tagged TrmD, loss of growth was observed. Loss of growth was most pronounced by expression of human Trm5 protein.

(C) Stability of the maintenance TrmD protein without (left) or with (right) the degron tag. Whole-cell lysates harvested over the time-course shown in (B) were analyzed by immunoblotting using an anti-TrmD antibody, showing rapid degradation of the degron-tagged TrmD relative to the untagged TrmD.

(D) Loss of viability over a serial 10-fold dilution of a culture grown to saturation in the Ara– condition as compared to the Ara+ condition.

  • 12.
    Growth validation. Troubleshooting 2.
    • a.
      Grow a single colony of the purified KO clone in LB medium with Kan50 + Cm34 + Ara0.2 at 37°C for 12–16 h.
    • b.
      Inoculate the preculture at 1:100 to a fresh LB medium of 2 mL with Kan50 + Cm34. Prepare duplicates and add Ara0.2 to one of the two as a control while no Ara in the other.
      Note: With the addition of Ara0.2 (Ara+) in one culture, the trmD gene in the maintenance plasmid would support viability of the KO strain, whereas without the addition of Ara (Ara−) in the second culture, the trmD gene in the maintenance plasmid would be turned off.
    • c.
      Grow the two cultures at 37°C and monitor growth by measuring OD600. In this first cycle of growth, there may not be a sufficient difference between the two cultures (Figure 4B).
    • d.
      Measure OD600 at OD600 around 1.0 (usually 3–4 h) and dilute each culture into a fresh LB medium with Kan50 + Cm34 in Ara+ or Ara− condition, to OD600 around 0.05.
    • e.
      Grow the two cultures at 37°C and continue the growth and hourly OD600 measurement. In this second cycle of growth, the Ara+ culture may start to show a faster growth than the Ara− culture (Figure 4B), indicating that the Ara− culture is gradually losing viability.
    • f.
      If the growth difference is still small, repeat steps 12d–12e one more time.
      Note: The growth defect in the Ara− condition should be observed earlier and more clearly when the maintenance trmD gene encodes a degron tag (Figure 4B), which is confirmed by rapid degradation of the degron-tagged trmD protein in immunoblotting (Figure 4C). The defect is most noticeable upon expression of Hs trm5 as the maintenance gene.
    • g.
      When a clear growth difference is observed (after the second or the third cycle), take an aliquot of the Ara− culture, and measure OD600.
    • h.
      Dilute the Ara− culture down to OD600 ∼0.1, which is approximately equivalent to 5.0 × 107 CFU/mL (where CFU = colony-forming units).
    • i.
      Make a serial 10-fold dilution using LB medium on a 96-well plate. Spot 3 μL of each serial dilution on an LB + Kan50 + Cm34 plate with or without Ara0.2. Incubate the plates for 12–16 h at 37°C.
      Note: Notably, this series of KO strains does not have the ts origin of replication yet, and thus each is grown at 37°C.
    • j.
      Check the growth next day. If successful, cells will barely grow on the Ara− plate whereas cell growth will be robust on the Ara+ plate (Figure 4D).
      Note: In general, the KO strain obtained here is not suitable for biological assays, because the strain made by λ Red recombination may harbor off-target genomic mutations that can affect the phenotype. For biological assays, we recommend using P1 transduction, as shown below, to introduce the trmD-KO locus into a well-defined WT strain harboring a ts maintenance plasmid. Successful transductants will be selected by the Kan marker on the genomic locus of interest.
  • 13.
    Preparation of P1 lysate from a donor trmD-KO strain for transduction.
    • a.
      Use the trmD-KO strain obtained in step 11 as the donor strain. Grow a single colony of the donor strain in LB medium with Kan50 + Cm34 + Ara0.2 at 37°C for 12–16 h.
    • b.
      Inoculate the preculture at 1:100 to a fresh 1 mL LB medium supplemented with 0.2% glucose and 5 mM CaCl2 as in the Ara− condition. Grow it for 1 h at 37°C.
    • c.
      Add 25 μL WT P1 lysate (CGSC, #12133) to the pre-grown cell culture. Grow the culture at 37°C until it appears cleared (4–8 h).
      Note: Clearing the culture indicates that the phage is infecting the donor cell and proliferating in it, while also harboring fragments of the donor genome.
    • d.
      Add 50 μL chloroform to the cleared culture to kill the remaining donor cell. Vortex-mix, and spin the culture at 16,000 × g for 5 min at 20°C–22°C.
    • e.
      Take the upper layer which contains the P1 phage and repeat the chloroform treatment (step 13d) one more time.
    • f.
      Collect the upper layer as the P1 lysate for trmD-KO and store it at 4°C.
  • 14.
    P1 transduction to the recipient strain.
    • a.
      Grow a single colony of E. coli WT strain MG1655 containing the pKD46-Ec trmD maintenance plasmid as the recipient, in a 1 mL LB + Amp100 medium at 30°C for 14–18 h.
    • b.
      Spin cells at 7,000 × g for 1 min, 20°C–22°C, and resuspend the pellet in 400 μL buffer containing 5 mM CaCl2 and 10 mM MgSO4.
    • c.
      Mix 50 μL cell resuspension and 50 μL P1 lysate from the donor strain obtained in step 13f, and incubate the mixture for 20 min at 37°C.
      Inline graphicCRITICAL: Include a control where the P1 lysate is replaced with LB, and another control where the recipient culture is replaced with the resuspension buffer.
    • d.
      Add a 1 mL fresh LB medium, 50 μL 1 M sodium citrate pH 5.2 (Na-Cit), and 10 μL 20% Ara to each tube to induce the Ara+ condition. Shake or rotate the sample to recover at 30°C for 1 h.
    • e.
      Spin down the cells at 7,000 × g for 1 min, 20°C–22°C, and resuspend the pellet in 100 μL fresh LB.
    • f.
      Spread the entire resuspension on an LB + Amp100 + Kan50 + Ara0.2 plate supplemented with 5 mM Na-Cit, and incubate at 30°C for >12 h, until distinct colonies are observed.
    • g.
      Follow step 10f to analyze the colonies by colony-PCR. Make sure that controls do not generate any colonies.
      Note: The observation of PCR bands from both WT chromosome and the KO chromosome indicates that the colony is heterogeneous.
    • h.
      If the chromosomal KO is confirmed, streak the colony on an LB + Amp100 + Kan50 + Ara0.2 plate and grow it at 30°C for 14–18 h. Pick up and grow a single colony in LB + Amp100 + Kan50 + Ara0.2 at 30°C.
    • i.
      Validate growth by following step 12 but replacing Cm34 with Amp100 for the pKD46-Ec trmD maintenance plasmid. Maintain all cultures at 30°C.
      Note: Make a freezer stock of this purified KO clone and use it for suppressor screen.
      Note: The growth rate at 30°C is generally slow, indicating that depletion of the maintenance protein would be slow. Thus, it may take a longer time to observe a reduced growth phenotype. In this case, the growth test can be done at 43°C, omitting Amp, to accelerate loss of the maintenance plasmid. This is essentially the procedure of isolation of suppressors as shown in step 15 (Figure 5).

Figure 5.

Figure 5

Phenotype analysis of the E. coli trmD-KO strain expressing Ec trmD from the ts pKD46-Ec trmD maintenance plasmid

(A) Comparing growth of trmD-WT and trmD-KO strains. Each harboring plasmid pKD46-Ec trmD was grown in LB without Ara, in cycles of growth and dilution as in Figure 4B, at non-permissive temperature 43°C. The trmD-KO strain exhibited reduced growth in the third cycle. Dilutions are indicated by a ∗.

(B) Cell viability of trmD-WT and trmD-KO strains. Both strains were diluted to the same OD600 and 3 μL of serial 10-fold dilutions were spotted on an LB plate and incubated at the indicated condition. Whereas the two strains showed similar CFU counts when there was no pre-depletion, the trmD-KO strain showed a significantly lower CFU count compared to the trmD-WT strains when cells were pre-depleted at 43°C as shown in Figure 5A. This result indicates that the depletion has progressively reduced the protein level of TrmD, resulting in loss of viability.

Removal of the plasmid-borne Ec trmD from the trmD-KO strain to screen for suppressors

Inline graphicTiming: 1 week

We describe steps for generation of TrmD-depleted cells by removing the ts maintenance plasmid from the trmD-KO clone through cycles of cell growth and dilution at the non-permissive temperature. We also describe steps for suppressor screen.

Note: Repeated cycles of growth and dilution at the non-permissive temperature will deplete the ts maintenance plasmid and pre-existing protein and associated products (Figure 5).

  • 15.
    Cycling between growth and dilution at 43°C. Troubleshooting 3.
    • a.
      Grow a single colony of the trmD-KO strain containing the ts maintenance plasmid in an LB + Kan50 + Amp100 + Ara0.2 liquid culture at 30°C for 14–18 h.
      Note: As a control, inoculate the WT counterpart strain with trmD (trmD-WT) on the chromosome, but containing the pKD46-Ec trmD maintenance plasmid in the same condition. No Kan is needed for the WT strain.
      Optional: Omitting Ara in this preculture will promote the KO phenotype.
    • b.
      Inoculate both precultures at 1:100 to a fresh 10 mL LB medium without Ara. Kan50 is added only to the trmD-KO culture. Grow both cultures at 43°C and monitor growth by measuring OD600.
      Note: While the trmD-WT culture should grow fast, the trmD-KO culture should show growth reduction.
    • c.
      At OD600 ∼1.0, dilute 1:50 and repeat another cycle of growth and dilution, until there is no visible growth of the trmD-KO strain, indicating loss of viability for the majority of the cells.
    • d.
      Keep growing the trmD-KO culture until OD600 = 0.1–0.15 (Figure 5A).
      Optional: To confirm the loss of viability, spot dilutions of the trmD-KO culture to determine the CFU counts (Figure 5B). The trmD-WT and trmD-KO cell cultures are diluted to the same OD600 and spot 3 μL of serial 10-fold dilutions on an LB plate. Without any pre-depletion, similar CFU counts are observed between trmD-WT and trmD-KO strains, although the count should decrease for the trmD-KO strain at 43°C or in Ara− condition (Figure 5B). Indeed, after a 9-h depletion in liquid culture over three cycles (Figure 5A), the CFU counts of the trmD-KO strain are decreased by > 106-fold relative to the trmD-WT strain (Figure 5B), regardless of the growth condition. This significant loss of the CFU counts indicates that the trmD-KO strain is approaching the non-viable state.
  • 16.
    Screen for suppressors of Ec trmD-KO. Troubleshooting 3. Troubleshooting 4.
    Note: Because suppressors may show differential growth in response to the KO, spread different amounts of cells on the screening plates.
    • a.
      Spread 10 and 100 μL of the cell culture from step 15d on an LB + Kan50 plate.
    • b.
      Spin down cells in the remaining cell culture (∼9.9 mL) at 7,000 × g for 5 min, 20°C–22°C, resuspend in 100–200 μL LB.
    • c.
      Divide into 1:9 and spread one portion on one LB + Kan50 plate and the other half on another LB + Kan50 plate.
    • d.
      Incubate plates at 43°C until distinct colonies are observed. To prevent dry-out of plates, wrap each with double layers of parafilm.
      Inline graphicCRITICAL: If there are no colonies after >36 h incubations, leave the plates at 20°C–22°C to avoid getting dried.
    • e.
      If a distinct colony is isolated, streak it on an LB + Kan50 plate, and incubate it at 43°C for purification.
      Note: False-positive clones will not grow on this streaked plate.
    • f.
      Confirm growth of the suppressor cells in a liquid culture. Suppressor cells should show a robust growth in the Ara− condition.
      Inline graphicCRITICAL: Confirm suppressor clone by PCR of the trmD locus and the pKD46 maintenance plasmid, using primers Ec trmD check F and R, and pKD46 check F and R, respectively. Also test the Amp sensitivity of the ts strain for loss of the Amp-carrying maintenance plasmid.
      Inline graphicCRITICAL: In step 15d, avoid over-growing the cell culture, which will generate sibling colonies of each suppressor on the screening plates.
      Inline graphicCRITICAL: To avoid genomic bias of a host, use several different host strains and construct the KO derivative of each with the same ts strategy. For examples, consider using different host strains such as MG1655, XAC-1, and BW25113. Then perform the same suppressor screen in parallel. Additionally, to strengthen conclusions, perform the suppressor screen of each strain at least twice to minimize isolation of sibling clones. Validate phenotypes associated with the gene of interest.

Whole-genome sequencing of suppressors

Inline graphicTiming: 3–4 weeks

We describe steps for library preparation and sequencing of the genomes of the suppressor cells. For details, see reference.1

  • 17.
    Library preparation and sequencing.
    • a.
      Grow each suppressor colony in a 1–2 mL of LB + Kan50 at 30°C for 14–18 h. Extract the genomic DNA by a phenol-chloroform method or using a commercial kit (such as PureLink Genomic DNA Mini Kit, Invitrogen, #K182001).
      Inline graphicCRITICAL: Include a parental WT DNA sample as a reference.
    • b.
      Process the extracted genomic DNA into a barcoded library using Nextera XT DNA Library Prep Kit (Illumina, #FC-131-1024). Follow the manufacturer’s instruction.
    • c.
      Perform whole-genome sequencing of the constructed DNA library in an appropriate setting.
      Note: In the cited work,1 a 2 × 150 bp paired-end sequencing was performed using the MiSeq platform (Illumina). A single multiplexed sample containing the barcoded libraries from 24 bacterial strains can generate sequencing reads with 80× coverage of the entire genome for each strain.
    • d.
      Identify mutations unique to each suppressor clone.
      Note: In the cited work,1 all suppressor mutations were mapped to Ec proS, encoding prolyl-tRNA synthetase, indicating that this is the core gene supported by Ec trmD. Prioritize on non-synonymous mutations.

CRISPR reconstruction of each suppressor mutation in MG1655

Inline graphicTiming: 2–3 weeks

To confirm that each suppressor mutation can restore cell viability, each must be re-created in the WT genome and re-evaluated. Mutations that do not restore cell viability in the WT background will be removed. We describe steps for reconstruction of each mutation in the WT MG1655 strain, using the CRISPR-Cas9 genome editing technique. Troubleshooting 5.

Note: Design oligo DNA primers as described in the reference for the CRISPR-Cas9 genome editing system,11 which provides details. Below is an example for reconstructing the Ec proS D98N suppressor mutation in MG1655.

  • 18.
    Design primers.
    Note: Four types of DNA oligos are required: one is to mutagenize the sgRNA plasmid, the second is to sequence the mutagenized sgRNA plasmid, the third is a donor oligo DNA for recombination, and the fourth is to verify the chromosomal mutation by mutant-specific colony-PCR and sequencing.
    • a.
      To mutagenize the template pKDsgRNA plasmid (Addgene, #62654 or #62656) to target the Cas9 system to the specific site of interest, design round-the-horn PCR primers.
      pKDsgRNA F:
      5′-CTGCTGCGTTTTGTTGACCGGTTTTAGAGCTAGAAATAGCAAG-3′.
      pKDsgRNA R (PtetR in the original reference):
      5′-GTGCTCAGTATCTCTATCACTGA-3′.
      Note: A forward primer contains a 20-mer sequence that contains a mutation site in the upstream of a PAM (protospacer adjacent motif) site (underlined), followed by a pKDsgRNA-specific sequence. A reverse primer is specific to the pKDsgRNA and is applicable for making CRISPR mutations in general.
      Note: Use webtools such as CRISPR-ERA12 (http://crispr-era.stanford.edu/) for an appropriate sgRNA sequence.
    • b.
      To sequence the mutagenized pKDsgRNA plasmid, order three primers described in the reference.11
      pKDseq5:
      5′-CAGTGAATGGGGGTAAATGG-3′.
      sgrnaR:
      5′-GCCTGCAGTCTAGACTCGAG-3′.
      sgrnaA:
      5′-AGCTTTCGCTAAGGATGATTT-3′.
    • c.
      To provide a mutant allele, design an 80-mer oligo DNA that contains a suppressor mutation, which is the donor DNA.
      Donor DNA: GGGAACAGTACGGTCCGGAACTGCTGCGTTTTGTGAATCGTGGCGAGCGTCCGTTCGTACTCGGCCCAACTCATGAAGAA
      Note: The mutation site (underlined) should be placed at the center as much as possible as shown above, with the bold-faced A being the suppressor mutation identified from the screen. Note that there are two additional mutations, which are synonymous changes (“silent” mutations) to enable the resulting suppressor mutant to escape the CRISPR-Cas9 cleavage. The mutagenesis in the example is from GTT-GAC (Val-Asp) to GTG-AAT (Val-Asn).
    • d.
      For genotype screening on CRISPR-mutants, design primers specific to the target gene.

Genotyping proS F (mutant-specific):

5′-GGAACTGCTGCGTTTTGTGAAT-3′.

Genotyping proS R (non-mutant-specific):

5′-AATCACCACCGGAATCGGCAT-3′.

External proS F:

5′-GATCAGCCATCAGCTGATGC-3′.

Note: One primer should contain mutant-specific bases at the 3′-end (underlined), so it anneals to the mutant sequence only. The other primer is in the opposite direction to amplify a partial fragment of the gene when used in combination with the mutant-specific primer. Also, design another primer which is external to the suppressor-specific primer to amplify a longer gene fragment for sequencing.

  • 19.
    Construction of the suppressor mutation-containing pKDsgRNA by round-the-horn PCR.
    • a.
      Run PCR using the following setup to amplify the entire pKDsgRNA plasmid. Follow the thermal cycling condition described in step 2a, using 7 min extension time.
      PCR setup
      Reagent Final concentration Amount
      pKDsgRNA-ack (100 ng/μL) (Addgene, #62654) 2 ng/μL 1 μL
      Primer pKDsgRNA F (10 μM) 200 nM 0.5 μL
      Primer pKDsgRNA R (10 μM) 200 nM 0.5 μL
      dNTPs (10 mM each) 250 μM each 0.625 μL
      5× Phusion Buffer 5.0 μL
      Phusion HF DNA Polymerase 0.04 U/μL 0.5 μL
      ddH2O N/A 16.9 μL
      Total N/A 25.0 μL
    • b.
      Analyze the PCR product on a 1.0% agarose gel. A single 7.0 kb band should be observed.
    • c.
      Digest the residual parental template plasmid by DpnI restriction (NEB, #R0146) at 37°C for 2 h.
    • d.
      Column-purify the PCR product using a commercial kit (Macherey-Nagel, #740609) and elute it in 25 μL sterilized water.
    • e.
      Mix as follows for T4 polynucleotide kinase (PNK) reaction and incubate at 37°C for 20 min followed by inactivation at 65°C for 10 min.
      Reaction setup
      Reagent Final concentration Amount
      Purified DNA fragment N/A 15 μL
      10 mM ATP 1 mM 2.0 μL
      T4 polynucleotide kinase (PNK; NEB, #M0201) 0.5 U/μL 1.0 μL
      10× T4 PNK buffer 2.0 μL
      Total N/A 20 μL
      Note: In this step, phosphorylate the 5′-end by T4 PNK to promote self-ligation of the 5′- and 3′-ends of the PCR product into a circular DNA.
    • f.
      Self-ligate the DNA. Mix 4 μL 5′-phosphorylated PCR product, 0.5 μL 10× T4 DNA ligase buffer, and 0.5 μL T4 DNA ligase (NEB, #M0202). Incubate at 16°C for 2 h.
    • g.
      Transform the whole ligation product into 50 μL of E. coli DH5α competent cells and obtain colonies on a selective LB+50 μg/mL spectinomycin (Spec50) plate at 30°C.
    • h.
      Grow a single clone in LB + Spec50 at 30°C for 14–18 h, extract plasmid DNA, and sequence it using the primer sgrnaA.
      Alternatives: Amplify a segment of the plasmid containing the sgRNA region by colony-PCR using primers pKDseq5 and sgrnaR and sequence the column-purified PCR product using the primer sgrnaA.
  • 20.
    Electroporation for recombination.
    • a.
      Transform WT E. coli MG1655 competent cells with pCas9cr4 (Addgene, #62655), which expresses Cas9 protein under anhydrous tetracycline (aTc) regulation. Obtain a transformed colony on LB + Cm34 at 37°C.
    • b.
      Grow the cell and make it into competent cells by a chemical method,9 then transform it with the mutagenized pKDsgRNA-proSD98N. Obtain a transformed colony on LB + Cm34 + Spec50 at 30°C.
    • c.
      Grow the colony and make it into electro-competent cells by following step 9 but replace Amp100 with Spec50.
    • d.
      As described in steps 10a–10c, electroporate 100 pmol (1 μL of 100 μM) of the donor DNA into the 50 μL competent cells.
    • e.
      Streak 100 μL on an LB + Cm34 plate supplemented with 100 ng/mL aTc (aTc100).
    • f.
      Incubate the plate at 30°C for 14–18 h until distinct colonies are observed.
      Inline graphicCRITICAL: Perform steps 20e and 20f in the dark, due to the light-sensitivity of aTc.
      Inline graphicCRITICAL: Include one negative control sample without the donor DNA. Surviving colonies on the aTc-containing plate should be cells that escape the Cas9 cleavage with the designed mutation. The negative control sample should show fewer surviving colonies on the plate.
    • g.
      Colony-PCR screening.
      • i.
        Pick up several colonies and resuspend each in 25 μL sterile water.
      • ii.
        Run PCR using the following setup. Follow the thermal cycling condition described in step 3i, using 59°C annealing temperature and 0.5 min extension time.
        PCR setup
        Reagent Final concentration Amount per sample
        Primer Genotyping proS F (10 μM) 500 nM 0.5 μL
        Primer Genotyping proS R (10 μM) 500 nM 0.5 μL
        FastGene Optima HotStart ReadyMix 5.0 μL
        ddH2O N/A 3.5 μL
        Water-resuspended colony N/A 0.5 μL
        Total N/A 10.0 μL
        Inline graphicCRITICAL: Depending on the mutations introduced, the mutant-specific primer can anneal also to the WT allele, especially at a lower annealing temperature, resulting in a false-positive clone. To minimize the non-specific annealing, we normally use 59°C–60°C annealing temperature.
        Note: Using the mutant-specific primer, only the mutant allele should be amplified whereas the WT allele should not.
    • h.
      Take the clone which generated a specific PCR band and amplify a longer gene fragment using primers External proS F and Genotyping proS R, following the PCR setup in step 20g.
    • i.
      Column-purify the PCR product using a commercial kit (Macherey-Nagel, #740609) and elute it in 25 μL sterilized water. Sequencing analysis is performed with either of the PCR primers to verify the mutations.
    • j.
      Follow steps 11a and 11b on an LB + Cm34 plate to eliminate the pKDsgRNA which is a ts plasmid. Make sure that cells show the Spec50 sensitivity after streak-purification.
  • 21.
    Removal of pCas9cr4 and final purification.
    • a.
      Grow the purified clone in LB + Cm34 and make it into competent cells by a chemical method.8
    • b.
      Mix 50 μL competent cells with 100 ng of pKDsgRNA-p15a (Addgene, #62656), and incubate cells on ice for 30 min.
    • c.
      Heat-shock cells at 42°C for 45 s, rest on ice for 2 min, and add 1 mL LB.
    • d.
      After growth recovery at 30°C for 2 h, add aTc100 and continue the incubation for another 2–3 h in the dark, inducing CRISPR-Cas9 system to cleave pCas9cr4.
    • e.
      Spreading the sample over an LB + Spec50 + aTc100 plate and incubate it at 30°C for 14–18 h, in the dark.
    • f.
      Pick up several colonies, make replicas on an LB + Spec50 plate, and grow each at 30°C for several hours.
    • g.
      Transfer each to an LB + Cm34 plate and grow it at 37°C for 12–16 h.
    • h.
      Find a Cm34-sensitive clone that shows no growth on the LB + Cm34 plate, indicating the loss of pCas9cr4.
    • i.
      Take a Cm34-sensitive clone and follow steps 11a and 11b on an LB plate without any antibiotics to eliminate the ts plasmid pKDsgRNA. Make sure that the clone shows the Spec50 sensitivity after streak-purification.
  • 22.
    P1 transduction.
    Note: The CRISPR-edited clone harbors the suppressor mutation on the chromosome. With the suppressor mutation on the chromosome, the P1-transduced cells should grow without the need for Ara or a maintenance plasmid.
    • a.
      Take the purified CRISPR-edited clone and follow steps 14a–14f to do P1 transduction, using P1 lysate for trmD-KO obtained in step 13f. Select colonies on an LB + Kan50 plate supplemented with 5 mM Na-Cit at 37°C.
    • b.
      Follow step 10f to do colony-PCR verification and streak-purify the clone on LB + Kan50 plate at 37°C.
      Optional: To remove the Kan marker at the knockout locus on the chromosome, transform the clone with pCP20 (CGSC, #7629), a FLP recombinase. After selection on an LB + Cm34 plate at 30°C, verify the trmD locus by colony-PCR. Streak-purify the clone twice on an LB plate at 43°C to eliminate the ts plasmid pCP20.
  • 23.
    Validation of suppressor viability.
    • a.
      Grow a single colony of the purified clone in LB + Kan50 at 37°C for 12–16 h.
    • b.
      Inoculate to fresh media at 1:100, and record OD600 over a time course at 37°C.
      Note: Compare growth with a parental KO strain in the Ara+ and Ara− conditions, the latter of which should be generated by a pre-depletion step in the Ara− condition. Suppressor mutants should show a robust growth in the Ara− condition comparable to that of the Ara+ condition. Test other growth conditions as needed (e.g., minimal media).
    • c.
      Alternatively, or in parallel, test the growth rate and the viability of each CRISPR mutant on a solid plate. Take cell cultures at an early-log time point and dilute it to the same OD600 for all suppressors.
    • d.
      Using a 96-well plate, make a serial 10-fold dilution with appropriate media.
    • e.
      Spot 3 μL of each dilution on a solid LB + Kan50 plate.
    • f.
      Incubate each plate at 37°C for 12–16 h or until colonies appear in the spots of higher dilutions.
    • g.
      To determine the viability of each dilution, compare the colony size and the spot mass. To determine the CFU, count the number of colonies at the dilution where colonies are countable and back-calculate based on the fold-dilution.

Expected outcomes

This protocol is designed to identify the core gene that is supported by an essential gene. Using Ec trmD as an example, the protocol describes the isolation of suppressor mutations, all of which are mapped to the single gene proS, indicating that the m1G37-tRNA methyl transferase encoded by Ec trmD is primarily supporting the prolyl-aminoacylation activity encoded by proS. Thus, although Ec trmD is required for cell viability throughout the entire elongation cycle of protein synthesis, it is most critical for the proS-encoded prolyl-aminoacylation of isoacceptors of tRNAPro. This support for proS as the core gene of Ec trmD establishes the limit of cell viability. It is different from the support of Ec trmD for other aminoacyl-tRNA synthetase genes, such as leuS or argS. In the latter case, while aminoacylation also benefits from the presence of m1G37 in the cognate isoacceptors,6 this benefit does not establish cell viability. For other essential genes, the suppressor screen described here may reveal a hierarchical order of core genes, where the most critical core gene would contain the greatest majority of suppressor mutations. Additional enzymatic and genetic analysis will be necessary to confirm this prediction.

Limitations

This protocol is based on the Gram-negative bacterium E. coli, which has a well-established set of genetic tools. The concept and practical application of the protocol is most readily applicable to the Gram-positive B. subtilis, which also has a well-established set of genetic tools. In contrast, the available genetic tools are more limited in other bacterial species, requiring the development of species-specific adaptation and optimization of the protocol.

Notably, while the core reactions are likely conserved throughout the bacterial domain, individual species can vary in profiles of gene expression and metabolism. For example, while our study identifies that proS is the most critical core gene of Ec trmD, there is an additional and differential effect of Ec trmD on various isoacceptors of tRNAPro.1 Because bacterial species differ in the distribution of isoacceptors of tRNAPro, this emphasizes the importance to test and verify the relationship between proS and Ec trmD in a different bacterial strain. Thus, depending on the choice of the different bacterial strain, it becomes imperative to develop the necessary genetic tools for the species of interest.

Troubleshooting

Problem 1

Difficulty in cloning (steps 1–6).

Potential solution

The cloning method is not limited to the conventional restriction digestion/ligation method. An alternative way is the in vitro recombination method such as Gibson assembly (NEB). All the plasmid constructions described here can be achieved by this method using primers properly designed according to instructions provided (https://www.neb.com/applications/cloning-and-synthetic-biology/dna-assembly-and-cloning/gibson-assembly).

Problem 2

Difficulty in observing growth defect upon turning off the essential gene expression from the maintenance plasmid (step 12).

Potential solution

Each essential gene has a specific expression level, and the gene product has a specific protein stability and functions. This leads to different amount of time required for a suppressor to show the growth defect. For example, proteins for cell structure need to be made constantly during cell division, so their elimination will affect cell viability immediately. In contrast, TrmD synthesizes m1G37-tRNAs, which are stable and can be used and re-used in multiple elongation cycles to support cell viability. Thus, elimination of TrmD in the trmD-KO strain does not arrest growth immediately. Instead, we show here that adding the degron tag to TrmD or expressing the human counterpart Trm5 accelerates growth arrest. Thus, the growth arrest of each KO of an essential gene needs to be titrated. This requirement is also to problem 4 below.

Problem 3

Difficulty in applying the technique to other species (steps 15 and 16).

Potential solution

Although the concept of the protocol described here should be applicable to other bacterial species, there will be limitations that require modifications, optimizations, and titrations. For instance, we have observed that the pKD46-Ec trmD maintenance plasmid is difficult to remove from Vibrio cholerae, also a Gram-negative bacterial strain. We find that it is necessary to remove the plasmid from suppressor clones using a chemical method with acridine orange. This is important to exclude suppressor mutants that arise due to leaky expression from the maintenance plasmid.

Problem 4

Difficulty in obtaining suppressor mutants (step 16).

Potential solution

Bacterial cells respond to each essential gene KO by a time-dependent differential loss of the gene products (e.g., TrmD of Ec trmD and m1G37-tRNA of TrmD). Thus, a gene-specific time course is required to reduce growth and to incur occurrence of suppressor mutations. If suppressor colonies are not found on the screening plate, repeat cycling of growth and dilution until no visible growth in the culture. A second solution is to prolong the incubation time of the screening plates. A third solution is to increase the size of the culture in the non-permissive condition to increase the occurrence of suppressor mutations. Notably, mutagen treatment to induce suppressor mutations is not recommended, due to the potential bias resulting from each mutagen.

Problem 5

Difficulty in generating CRISPR reconstruction mutants (steps 18–20).

Potential solution

The solution is to select a different PAM site and a different sgRNA sequence. In our experience, the success rate is highly dependent on the PAM site and the sgRNA sequence. Although other factors, such as the induction level of λ Red recombinase or donor DNA sequence, may also help, they are less effective as compared to the choice of the sgRNA sequence. Available sgRNA sequences can be found by webtools such as CRISPR-ERA12 (http://crispr-era.stanford.edu/).

Resource availability

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Ya-Ming Hou (ya-ming.hou@jefferson.edu).

Materials availability

Plasmids and bacterial strains generated in this study and referred to in the published work1 will be available through the lead contact, Ya-Ming Hou (ya-ming.hou@jefferson.edu).

Acknowledgments

This work is supported by the grant award R35 GM134931 to Y.-M.H. from the National Institutes of Health, United States.

Author contributions

Conceptualization, I.M., Y.-M.H.; methodology, I.M., Y.-M.H.; validation, I.M., Y.-M.H.; investigation, I.M.; resources, Y.-M.H.; writing – original draft, I.M.; writing – review & editing, I.M., Y.-M.H.; visualization, I.M., Y.-M.H.; supervision, Y.-M.H.; project administration, Y.-M.H.; funding acquisition, Y.-M.H.

Declaration of interests

The authors declare no competing interests.

Contributor Information

Isao Masuda, Email: isao.masuda@jefferson.edu.

Ya-Ming Hou, Email: ya-ming.hou@jefferson.edu.

Data and code availability

Additional datasets and codes are available in the published work.1

References

  • 1.Masuda I., Yamaki Y., Detroja R., Tagore S., Moore H., Maharjan S., Nakano Y., Christian T., Matsubara R., Lowe T.M., et al. tRNA methylation resolves codon usage bias at the limit of cell viability. Cell Rep. 2022;41 doi: 10.1016/j.celrep.2022.111539. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Hou Y.M., Matsubara R., Takase R., Masuda I., Sulkowska J.I. TrmD: a methyl transferase for tRNA methylation with m(1)G37. Enzymes. 2017;41:89–115. doi: 10.1016/bs.enz.2017.03.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Gamper H., Li H., Masuda I., Miklos Robkis D., Christian T., Conn A.B., Blaha G., Petersson E.J., Gonzalez R.L., Jr., Hou Y.M. Insights into genome recoding from the mechanism of a classic +1-frameshifting tRNA. Nat. Commun. 2021;12:328. doi: 10.1038/s41467-020-20373-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Gamper H., Masuda I., Hou Y.M. Genome expansion by tRNA +1 frameshifting at quadruplet codons. J. Mol. Biol. 2022;434 doi: 10.1016/j.jmb.2021.167440. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Gamper H.B., Masuda I., Frenkel-Morgenstern M., Hou Y.M. Maintenance of protein synthesis reading frame by EF-P and m(1)G37-tRNA. Nat. Commun. 2015;6:7226. doi: 10.1038/ncomms8226. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Masuda I., Hwang J.Y., Christian T., Maharjan S., Mohammad F., Gamper H., Buskirk A.R., Hou Y.M. Loss of N(1)-methylation of G37 in tRNA induces ribosome stalling and reprograms gene expression. Elife. 2021;10 doi: 10.7554/eLife.70619. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Datsenko K.A., Wanner B.L. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA. 2000;97:6640–6645. doi: 10.1073/pnas.120163297. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Pope B., Kent H.M. High efficiency 5 min transformation of Escherichia coli. Nucleic Acids Res. 1996;24:536–537. doi: 10.1093/nar/24.3.536. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Carr A.C., Taylor K.L., Osborne M.S., Belous B.T., Myerson J.P., Moore S.D. Rapid depletion of target proteins allows identification of coincident physiological responses. J. Bacteriol. 2012;194:5932–5940. doi: 10.1128/JB.00913-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Christian T., Evilia C., Williams S., Hou Y.M. Distinct origins of tRNA(m1G37) methyltransferase. J. Mol. Biol. 2004;339:707–719. doi: 10.1016/j.jmb.2004.04.025. [DOI] [PubMed] [Google Scholar]
  • 11.Reisch C.R., Prather K.L. Scarless Cas9 assisted recombineering (no-SCAR) in Escherichia coli, an easy-to-use system for genome editing. Curr. Protoc. Mol. Biol. 2017;117:31-8.1–31.8.20. doi: 10.1002/cpmb.29. [DOI] [PubMed] [Google Scholar]
  • 12.Liu H., Wei Z., Dominguez A., Li Y., Wang X., Qi L.S. CRISPR-ERA: a comprehensive design tool for CRISPR-mediated gene editing, repression and activation. Bioinformatics. 2015;31:3676–3678. doi: 10.1093/bioinformatics/btv423. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Additional datasets and codes are available in the published work.1


Articles from STAR Protocols are provided here courtesy of Elsevier

RESOURCES