Bcl-x short-isoform is essential for maintaining homeostasis of multiple tissues

Summary

BCL-2-like protein 1 (BCL2L1) is a key component of cell survival and death mechanisms. Its dysregulation and altered ratio of splicing variants associate with pathologies. However, isoform-specific loss-of-function analysis of BCL2L1 remains unexplored. Here we show the functional impact of genetically inhibiting Bcl-x short-isoform (Bcl-xS) in vivo. Bcl-xS is expressed in most tissues with predominant expression in the spleen and blood cells in mice. Bcl-xS knockout (KO) mice show no overt abnormality until 3 months of age. Thereafter, KO mice develop cardiac hypertrophy with contractile dysfunction and splenomegaly by 6 months. Cardiac fibrosis significantly increases in KO, but the frequency of apoptosis is indistinguishable despite cardiomyopathy. The Akt/mTOR and JNK/cJun signaling are upregulated in male KO heart, and the JNK/cJun is activated with increased Bax expression in KO spleen. These results suggest that Bcl-xS may be dispensable for development but is essential for maintaining the homeostasis of multiple organs.

Graphical abstract

Highlights

• •Bcl-xS is essential for maintaining the multiple-tissue homeostasis
• •Isoform-specific inhibition of Bcl-x short-isoform (Bcl-xS) results in cardiomyopathy and splenomegaly
• •Alternative splicing of Bcl2l1 may play a critical role in cardiosplenic network

Cardiovascular medicine; Cell biology; Developmental biology

Introduction

Bcl-2 family of proteins plays a central role in regulated cell death.^1,2,3 Loss of anti-apoptotic Bcl-2 family proteins, including Bcl-2 and Bcl-2-like protein 1 (BCL2L1), results in embryonic or early postnatal death with massive cell death.^4,5,6 Mice that have restricted ability to undergo apoptosis by combined genetic deletions of pro-apoptotic Bcl-2 family proteins, including Bax, Bak, and Bok, die perinatally with multiple developmental defects with hyperplasia in some tissues.^7,8,9 These loss-of-function studies indicate the crucial roles of the Bcl-2 family of proteins in cell survival and death with distinct but partially overlapped functional properties, which are essential for normal development and maintaining tissue homeostasis.

The expression level of BCL2L1 is associated with the progression of multiple types of cancer and cardiovascular disease in humans. Notably, the Bcl2l1 gene produces transcript variants. Bcl-x long (Bcl-xL) is a major isoform of BCL2L1 and is diffusely expressed in postmitotic cells, including the brain and heart, whereas Bcl-x short (Bcl-xS) is produced by alternative splicing of the 5′ splice site (5′ ss) and is expressed predominantly in cells with a high rate of turnover, such as lymphocytes.¹⁰ Gain-of-function studies by overexpressing one isoform show anti-cell death function of Bcl-xL by maintaining mitochondrial membrane potential^11,12 and pro-cell death function of Bcl-xS by inhibiting functional properties of anti-apoptotic Bcl-2 family proteins in vitro.¹⁰ Although these studies indicate the bidirectional functionalities of BCL2L1 proteins in regulating cell viability, an experiment determining the functional impact of isoform-specific genetic inhibition of the Bcl2l1 remains to be explored.

Alternative splicing of the Bcl2l1 precursor mRNA (pre-mRNA) takes place at the 5′ ss, located in exon 2 of Bcl2l1 (Figure 1A), which eliminates the Bcl-2 homology (BH) 1 and partial BH2 domains (Figure 1B). The RNA-binding proteins recognize and bind to the enhancer or silencer elements upstream or downstream of the 5′ ss to regulate alternative splicing events,^13,14 where multiple single nucleotide polymorphisms (SNPs) have been identified and classified as variants of unknown clinical significance.¹⁵ Given the extensive evidence implicating altered expression of BCL2L1 in human pathologies and showing bidirectional functionalities of BCL2L1 variants and the SNPs with unknown relevance, it is crucial to determine the isoform-specific pathophysiological role of BCL2L1 in a loss-of-function model in vivo. To address this issue, we have generated a mouse model with genetic inhibition of Bcl-xS expression. We observed normal embryonic and early postnatal development but, to our surprise, the development of cardiomyopathy and splenomegaly during aging in a sex-dependent fashion by inhibiting Bcl-xS expression. These results suggest that Bcl-xS-isoform of BCL2L1 is dispensable for development but critical for maintaining the homeostasis of multiple tissues, likely through the regulation of inflammation.

Figure 1.

Generation of Bcl-xS knockout (KO) mice

(A) Schematic representation of BCL2L1 pre-mRNA alternative splicing events. Black large arrow indicates translation start site, blue arrow indicates translation stop site, and red arrow indicates 5′ alternative splice site (ss). F and R indicate forward and reverse primers, respectively, which were used for Figures 1C, 1H, and S1. E; exon. CDS; protein coding sequence.

(B) Alternative splicing of BCL2L1 and alternative transcripts with resultant protein domain structures in Bcl-xS and Bcl-xL. The bottom shows the Bcl2l1 coding gene. BH; Bcl-2 Homology domains. TM; transmembrane domain.

(C and D) The PCR products using the cDNA were imaged to visualize and quantify the isoforms by DNA electrophoresis using TapeStation D4150 (C). RNA was isolated from the indicated tissues from 2 male and 2 female mice. Relative expression levels of Bcl-xS and Bcl-xL among the indicated tissues and the ratio of Bcl-xS/Bcl-xL based on the calibrated concentration are shown (D). Data are mean ± SEM.

(E) Single nucleotide mutation from G to C in the 5′ ss to generate Bcl2l1 V126L mutant mice with a CRISPR-CAS9 system.

(F) Schematic representation of CRISPR-CAS9 single nucleotide mutation strategy.

(G) Sequencing results of wild-type (WT+/+), heterozygous (KO/+), and homozygous KO (KO/KO) mice.

(H) The reverse-transcription-polymerase chain reaction (RT-PCR) using complementary DNA synthesized from RNA extracted from the indicated tissues of the 23-day-old homozygous KO and littermate WT mice with the forward and reverse primers shown in Figure 1A. L; Bcl-xL. S; Bcl-xS. See also Figures S1 and S2.

Results

Bcl-xS knockout mice develop normally and are viable with normal fertility

First, we evaluated expression patterns of Bcl-xS and Bcl-xL mRNA in male and female mice, separately. The isoforms were visualized and quantified by DNA electrophoresis using the TapeStation systems with complementary DNA synthesized from RNA extracted from C57BL/6J wild-type (WT) mouse tissues (Figure 1C). To confirm that ∼700 bp and ∼500 bp PCR products are identical to coding DNA sequences (CDS) of Bcl-xL and Bcl-xS, respectively, the PCR products were subcloned into pBluescript and their nucleotide sequences were analyzed using universal T3 primer (Figure S1A). In 8 out of 9 colonies, the ∼500 bp PCR products from WT spleen were identified as Bcl-xS CDS (Figure S1B) and its translated amino acid sequence matched to Bcl-xS-isoform (GenBank: AAA82172.1; UniProtKB: Q64373-2). In 4 out of 5 colonies, the ∼700 bp PCR products from WT spleen were identified as Bcl-xL CDS (Figure S1C). Using high-sensitivity ScreenTape, we found that Bcl-xS mRNA is expressed in almost all tissues with predominant expression in the blood cells, spleen, and colon in males and the blood cells, spleen, colon, and ovary in females (Figures 1C and 1D). In contrast, Bcl-xL mRNA was more equally expressed among all tissues evaluated than Bcl-xS mRNA. The ratio of Bcl-xS/Bcl-xL mRNA, considered as frequency of alternative splicing event, was high in the blood cells, spleen, lung, and brain under the basal condition (Figures 1C and 1D). These results indicate a tissue-specific control of Bcl2l1 alternative splicing events.

To demonstrate the isoform-specific role of BCL2L1 in a genetic loss-of-function model, we generated Bcl-xS knockout (KO) mice by disrupting the 5′ ss in exon 2 of the Bcl2l1 gene. The sequence features of the 5′ splice donor site and the 3′ splice acceptor site indicate that the key conserved nucleotide sequence in the 5′ splice donor site of the Bcl2l1 gene is CAG/GTA, and that guanine in valine 126 of Bcl-xL is the most important nucleobase for 5′ splicing.^16,17 We replaced guanine with cytosine by CRISPR/CAS9 technology, producing a valine 126 leucine mutation, both hydrophobic amino acids (Figures 1E–1G). The Bcl-xS mRNA expression was successfully inhibited by our gene targeting strategy (Figure 1H). The ∼700 bp PCR products from the Bcl-xS KO spleen showed an expected single mutation in the 5′ splice donor site of the Bcl-xL CDS (Figures S1A and S1D). These data confirm that alternative splicing of Bcl-xS is suppressed in KO mice.

Contrary to Bcl2l1-deficient mice, which die around embryonic day 13 with massive cell death and immature lymphocytes,⁴ the homozygous mutant mice were viable and born at the predicted Mendelian ratio with fertility (Figure S2A). Bcl-xS KO mice showed no obvious abnormality in embryonic development (Figures S2B and S2C). These findings indicate that an alternative splicing event of the Bcl2l1 gene that generates Bcl-xS-isoform may be dispensable for normal embryonic development in mice.

Bcl-xS KO mice grow normally in adolescence and early adulthood

We evaluated the systemic impact of Bcl-xS deletion. Body weight was slightly larger in male, but not female, KO mice than in littermate WT mice at 6 months (Figure 2A). Systolic blood pressure was compatible between WT and KO mice in both sexes at 2 and 6 months of age (Figure 2B). Fasting blood sugar level was also similar between WT and KO mice in both sexes at 6 months (Figure 2C). A complete blood count test showed thrombocytopenia in KO mice with a tendency toward an increase in white blood cells in males and a decrease in red blood cells in both sexes, although this tendency was not statistically significant (Figure 2D). These data suggest that Bcl-xS is dispensable for maintaining hemodynamics and glucose metabolism, but body weight and homeostasis of the hematopoietic system are affected by the deletion of Bcl-xS in a sex-dependent manner.

Figure 2.

Male, but not female, Bcl-xS knock-out (KO) mice have larger body weight compared to WT mice

(A) Body weight in male and female mice of the indicated age (months). n shown in the figure. ∗p < 0.05.

(B) Systolic blood pressure (Pes, mmHg) in male and female mice of the indicated age (months).

(C) Fasting blood sugar (FBS) level of 6-month-old mice.

(D) Complete blood count (CBC) test showing the counts of white blood cells (WBC), red blood cells (RBC), and platelets (PLT) in male and female mice. n = 10 (male WT and KO and female WT) and 9 (female KO). p value is shown in the figure. n represents biologically independent replicates. Unpaired t test in the same age and sex. If the data distribution failed normality, the Mann-Whitney U test was performed in the same age and sex. Data are mean ± SEM.

Next, we measured organ weights, which were normalized by tibial length. Despite that the heart has a low level of Bcl-xS mRNA at baseline, heart weight markedly increased from 4 months of age in male, but not female, KO mice (Figures 3A and 3B). Lung weight also increased at 6 months in male and 4 months in female KO mice (Figure 3C). Liver and kidney weights were compatible between WT and KO mice in both sexes (Figures 3D, 3E, and S2D). Notably, splenomegaly was observed at 6 months in male and from 4 months of age in female KO mice (Figures 3F, S2E, and S2F). In contrast, epididymal white adipose tissue decreased at 6 months in KO mice (Figures 3G and S2F). Thymus is an essential organ for maturing lymphocytes, where Bcl2l1 was reported to be highly expressed.¹⁰ However, thymus weight was not altered by the deletion of Bcl-xS in both sexes (Figure 3H). These results indicate that Bcl-xS is essential for maintaining the homeostasis of multiple organs during aging in a sex-dependent manner.

Figure 3.

Bcl-xS knock-out (KO) induces cardiac hypertrophy in male and splenomegaly in both sexes

Organ weight was measured in Bcl-xS KO and the littermate WT mice at 2, 3, 4, and 6 months of age and normalized by tibia length (TL) unless otherwise mentioned (A-H).

(A) Heart weight (HW).

(B) Gross appearance of the hearts at the indicated age (month). M; months.

(C) Lung weight.

(D) Liver weight.

(E) Kidney weight.

(F) Spleen weight.

(G) epididymal white adipose tissue (eWAT) weight.

(H) Thymus weight. n represents biologically independent replicates. Unpaired t test in the same age and sex. If the data distribution failed normality, the Mann-Whitney U test was performed. ∗∗∗p < 0.001, ∗∗p < 0.01, and ∗p < 0.05. Data are mean ± SEM. See also Figure S2.

Deletion of Bcl-xS results in cardiac hypertrophy and heart failure

Since cardiac pathology develops in adulthood (older than 4–6 months) of Bcl-xS KO mice, we further examined cardiac phenotypes more thoroughly by echocardiography and pressure-volume loop analysis. There was no difference in heart rate between WT and KO mice of both sexes (Figure 4A). Left ventricular (LV) systolic function strikingly decreased in both male and female KO mice at 6 months (Figures 4B and S3), accompanied by increased LV diameter in male, but not female, KO mice (Figures 4C and 4D). Cardiac hypertrophy developed after 4 months of age in KO male, but not female, mice, as evidenced by increased interventricular septum thickness in diastole (IVSd) and LV mass (Figures 4E and 4F). Diastolic function, as assessed by LV diastolic time constant, Tau, was decreased at 6 months in both sexes (Figure 4G). End-diastolic LV pressure was increased in KO male, but not female, mice (Figure 4H). These findings indicate that Bcl-xS KO male mice develop cardiomyopathy with hypertrophy, cardiac remodeling, and heart failure with reduced ejection fraction, while Bcl-xS KO female mice develop systolic and diastolic dysfunction in the absence of obvious hypertrophy and heart failure.

Figure 4.

Bcl-xS knock-out (KO) mice develop cardiac dysfunction in adulthood (6 months ∼)

Cardiac function was measured by echocardiography (A-F) and pressure-volume loop analysis (G-H).

(A) Heart rate (HR).

(B) Ejection fraction (EF).

(C) Left ventricular end-diastolic diameter (LVDd).

(D) Left ventricular end-systolic diameter (LVDs).

(E) Septal wall thickness at end-diastole (IVSd).

(F) Left ventricular (LV) mass.

(G) Tau (Weiss).

(H) End-diastolic pressure (Ped). n represents biologically independent replicates. Unpaired t test in the same age and sex. If the data distribution failed normality, the Mann-Whitney U test was performed. ∗∗p < 0.01, and ∗p < 0.05. Data are mean ± SEM. See also Figure S3.

Bcl-xS KO mice show cardiac fibrosis and structural disorganization of the spleen

Gross appearance of heart slice stained with Hematoxylin and Eosin (H&E) reconfirmed hypertrophy, as evidenced by increased wall thickness in Bcl-xS KO heart (Figures 5A, 5B, and S3B). The spleen of 6-month-old WT mice preserved normal morphology, including the red and white pulp with uniformly encircled by the marginal zones, while that of 6-month-old KO mice showed a high degree of distortion and diffusion of the marginal zones and enlarged germinal centers (Figures 5C and S3C). The structural disorganization of the spleen was observed to an equal degree in male and female KO mice. Wheat Germ Agglutinin (WGA) staining showed enlarged individual cardiomyocytes in the heart of KO male, but not female, mice (Figure 5D), indicating that a Bcl-xS deletion induces cardiac and cardiomyocyte hypertrophy in a sex-specific manner. Cardiac fibrosis remarkably increased in both male and female KO hearts (Figure 5E). Taken together, these findings indicate that Bcl-xS is critical for maintaining cardiac function and splenic morphology in both male and female mice and for controlling heart size only in male mice.

Figure 5.

Bcl-xS knock-out (KO) mice develop cardiac hypertrophy and fibrosis

(A) Heart sections of the WT and KO mice stained with hematoxylin and eosin (H&E).

(B) H&E staining of the WT and KO mouse hearts. Scale bar, 100 μm.

(C) H&E staining of the spleen. Arrows indicate marginal zones. Asterisks indicate germinal centers. WP, white pulp; RP, red pulp. The spleen of the 6-month-old WT mice showed normal morphology, including the red pulp and the white pulp ,WP areas with uniformly encircled by the marginal zones, while that of the 6-month-old KO mice showed a high degree of distortion and diffusion of the marginal zones and enlarged germinal centers. Scale bar, 200 μm.

(D) Wheat Germ Agglutinin (WGA) staining of the heart sections from the 6-month-old mice (n = 6). Scale bar, 50 μm.

(E) Picric acid Sirius red (PASR) staining of the heart sections from the 6-month-old mice (n = 6). Scale bar, 200 μm. n represents biologically independent replicates. p value is shown in the figure. Unpaired t test in the same age and sex. If the data distribution failed normality, the Mann-Whitney U test was performed. Data are mean ± SEM. See also Figure S3.

The level of apoptosis is similar in the heart between Bcl-xS KO and WT mice

Since BCL2L1 is a key regulator of cell survival and death, we evaluated protein expression levels critical for apoptosis by immunoblots. We found decreased expression of Bcl-xL and Bax (male) or Bak (female) in KO hearts (Figures 6A, 6C, S4A, and S4C), while Bax (both sexes), Bak (female), and Bid (female) expression was increased in KO spleens (Figures 6B, 6C, S4B and S4C). Notably, cleaved caspase 3 and 9 expression levels were not significantly altered by inhibition of Bcl-xS in both the heart and spleen (Figures 6A–6C and S4A–S4C). In line with these findings, the percentage of TUNEL-positive nuclei was comparable between WT and KO hearts (Figures 6D, 6E, and S4D).

Figure 6.

Apoptotic rate is not significantly altered by the deletion of Bcl-xS in the heart

Apoptotic signaling was assessed in the heart and spleen of the 6-month-old male mice.

(A–C) Representative immunoblots from three independent heart and spleen lysates probed with the indicated antibodies and densitometric analyses of proteins relative to tubulin are shown. Equal amounts of protein were loaded. Densitometric analyses are shown in (C). n shown in the figure.

(D and E) Representative terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) staining of the heart sections from 6-month-old male mice and quantification analysis of the TUNEL positive nuclei (n = 6). Scale bar, 50 μm. Individual points represent independent heart samples. n represents biologically independent replicates. Unpaired t test in the same age and sex. If the data distribution failed normality, the Mann-Whitney U test was performed. ∗∗p < 0.01, and ∗p < 0.05. Data are mean ± SEM. See also Figures S4–S6.

Despite the development of cardiomyopathy in Bcl-xS KO mice, the frequency of apoptosis in the KO heart was similar to that of the WT heart, suggesting that cell death pathways are inhibited by the deletion of Bcl-xS in the heart. However, it remains unknown whether Bcl-xS induces cell death in cardiomyocytes in a manner similar to that of other cell types. To gain further insight into a cell-type specific role of Bcl-xS, we generated adenovirus (Ad-) harboring Bcl-xS (Ad-Bcl-xS, Ad-Flag-Bcl-xS, and Ad-yellow fluorescent protein (YFP)-Bcl-xS) using the in-fusion cloning technique (Clontech/Takara) for overexpression of Bcl-xS isoform in primary rat neonatal cardiomyocytes in vitro. Cardiomyocytes transduced with Ad-Flag-Bcl-xS significantly reduced viability, as assessed by CellTiter-Blue cell viability assay (Figures S5A and S5B). LIVE/DEAD cell assay showed that cell death increased in cardiomyocytes transduced with Ad-Bcl-xS compared with those transduced with Ad-LacZ or Ad-Bcl-xL, as evidenced by increased red color in the nucleus of Bcl-xS expressing cardiomyocytes (Figure S5C). Furthermore, Tetramethylrhodamine methyl ester (TMRM) assay displayed a reduction in mitochondrial membrane potential in cardiomyocytes transduced with Ad-Bcl-xS compared with those transduced with Ad-LacZ or Ad-Bcl-xL (Figure S5D). Bcl-xS was sufficient to increase the protein expression of cleaved caspase 3 (Figure S5E). Cardiomyocytes transduced with Ad-YFP-Bcl-xS increased PI-positive rates, as demonstrated by flow cytometry analysis (Figures S5F and S5G). Electron microscopy study showed swollen and rupturing mitochondria in cardiomyocytes transduced with Ad-YFP-Bcl-xS (Figure S5H). Finally, Bcl-xS decreased oxygen consumption rate (OCR), ATP production, and maximal respiratory capacity in cardiomyocytes (Figures S5I–S5L). These results indicate that increased expression of Bcl-xS induces apoptotic and necrotic cell death and mitochondrial dysfunction in cardiomyocytes in a manner similar to those of other cell types. Together with the finding that apoptotic rate little increased in loss-of-Bcl-xS-induced cardiomyopathy, these data suggest that inhibition of Bcl-xS expression can repress cell death pathways in cardiomyopathy.

We replaced guanine with cytosine in Valine 126 to inhibit the 5′ alternative splicing of the Bcl2l1 gene in the Bcl-xS KO mice, which produces a valine 126 leucine mutation. Although both amino acids are hydrophobic and this mutation should have the least possible effect on a protein structure, a lower expression level of Bcl-xL protein specifically in KO hearts than that in WT hearts (Figures 6A, 6C, S4A, and S4C) raised the possibility that a V126L mutation of Bcl-xL might alter the protein stability of Bcl-xL. To this end, we generated a Bcl-xL-V126L mutant. YFP-Bcl-xL-WT and -V126L mutants were expressed in H9C2 heart myoblasts (Figure S6A). Both WT and V126L mutant Bcl-xL proteins were diffusely expressed in the cytosol (Figure S6B). Next, the H9C2 cells expressing either YFP-Bcl-xL-WT or -V126L mutant were treated with cycloheximide (CHX) for 24 h to inhibit protein synthesis. CHX treatment decreased the protein amounts of YFP-Bcl-xL-WT and -V126L mutant at a similar level (Figure S6C). In support of this, the expression level of Bcl-xL protein is not altered in the spleen, liver, and blood cells (Figure S6D). In addition, the Bcl2l1 mRNA expression is not significantly changed in the heart and spleen (Figure S6E). These findings suggest that a V126L mutation itself does not affect the subcellular localization and protein stability of Bcl-xL and a lower expression level of Bcl-xL protein in KO hearts might be due to an inhibition of Bcl-xS expression.

Akt-mTOR and JNK pathways are activated in KO male mice

Finally, we evaluated the signaling pathways related to cell growth and inflammation in the heart and spleen of 6-month-old mice. Phosphorylation of Akt at Ser473 was increased in KO male hearts, along with increases in inhibitory phosphorylation of GSK-3α/β at Ser21/Ser9 (Figures 7A and 7C). In contrast, GSK-3α/β was activated in KO male spleens, as evidenced by decreased Ser21/Ser9 phosphorylation (Figures 7B and 7C). Further, phosphorylation levels of 4EBP and p70S6K increased in KO male hearts, but not spleens (Figures 7D–7F), indicating that the Akt-mTOR pathway is activated, which may contribute to the development of cardiac pathological hypertrophy in KO male hearts. Then, we investigated the three major mitogen-activated protein kinase (MAPK) pathways. Extracellular signal-regulated kinase (ERK) was activated only in the KO male spleen (Figures 7A–7C). The p38MAPK expression level was not altered in both the heart and spleen, but the c-Jun N-terminal kinase (JNK) pathway was remarkably stimulated in both the heart and spleen of Bcl-xS KO mice, which may contribute to inflammation and cell growth. In contrast, in line with the finding that KO female mice lack cardiac hypertrophy, the Akt-mTOR and JNK pathways were not activated in KO female hearts (Figures S4E–S4G). Phosphorylation of cJun increased in KO spleens, similar to that in male mice. Taken together, these results suggest that the Akt-mTOR and JNK-cJun signaling are activated in KO male hearts, which may promote cardiac pathological hypertrophy and fibrosis, and that activation of GSK-3α/β and/or JNK may contribute to splenomegaly in Bcl-xS KO mice.

Figure 7.

Hypertrophy and inflammation signaling pathways in the heart and spleen of Bcl-xS knock-out (KO) and WT mice

Hypertrophic signaling, including the Akt-GSK-3, MAPK, and mTOR signaling, was evaluated in the heart and spleen of the 6-month-old male mice.

(A–F) Representative immunoblots from three independent heart (A and D) and spleen (B and E) lysates probed with the indicated antibodies and densitometric analyses (ratio of phosphorylated relative to total proteins, C and F) are shown. n shown in the figure. n represents biologically independent replicates. Unpaired t test in the same age and sex. If the data distribution failed normality, the Mann-Whitney U test was performed. ∗∗∗∗p < 0.0001, ∗∗∗p < 0.001, ∗∗p < 0.01, and ∗p < 0.05. Data are mean ± SEM. See also Figures S4 and S6.

Discussion

We generated isoform-specific Bcl-xS KO mice for phenotypic analysis by introducing a single nucleotide mutation in 5′ ss, located in exon 2 of the Bcl2l1 gene, with CRISPR/CAS9 technology. The current loss-of-function study showed the physiological significance of Bcl-xS in mice in vivo. The data presented here indicate that Bcl-xS may be dispensable for normal embryonic development, but inhibition of Bcl-xS progressively induces morphological and functional changes, likely through inflammation, in multiple tissues, including the heart and spleen. Our study indicates the essential role of Bcl-xS in maintaining tissue homeostasis during aging in a sex-dependent manner.

Overexpression of Bcl-xL shows anti-apoptotic function of Bcl-xL, whereas that of Bcl-xS acts as pro-cell death in some types of cells in vitro. Systemic deletion of the BCL2L1 protein, including both isoforms of Bcl-xL and Bcl-xS, results in embryonic lethal around embryonic day 13 with massive cell death in postmitotic immature neurons and hematopoietic cells.⁴ Given that Bcl-xS KO mice develop normally, BCL2L1 KO mice die likely through a Bcl-xS-independent mechanism. Conditional deletion of BCL2L1 in the hematopoietic system using MMTV-Cre induces hyperplasia of immature erythroid cells, anemia, and splenomegaly.¹⁸ Increased death of erythroid cells is independent from Bax function, as demonstrated by conditional double KO of BCL2L1 and Bax. The deletion of BCL2L1 in macrophages with LysM-Cre increases susceptibility to apoptosis, leading to the depletion of tissue macrophages and atherosclerotic plaque development and vulnerability in ApoE−/− mice.¹⁹ In contrast, conditional deletion of BCL2L1 in T lymphocytes by Lck-Cre exhibits normal T-dependent immune response, indicating the dispensable role of BCL2L1 for generation of effector and memory T lymphocytes.²⁰ Y15C and I182N mutations in Bcl2l1 gene destabilize the Bcl-xL protein, leading to activation of pro-apoptotic protein Bak and thrombocytopenia.²¹ Although a V126L mutation little affects the stability of Bcl-xL protein (Figure S6C) and the Bcl-xL protein level in the blood cells (Figure S6D) in our mouse model, the Bcl-xS KO mice have thrombocytopenia (Figure 2D), indicating that Bcl-xS may be critical for maintaining homeostasis of platelets or hematopoietic cells. These results highlight the relevance of BCL2L1 in the development and maintenance of tissue homeostasis in vivo in a tissue or cell-type-specific manner. However, there remains a question as to how Bcl-xL protein decreases in the heart. It may be possible that the stability of Bcl-xL protein may depend on certain expression levels of Bcl-xS in a tissue-dependent manner. Given the bidirectional functionalities of Bcl-xL and Bcl-xS, these findings further indicate the importance of determining the isoform-specific functional significance of BCL2L1 in vivo.

The phenotype of Bcl-xS KO mice partially resembles that of BCL2L1 conditional KO mice, including splenomegaly, which may be explained to some extent by tissue-specific expression patterns of Bcl2l1 gene. In addition, increased pro-apoptotic Bax, Bak, and Bid proteins and JNK signaling may contribute to inflammation and splenomegaly in Bcl-xS KO mice. It should be noted, however, that pathological hypertrophy and heart failure observed in Bcl-xS KO mice appear unique phenotypes in mouse models with a genetic deletion of a Bcl2 family protein. The MAPK and Akt-mTOR pathways are activated in male KO mice, which should contribute to the development of cardiac hypertrophy.²² It would be interesting to investigate whether there is a common signaling molecule, such as a circulating molecule or immune cells-derived cytokines, upstream of MAPK and Akt-mTOR to activate both pathways in the KO and, if so, to determine the identity. There was no difference in blood pressure between KO and WT mice, suggesting that cardiac hypertrophy observed in Bcl-xS KO male mice is not likely due to pressure overload. Inflammation is a key mechanism to induce pathological hypertrophy.²² Bcl-xS KO mice exhibited cardiac fibrosis with an activated JNK-cJun pathway. Considering the low expression level of Bcl-xS in the heart, our findings suggest inflammation as a potential inducer of pathological hypertrophy in a model of genetic inhibition of Bcl-xS.

We found sex difference in phenotypes of Bcl-xS KO mice. Although tissue expression patterns of Bcl-xS mRNA differ between male and female (Figures 1C and 1D), the distinct expression patterns may not directly associate with sex difference in phenotypes. The Akt-mTOR and MAPK signaling are activated only in male, which correlates with the development of cardiac hypertrophy in male KO mice. Considering the similar ratios of Bcl-xS/Bcl-xL mRNA expression in various tissues between male and female, sex-specific activation of hypertrophic signaling may stem from the protective effect of the female sex against cardiovascular and metabolic diseases.^23,24,25 The combination of genetic, epigenetic, and hormonal influences of biological sex and tissue expression pattern of Bcl-xS should impact on the pathophysiology in Bcl-xS KO mice in a sex-dependent manner.

The increased level of Bcl-xS expression has been reported in human failing hearts compared to donor hearts²⁶ and in ischemia-induced cardiomyopathy in rat.²⁷ These studies clearly showed the correlation between Bcl-xS expression and cardiac dysfunction, although the functional role of Bcl-xS in cardiomyocytes has remained obscure. In our study, apoptotic rate was not increased in the heart of Bcl-xS KO mice despite the development of cardiomyopathy. It should be noted that cell death pathway is activated in the heart in most cases of cardiomyopathy,^22,28,29 suggesting that Bcl-xS may have a cell-killing effect in the heart and suppression of Bcl-xS expression inhibits apoptosis. Further, our in vitro study with adenovirus-mediated expression of exogenous Bcl-xS indicates that upregulation of Bcl-xS is sufficient to induce apoptotic and necrotic cell death in cardiomyocytes in a manner similar to that of other cell types.³⁰

Aberrant expression of BCL2L1 has been implicated in human diseases. For example, deregulated expression of BCL2L1 is associated with polycythemia vera in humans.³¹ The impact of BCL2L1 expression may have been most intensively studied in the cancer area. The deamidation of Bcl-xL through DNA damage reduces the ability of the anti-apoptotic Bcl-xL to inhibit the BH3-only proteins, promoting apoptosis. In patients with chronic myeloid leukemia, Bcl-xL deamidation is suppressed, thereby inhibiting apoptosis.³² The expression level of Bcl-xL highly associates with progression and therapy resistance to numerous cancers, such as colorectal, lung, breast, and hematological cancers.^{33,34,35,36,37,38,39} In addition, the ratio of Bcl-xS to Bcl-xL is also a crucial marker of tumor progression. The Bcl-xS to Bcl-xL ratio was decreased by genetic inactivation of mRNA splicing factor RNA-binding motif 10 (RBM10), suggesting RBM10 as a role of biomarker of poor response to epidermal growth factor receptor (EGFR) inhibitor for cancer treatment.⁴⁰ These studies underscore the importance of the level of BCL2L1 or the ratio of Bcl-xL/Bcl-xS in cancer. Thus, it will be interesting to determine whether and how disruption of Bcl-xS impacts the development and progression of cancer in vivo.

A single gene produces multiple transcripts through alternative splicing, which takes place in ∼95% of human multiexon genes, contributing to proteomic and phenotypic diversities.^16,41,42 Alternative splicing events affect cellular processes, including cell death, cell cycle, and differentiation; thus, dysregulation of alternative splicing results in pathologies, such as developmental defects, the development and progression of cancer, and immune disorders.⁴³ Most of the splicing reactions are performed by the major spliceosome, composed of small nuclear ribonucleoproteins (snRNPs) and non-snRNP protein components. Other than RNA-binding proteins, genetic variants should influence the process of alternative splicing. However, a big gap in knowledge remains as to the functional significance of the majority of alternative splicing events. Given that there are the SNPs reported in the enhancer and silencer elements upstream and downstream of the 5′ ss of Bcl2l1 in humans,¹⁵ it is critical to determine the physiological role of endogenous Bcl-xS in vivo. Our mouse model allowed us to demonstrate the isoform-specific functional impact of inhibiting Bcl-xS independently of Bcl-xL function.

The spleen is the largest lymphoid organ and acts as a reservoir of immune cells. Recent studies suggest that the spleen may regulate heart pathophysiology.⁴⁴ Splenic metabolic activity increases after acute coronary syndrome and positively associates with arterial inflammation and post-infarct cardiac events likely through B lymphocytes. Further, congenital heart disease and splenic abnormality are closely associated with one another. For example, abnormality of T lymphocyte is associated with DiGeorge Syndrome, featuring congenital heart disease. Splenomegaly is observed in 10% of DiGeorge syndrome. Depletion of B lymphocytes reduces myocardial mass and enhances cardiac contractile function in rodents.⁴⁵ Although lymphocytes are one of the most prevalent leukocytes in the naive heart, there is a huge gap in our understanding of the molecular mechanisms that maintain normal heart morphology and function by the spleen. Our findings suggest that the heart and spleen may physiologically communicate with one another, likely in part through Bcl-xS function in immune cells, such as lymphocytes and macrophages, and dysregulation of alternative splicing of Bcl2l1 may disrupt healthy cardiosplenic network. It would be interesting to investigate the mechanisms as to how Bcl2l1-mediated altered activities of immune cells in the spleen and splenic function affect heart morphology and function.

In summary, the current study demonstrates that an alternative splicing event of Bcl2l1 to generate Bcl-xS is dispensable for normal embryonic development but important for maintaining normal morphology and function of the heart and spleen during aging. Loss of Bcl-xS leads to cardiomyopathy and splenomegaly in tissue and sex-dependent mechanisms.

Limitations of study

We acknowledge some limitations in our study. The scope of this study was to demonstrate the impact of genetically inhibiting isoform-specific Bcl-xS expression in mice in vivo. Future efforts could be paid to investigate the underlying mechanisms as to how Bcl-xL expression is decreased only in the heart of KO mice, how some phenotypes observed in KO, including cardiac hypertrophy, develop in a sex-dependent manner, and how the heart and spleen connect with one another in this model.

STAR★Methods

Key resources table

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
rabbit monoclonal Bcl-xL antibody	Cell Signaling Technology	#2764
rabbit cleaved caspase-3 antibody	Cell Signaling Technology	#9661
rabbit cleaved caspase-9 antibody	Cell Signaling Technology	#9507
mouse monoclonal caspase-9 antibody	Cell Signaling Technology	#9508
rabbit monoclonal Bcl-2 antibody	Cell Signaling Technology	#3498
rabbit Bax antibody	Cell Signaling Technology	#2772
rabbit monoclonal Bak antibody	Cell Signaling Technology	#12105
mouse Bid antibody	Cell Signaling Technology	#2003
rabbit monoclonal p44/42 MAPK (Erk1/2) antibody	Cell Signaling Technology	#9102
rabbit monoclonal phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204) antibody	Cell Signaling Technology	#4370
rabbit monoclonal phospho-GSK-3α/β (Ser21/9) antibody	Cell Signaling Technology	#9323
rabbit monoclonal GSK-3α/β antibody	Cell Signaling Technology	#5676
rabbit polyclonal phospho-Akt (Ser473) antibody	Cell Signaling Technology	#9271
rabbit polyclonal Akt antibody	Cell Signaling Technology	#9272
rabbit monoclonal phospho-p38MAPK antibody	Cell Signaling Technology	#4511
rabbit monoclonal p38MAPK antibody	Cell Signaling Technology	#9212
rabbit monoclonal phospho-c-Jun (Ser73) antibody	Cell Signaling Technology	#3270
rabbit monoclonal c-Jun antibody	Cell Signaling Technology	#9165
rabbit monoclonal phospho-4EBP (Thr37/46) antibody	Cell Signaling Technology	#2855
rabbit monoclonal 4EBP antibody	Cell Signaling Technology	#9644
rabbit monoclonal phospho-p70 S6 Kinase (Thr389) antibody	Cell Signaling Technology	#9234
rabbit monoclonal p70 S6 Kinase antibody	Cell Signaling Technology	#9202
rabbit monoclonal GAPDH	Cell Signaling Technology	#5174
rabbit monoclonal GFP antibody	Cell Signaling Technology	#2956
anti-mouse IgG, HRP-linked antibodies	Cell Signaling Technology	#7076
anti-rabbit IgG, HRP-linked antibodies	Cell Signaling Technology	#7074
α-actinin (sarcomeric)	Sigma-Aldrich	#A7811
rabbit monoclonal α-tubulin	Sigma-Aldrich	# T6199
Bacterial and virus strains
Subcloning Efficiency DH5α Competent Cells	Thermo Fisher Scientific	18265017
Adenovirus-human-Bcl-xS	This paper	N/A
Adenovirus-flag-human-Bcl-xS	This paper	N/A
Adenovirus-YFP-human-Bcl-xS	This paper	N/A
Adenovirus-human-Bcl-xL	This paper	N/A
Chemicals, peptides, and recombinant proteins
LipofectamineT`M 2000 Transfection Reagent	Thermo Fisher Scientific	11668-019
2,2,2-Tribromoethanol	Sigma-Aldrich	T48402
Protease Inhibitor Cocktail	Sigma-Aldrich	P8340
Phosphatase Inhibitor Cocktail 3	Sigma-Aldrich	P0044
BOVINE SERUM ALBUMIN, LYOPHILIZED POWDER	Sigma-Aldrich	A9418
TRIzol Reagent	ThermoFisher Scientific	15596-018
Collagenase Type 2 CLS2	Worthington	LS004177
Percoll	GE Healthcare	17-0891-01
Oligomycin	Sigma-Aldrich	O4876
FCCP	Sigma-Aldrich	C2920
Rotenone	Sigma-Aldrich	R8875
Antimycin A	Sigma-Aldrich	A8674
Cycloheximide	Sigma-Aldrich	01810
PfuUltra High-Fidelity DNA Polymerase	Agilent	600385
DpnI	New England BioLabs	R0176S
Mounting Medium with DAPI	Vectashield	LS-J1033
PrimeScript RT Master Mix	Takara	RR036
GoTaq DNA Polymerase	Promega	M3008
In-Fusion cloning	Takara	638947
Ampicillin Sodium Salt	Sigma-Aldrich	A9518
Propidium Iodide	ThermoFisher Scientific	P1304MP
Maxima SYBR Green qPCR master mix	ThermoFisher Scientific	K0253
High Sensitivity D1000 ScreenTape	Agilent Technologies	5067-5584
High Sensitivity D1000 Reagents	Agilent Technologies	5067-5585
Critical commercial assays
XF96 Extracellular Flux Analyzer	Agilent Technologies	https://www.agilent.com/
QIAGEN HiSpeed Plasmid Maxi Kit	QIAGEN	12663
QIAGEN HiSpeed Plasmid Midi Kit	QIAGEN	12643
QIAquick PCR Purification Kit	QIAGEN	28106
QIAquick Gel Extraction Kit	QIAGEN	28706
HI-SPEED MINI PLASMID isolation KIT	IBI Scientific	#IB47101
LIVE/DEAD Viability/Cytotoxicity Kit	ThermoFisher Scientific	L3224
Tetramethylrhodamine methyl ester (TMRM)	ThermoFisher Scientific	T668
Aimstrip plus blood glucose meter kit	VWR	10025-286
CellTiter-Blue Cell Viability assay	Promega	G8080
Deposited data
The mus musculus BCL2-like 1 short (Bcl-xS) mRNA, complete cds	GenBank	OP441372
Source Data	This paper	Data S1
Experimental models: Cell lines
H9C2 cells	ATCC	CRL-1446
HEK293 cells	ATCC	CRL-1573
Experimental models: Organisms/strains
Mouse: C57BL/6J	Jackson Lab	Strain #: 000664
Mouse: Bcl-xS knockout	This paper	N/A
Rat: Primary cultured neonatal ventricular cardiomyocytes	Envigo, Somerville	1-day-old Crl: (WI )BR-Wistar rats
Oligonucleotides
sgRNA CGCGTATCAGAGCTTTGAGC	Millipore	N/A
ssODN template 5’-CAGTGATCTAACA TCCCAGCTTCACATAACCCCAGGGAC CGCGTATCAGAGCTTTGAGCAGcTAG TGAATGAACTCTTTCGGGATGGAGTA AACTGGGGTCGCATCGTGGCCTTTTT CTCCTTTGGCGGGGCACTGTGCGTG GAAAGCGTAGACAAGGAGATG-3’	IDT	N/A
Genotyping primer GACCCAGTAAGTG AGCAGGT	This paper	N/A
V126L site-directed mutagenesis primers. For; CAGAGCTTTGAGCAGCTAGTGAAT GAACTC, Rev; GAGTTCATTCACTAGCTG CTCAAAGCTCTG	This paper	N/A
RT-PCR primers. For; ATTATTATAGAATT Catgtctcagagcaaccggga, Rev; ATTATTAT CTCGAGtcacttccgactgaagagtgagc	This paper	N/A
qPCR primers. Bcl2l1 : For; 5’- CCAGCTT CACATAACCCCAG-3’, Rev; 5’-TCACTTC CGACTGAAGAGTGAGC-3’	This paper	N/A
qPCR primers. GAPDH : For; 5’- TTCTTG TGCAGTGCCAGCCTCGTC-3’, Rev; 5’- TAGGAACACGGAAGGCCATGCCAG-3’	This paper	N/A
Recombinant DNA
pBHGloxΔE1.3 Cre	Microbix	N/A
pDC316-YFP shuttle vector	Sadoshima Lab	Nakamura et al., Cell Metab. 2019 May 7;29(5):1119-1134.e12.46
pDC316-Flag shuttle vector	Sadoshima Lab	Nakamura et al., Cell Metab. 2019 May 7;29(5):1119-1134.e12.46
pDC316-human-Bcl-xS	This paper	N/A
pDC316-Flag-human-Bcl-xS	This paper	N/A
pDC316-YFP-human-Bcl-xS	This paper	N/A
pDC316-human-Bcl-xL	This paper	N/A
pDC316-YFP-human-Bcl-xL-WT	This paper	N/A
pDC316-YFP-human-Bcl-xL-V126L	This paper	N/A
pBluescript II	Sadoshima Lab	Nakamura et al., Cell Metab. 2019 May 7;29(5):1119-1134.e12.46
pDC316 shuttle vector	Microbix	N/A
Software and algorithms
Prism version 9	GraphPad	https://www.graphpad.com
FACSDiva Version 6.1.2 software	BD Biosciences	https://www.bdbiosciences.com/en-us/products/software/instrument-software/bd-facsdiva-software
ChemiDoc MP Imaging System	Bio-Rad	https://www.bio-rad.com/en-us/category/chemidoc-imaging-systems?ID=NINJ0Z15
ApE software	ApE	https://jorgensen.biology.utah.edu/wayned/ape/
NCBI BLASTP	NIH	https://blast.ncbi.nlm.nih.gov/Blast.cgi
ImageJ	NIH	https://imagej.nih.gov/ij/
TapeStation software	Agilent Technologies	https://www.agilent.com/en/product/automated-electrophoresis/tapestation-systems/tapestation-software/tapestation-software-379381
Other
Dulbecco’s modified Eagle’s medium	Gibco	11965092
Dulbecco’s modified Eagle’s medium/F-12	Gibco	11320033
Horse serum	Gibco	26-050-088
Fetal bovine serum	Corning	MT35010CV
The Agilent 4150 TapeStation systems	Agilent Technologies	G2992AA

Resource availability

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Michinari Nakamura (nakamumi@njms.rutgers.edu).

Materials availability

Plasmids and mouse line generated in this study are available from the lead contact upon reasonable request with a completed Materials Transfer Agreement.

Data and code availability

• •Source data for graphs and original western blot images can be found in Data S1. The mus musculus BCL2-like 1 short (Bcl-xS) mRNA, complete cds, data has been deposited at GenBank (accession number: OP441372) and are publicly available as of the date of publication.
• •This paper does not report original code.
• •Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.

Experimental model and subject details

Mice

We generated the Bcl-xS KO mice that have a mutation in V126L using a CRISPR-CAS9 system. Briefly, CRISPR sgRNA CGCGTATCAGAGCTTTGAGC (Millipore) was complexed with HiFi Cas9 (IDT) and electroporated into C57BL/6J zygotes along with a donor ssODN template (IDT) 5’-CAGTGATCTAACATCCCAGCTTCACATAACCCCAGGGACCGCGTATCAGAGCTTTGAGCAGcTAGTGAATGAACTCTTTCGGGATGGAGTAAACTGGGGTCGCATCGTGGCCTTTTTCTCCTTTGGCGGGGCACTGTGCGTGGAAAGCGTAGACAAGGAGATG-3’ (base changed, lower case). Potential founders were screened by PCR and AluI restriction digest, which was introduced by the donor oligo. Founders with the V126L change were confirmed by next generation sequencing (NGS), as shown in Figure 1. Genotyping was performed by Sanger Sequencing using a forward primer (GACCCAGTAAGTGAGCAGGT) to identify the expected mutation (G > C) as shown in Figure 1. C57BL/6J wild-type mice were purchased from the Jackson Laboratory (Strain #: 000664) at 5-8 weeks of age to backcross Bcl-xS KO mice for more than 6 generations. Mice of both sexes were used. Littermate WT mice were used as a control. Mice were housed in a temperature-controlled environment within a range of 21°C - 23°C with 12-hour light/dark cycles, in which they received food and water ad libitum. All protocols concerning the use of animals were approved by the Institutional Animal Care and Use Committee at Rutgers New Jersey Medical School and all procedures conformed to the NIH guidelines (Guide for the Care and Use of Laboratory Animals).

Isolation of primary rat neonatal cardiomyocytes

Primary cultures of ventricular cardiomyocytes were prepared from 1-day-old Crl: (WI )BR-Wistar rats (Envigo, Somerville) and maintained in culture as described previously.⁴⁶ The neonatal rats were deeply anesthetized with isoflurane. The chest was opened and the heart was harvested. A cardiomyocyte-rich fraction was obtained by centrifugation through a discontinuous Percoll gradient. Cardiomyocytes were cultured in complete medium containing Dulbecco’s modified Eagle’s medium/F-12 supplemented with 5% horse serum, 4 μg/ml transferrin, 0.7 ng/ml sodium selenite, 2 g/l bovine serum albumin (fraction V), 3 mM pyruvate, 15 mM Hepes pH 7.1, 100 μM ascorbate, 100 mg/l ampicillin, 5 mg/l linoleic acid, and 100 μM 5-bromo-2’-deoxyuridine (Sigma). Culture dishes were coated with 0.3% gelatin for 6 cm dishes or 6-well plates or 2% gelatin for immunofluorescence staining on chamber slides.

Cell lines

Adenoviruses were generated in HEK293 cells that were purchased from the American Type Culture Collection (ATCC). HEK293 cells were maintained at 37ºC with 5% CO₂ in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum and penicillin/streptomycin. H9C2 cells used for protein stability assay were purchased from the ATCC and were maintained at 37ºC with 5% CO₂ in Dulbecco’s modified Eagle’s medium/Nutrient Mixture F-12 supplemented with 10% fetal bovine serum and penicillin/streptomycin.

Method details

Echocardiography

Mice were anesthetized using 10 μl/g body weight of 2.5% avertin (Sigma-Aldrich), and echocardiography was performed using ultrasound (Visualsonics Vevo 770, Toronto, Canada). It took around 10-20 minutes from the establishment of anesthesia to the completion of echocardiography and 1-2 hours to fully recover from anesthesia after echocardiography. A 30-MHz ultrasound transducer was used. Mice were subjected to 2-dimension guided M-mode measurements of LV internal diameter at the papillary muscle level from the short-axis view to measure heart rate, systolic function (ejection fraction with LV diameter at end diastole (LVDd) and LV diameter at end systole (LVDs)) and wall thickness (Interventricular septal at end diastole (IVSd)), which were taken from at least three beats and averaged. LV ejection fraction was calculated as follows: Ejection fraction = [(LVDd)³ – (LVESD)³]/(LVEDD)³ x 100. LV mass was calculated as follows: LV mass = 1.05 x [(IVSd+LVDd+LVPWd)³ – (LVDd)³].

Pressure-volume (PV) loop analysis

Mice were anesthetized with pentobarbital (60 mg/kg, intraperitoneal injection) and subjected to pressure-volume (PV) loop analyses to measure diastolic and systolic cardiac function. The chest and neck were shaved by clipper and the skin was cleaned using betadine and 70% isopropyl alcohol three times. Mice were then placed in a supine position. The lack of pedal reflex was confirmed prior to making an incision. A small incision (5-10 mm) was made on the neck. Under a dissecting microscope, the right common carotid artery was surgically isolated and clamped proximally and distally. A small incision (0.5-1 mm) was made in the carotid artery, and a 1.4-French pressure-conductance catheter (Millar Instruments) was inserted in the vessel and advanced into the aorta to measure aortic pressure and then into the LV cavity to measure LV pressure; End-systolic pressure (Pes) and End-diastolic pressure (Ped). The relaxation time constant Tau (msec) was calculated as the time constant of exponential pressure decay during isovolumic relaxation by Weiss method. The PV relation and hemodynamics were continuously recorded. After stabilization, the end-systolic PV relation and its slope and the end-diastolic PV relation and its slope were obtained by intermittent occlusion of the inferior vena cava. During the procedure, the depth of anesthesia was monitored by checking pedal reflex periodically to unsure the surgical plane of anesthesia.

Complete blood count measurement

Blood was collected from ventricles using 22-gauge or larger size needle and was immediately transferred into an EDTA anti-coagulated collection tube (Greiner, 95057-299), followed by inversion of tube 8 to 10 times to properly mix sample. The samples were analyzed by HESKA HT5 hematology analyzer with Rutgers In Vivo Research Services at Piscataway.

Immunoblotting

Cardiomyocyte lysates and heart homogenates were prepared in RIPA buffer containing protease and phosphatase inhibitors (Sigma-Aldrich) as described previously.⁴⁷ Lysates were centrifuged at 13,200 rpm at 4°C for 15 minutes. Protein concentrations were determined using a standard bicinchoninic acid (BCA) assay. Total protein lysates (10-30 μg) were incubated with SDS sample buffer (final concentration: 100 mM Tris (pH 6.8), 2% SDS, 5% glycerol, 2.5% 2-mercaptoethanol, and 0.05% bromophenol blue) at 95°C for 5 minutes. The denatured protein samples were separated by SDS-PAGE, transferred to polyvinylidene difluoride membranes by wet electrotransfer, blocked in either 5% (w/v) BSA or 5% (w/v) non-fat dry milk in 1xTBS/0.5% Tween 20 at room temperature for 1 hour, and probed with primary antibodies at 4°C overnight. After washing with 1xTBS/0.5% Tween 20 for 20 minutes, the membranes were incubated with the corresponding secondary antibody at room temperature for 1 hour. After washing with 1xTBS/0.5% Tween 20 for 45 minutes, the membranes were developed with enhanced chemiluminescence (ECL) Western blotting substrate, followed by acquisition of digital image with the ChemiDoc MP Imaging System (Bio-Rad). The intensities of Western blot bands were quantified using ImageJ. Blotting images with uncropped and molecular markers are provided in Supplemental Figure.

Antibodies and reagents

The following commercial antibodies were used at the indicated dilutions: rabbit monoclonal Bcl-xL antibody (#2764) (1:5,000), rabbit cleaved caspase-3 antibody (#9661) (1:2,000), rabbit cleaved caspase-9 antibody (#9507) (1:2,000), mouse monoclonal caspase-9 antibody (#9508) (1:3,000), rabbit monoclonal Bcl-2 antibody (#3498) (1:5,000), rabbit Bax antibody (#2772) (1:6,000), rabbit monoclonal Bak antibody (#12105) (1:4,000), mouse Bid antibody (#2003) (1:5,000), rabbit monoclonal p44/42 MAPK (Erk1/2) antibody (#9102) (1:5,000), rabbit monoclonal phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204) antibody (#4370) (1:5,000), rabbit monoclonal phospho-GSK-3α/β (Ser21/9) antibody (#9323) (1:3000), rabbit monoclonal GSK-3α/β antibody (#5676) (1:5000), rabbit polyclonal phospho-Akt (Ser473) antibody (#9271) (1:4000), rabbit polyclonal Akt antibody (#9272) (1:8000), rabbit monoclonal phospho-p38MAPK antibody (#4511), rabbit monoclonal p38MAPK antibody (#9212) (1:4,000), rabbit monoclonal phospho-c-Jun (Ser73) antibody (#3270) (1:3,000), rabbit monoclonal c-Jun antibody (#9165) (1:3,000), rabbit monoclonal phospho-4EBP (Thr37/46) antibody (#2855) (1:3,000), rabbit monoclonal 4EBP antibody (#9644) (1:3,000), rabbit monoclonal phospho-p70 S6 Kinase (Thr389) antibody (#9234) (1:3,000), rabbit monoclonal p70 S6 Kinase antibody (#9202) (1:3,000), rabbit monoclonal GAPDH (#5174) (1:8,000), rabbit monoclonal GFP antibody (#2956) (1:3,000), anti-mouse or rabbit IgG, HRP-linked antibodies (#7076 and #7074) (1:5,000) (Cell Signaling Technology); and α-actinin (sarcomeric) (#A7811) (1:3,000), rabbit monoclonal α-tubulin (T6199) (1:8,000) (Sigma-Aldrich). Antibodies were diluted in either 5% (w/v) BSA or 5% (w/v) non-fat dry milk in 1xTBS/0.5% Tween 20, depending on the level of background intensity.

Adenovirus constructs

Recombinant adenovirus vector for overexpression was constructed, propagated and titered as previously described.⁴⁶ Briefly, pBHGloxΔE1,3Cre (Microbix), including the ΔE adenoviral genome, was co-transfected with the pDC316 shuttle vector containing the gene of interest into HEK293 cells obtained from the American Type Culture Collection (ATCC). HEK293 cells were maintained at 37ºC with 5% CO₂ in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum and penicillin/streptomycin. Replication-defective human adenovirus type 5 (devoid of E1) harboring full length wild-type human Bcl-xL cDNA (Ad-Bcl-xL) or human Bcl-xS cDNA (Ad-Bcl-xS) with Flag or YFP tag was generated by homologous recombination in HEK293 cells.²⁸ An in-house-generated adenovirus harboring β-galactosidase (Ad-LacZ) or YFP (Ad-YFP) was used as a control. The human Bcl-xS plasmids were generated by In-Fusion cloning (Takara bio). All genes of the interest in pDC316 vector were verified by sequencing.

Electron microscopy experiment

Rat neonatal cardiomyocytes were cultured on 6 cm dishes, transduced with adenoviruses harboring YFP-Bcl-xS or YFP as a control at 37ºC for 48 h, and collected with 0.05% Trypsin-EDTA and 4 ml of PBS. After centrifugation for 5 min at 1,000 rpm at 4ºC, the cardiomyocytes were fixed with modified Karnovsky’s fixative (4% formaldehyde and 2.5% glutaraldehyde containing 8 mM CaCl₂ in 0.1M sodium cacodylate buffer (pH 7.4)). Samples were then dehydrated through a graded series of ethanol and embedded in Epon/SPURR resin (EM Science) that was polymerized at 65ºC overnight. Sections were prepared with a diamond knife on a Reichert-Jung Ultracut-E Ultramicrotome and stained with UrAc (20 min) followed by 0.2% lead citrate (2.5 min). Images were photographed with a Jeol JEM-1200EX electron microscope.

Flow cytometry analysis of propidium iodide (PI)-stained cardiomyocytes

Rat neonatal cardiomyocytes were cultured on 6 cm dishes as described above, and transduced with adenoviruses harboring YFP-Bcl-xS or YFP as a control. Forty-eight hours after transduction, the cardiomyocytes were detached from culture plates with 0.05% Trypsin-EDTA and collected with 4 ml of PBS. After centrifugation for 5 min at 1,000 rpm at 4ºC, the cardiomyocytes were resuspended in 1 ml of PBS and 200 μl of the aliquots was stained with PI (final concentration 0.05 mg/ml) for 5 min at room temperature in the dark. Ten thousand cells from each sample were counted with a BD LSR II Flow Cytometer (BD Biosciences, San Jose, CA, USA). First, we ran a YFP negative sample to identify the YFP negative cells, and then a YFP alone sample to identify the YFP positive cells. Finally, we ran the samples expressing YFP-Bcl-xS or YFP alone as a control with the YFP and PI. The percentage of PI positive in YFP-positive cells were assessed with FACSDiva Version 6.1.2 software (BD Biosciences, San Jose, CA, USA).

Mitochondrial analysis using the seahorse system

The oxygen consumption rate (OCR, pmol/min) in cultured rat neonatal ventricular cardiomyocytes was measured using a Seahorse XF96 Extracellular Flux Analyzer (Agilent Technologies) according to the Installation and Operation Manual from Agilent Technologies. Cardiomyocytes were plated at a density of 40,000 cells/well in 96-well Seahorse assay plates except for background correction wells, followed by transduction with Ad-Bcl-xL, Bcl-xS, or Ad-LacZ for 48 h prior to measurement. One hour prior to the beginning of measurements, the medium was replaced with XF assay medium containing unbuffered DMEM, 5.5 mM glucose, and 1 mM pyruvate, and cardiomyocytes were incubated for 1 hr in a 37ºC incubator without CO₂. After baseline measurements, 1 μM oligomycin, 3 μM carbonyl cyanide 4-(trifluoromethoxy)phenylhydrazone (FCCP), and 1 μM rotenone mixed with 1 μM antimycin A were sequentially injected into each well.

Bcl-xL protein stability assay

Cycloheximide (CHX) chase experiment was performed for evaluating the protein stability. H9C2 cells obtained from the American Type Culture Collection (ATCC) were maintained at 37ºC with 5% CO₂ in Dulbecco’s modified Eagle’s medium/Nutrient Mixture F-12 supplemented with 10% fetal bovine serum and penicillin/streptomycin. H9C2 cells were transduced with either pDC316-YFP-Bcl-xL-WT or pDC316-YFP-Bcl-xL-V126L mutant for 24 h using Lipofectamine 2000 (Thermo Fisher Scientific), followed by incubation with 50ng/ml CHX for 24 h, after which lysates were immediately collected into lysis buffer. The denatured protein lysates were separated by SDS-PAGE. A V126L mutation was obtained by a site-directed mutagenesis using the PfuUltra High-Fidelity DNA Polymerase (Agilent) with the following primers; the forward (CAGAGCTTTGAGCAGCTAGTGAATGAACTC) and the reverse (GAGTTCATTCACTAGCTGCTCAAAGCTCTG), followed by DpnI digestion at 37ºC for 1 h (New England BioLabs). PCR was conducted as the following cycle: denaturing at 95ºC for 2 min, 12 cycles of denaturing at 95ºC for 30 s, annealing at 57ºC for 1 min, extension at 72ºC for 6 min, and a final elongation step of 10 min at 72ºC. The PCR and DpnI digestion products were transformed into MAX Efficiency DH5α Competent Cells (ThermoFisher Scientific). The expected mutation in the plasmid was confirmed by sequencing (Psomagen).

Subcellular localization of YFP-Bcl-xL-WT and -V126L mutant protein

H9C2 cells were cultured on coverslips at 37ºC with 5% CO₂ in Dulbecco’s modified Eagle’s medium/Nutrient Mixture F-12 supplemented with 10% fetal bovine serum and penicillin/streptomycin. H9C2 cells were transduced with either pDC316-YFP-Bcl-xL-WT or pDC316-YFP-Bcl-xL-V126L mutant for 48 h using Lipofectamine 2000 (Thermo Fisher Scientific), followed by fixation in 4% paraformaldehyde for 20 min and washing in PBS 4 x 5 min. Samples were mounted on glass slides with a reagent containing DAPI (VECTASHIELD; Vector Laboratories). Cells were observed under a fluorescence microscope (Eclipse Ti, Nikon or BX51, Olympus).

Reverse transcription polymerase chain reaction (RT-PCR)

Total RNA was harvested from mouse tissues using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. Complementary DNA (cDNA) was synthesized by reverse transcription using 300 ng total RNA with PrimeScript RT Master Mix (Takara RR036). The reverse transcription products (100 ng) were amplified with GoTaq DNA Polymerase (Promega) using the specific primers for mouse Bcl2l1 mRNA; the forward (ATTATTATAGAATTCatgtctcagagcaaccggga) and the reverse (ATTATTATCTCGAGtcacttccgactgaagagtgagc) primers. PCR was conducted as the following cycle: denaturing at 94ºC for 2 min, 32 cycles of denaturing at 94ºC for 30 s, annealing at 57ºC for 45 s, extension at 72ºC for 1 min, and a final elongation step of 8 min at 72ºC. The PCR products were separated via 1.5% agarose gel electrophoresis and digital image was acquired with the ChemiDoc MP Imaging System (Bio-Rad).

Quantitative analysis of the Bcl-x isoforms was conducted using the Agilent TapeStation systems. Appropriate size distribution of RT-PCR products (30 PCR cycles) from cDNA using 10 ng of RNA was analyzed by running PCR products on the Agilent 4150 (G2992AAA) TapeStation System with High Sensitivity D1000 ScreenTape according to the manufacturer’s instructions. Calibrated concentration of the PCR product was obtained by selecting the peaks of upper (1500 bp) and lower (25 bp) marker, followed by selection of the peaks of around 550 bp (Bcl-xS mRNA) and 740 bp (Bcl-xL mRNA), using the TapeStation Analysis Software version 4.1.1 (Agilent Technologies, Inc).

Sequencing analysis of the Bcl-xL and Bcl-xS mRNA from mouse spleen

Total RNA was harvested from mouse spleen using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. Complementary DNA (cDNA) was synthesized by reverse transcription using 300 ng total RNA with PrimeScript RT Master Mix (Takara RR036). The reverse transcription products (50 ng) were amplified with PfuUltra High-Fidelity DNA Polymerase (Agilent) using the specific primers for mouse Bcl2l1 mRNA; the forward (ATTATTATAGAATTCatgtctcagagcaaccggga) and the reverse (ATTATTATCTCGAGtcacttccgactgaagagtgagc) primers. PCR was conducted as the following cycle: denaturing at 95ºC for 2 min, 32 cycles of denaturing at 95ºC for 30 s, annealing at 57ºC for 30 s, extension at 72ºC for 1 min, and a final elongation step of 10 min at 72ºC. The PCR products were separated via 1.5% agarose gel electrophoresis. The Bcl-xL cDNA (mRNA) from the spleen of WT mice, Bcl-xL cDNA (mRNA) from the spleen of KI mice, and Bcl-xS cDNA (mRNA) from the spleen of WT mice were subcloned into pBlueScript II SK(+) vector, followed by transformation into MAX Efficiency DH5α Competent Cells (ThermoFisher Scientific). A single colony was inoculated in 2 mL of Luria Bertani (LB) culture medium and incubated overnight at 37ºC with agitation. Plasmid DNA was isolated using HI-SPEED MINI PLASMID isolation KIT (IBI Scientific #IB47101). The inserter Bcl2l1 cDNA within the plasmid was verified by sequencing with the Universal T3 primer (Psomagen). The sequencing results were aligned with Mus musculus BCL2-like 1 (Bcl2l1), transcript variant 2, mRNA (NM_001289717.1) or Bcl-x short (Mus musculus) (AAA82172.1) using ApE software or NCBI BLASTP.

Quantitative RT-PCR analysis

Total RNA was harvested from mouse heart and spleen using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. Complementary DNA (cDNA) was synthesized by reverse transcription using 480 ng total RNA with PrimeScript RT Master Mix (Takara RR036). Using Maxima SYBR Green qPCR master mix (ThermoFisher Scientific, K0253), real-time RT-PCR was performed under the following conditions: denaturing at 95ºC for 2 min, 40 cycles of denaturing at 95ºC for 15 s, annealing at 58ºC for 15 s, extension at 72ºC for 1 min, and a final elongation step at 72ºC for 10 min. Relative mRNA expression was determined by the ΔΔ-Ct method normalized to the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) level.

Histology analysis

The heart tissue or embryo was washed with PBS, fixed in 4% paraformaldehyde overnight, embedded in paraffin, and sectioned at 10-μm thickness onto a glass slide. After de-paraffinization, sections were stained with wheat germ agglutinin (WGA) for evaluation of the cross-sectional area of cardiomyocytes, TUNEL for evaluation of apoptosis or Hematoxylin and Eosin staining. The tissues were observed under a fluorescence microscope (Eclipse Ti, Nikon or BX51, Olympus). The outline of 100-200 myocytes was traced in each section, using ImageJ software (NIH).

Viability and cell death assays of cardiomyocytes

Rat neonatal ventricular cardiomyocytes were cultured on coverslips and transfected with adenoviruses for 48 h. LIVE/DEAD Viability/Cytotoxicity Kit (ThermoFisher Scientific) was used to determine live-cell and dead-cell population according to the manufacture’s protocol (2 μM calcein-AM and 4 μM EthD-1 working solution in phosphate-buffered saline (PBS)). Tetramethylrhodamine methyl ester (TMRM) (ThermoFisher Scientific) was used to determine the level of mitochondrial functionality according to the manufacture’s protocol (dilution of the 1000x concentrated stock solution in culture medium). Cells were observed under a fluorescence microscope (Eclipse Ti, Nikon or BX51, Olympus).

Quantification and statistical analysis

Data are represented as single data points or dot plots and all values are expressed as mean ± SEM. Statistical analyses were carried out by 2-tailed unpaired Student t test for 2 groups or one-way analysis of variance (ANOVA) followed by the Tukey post-hoc analysis for 3 groups or more unless otherwise stated. If the data distribution failed normality by the Shapiro–Wilk test or Kolmogorov–Smirnov test, the Mann–Whitney U test for 2 groups or Kruskal–Wallis test with the Dunn’s multiple comparison test for 3 groups or more was performed. Multiple group comparisons with time-course were performed by two-way ANOVA and the Tukey post-hoc analysis. The statistical analyses used for each figure are indicated in the corresponding figure legends. No statistical methods were used to predetermine sample size. The sample size was estimated based on data from published studies and pilot experiments. Investigators were blinded to data collection, measurement and analysis. Owing to the nature of the cell culture experiments, randomization of the cell culture samples was not applicable. All experiments are represented by multiple biological replicates or independent experiments. The number of replicates per experiment are indicated in the legends. All experiments were conducted using at least two independent experimental materials or cohorts to reproduce similar results. No sample was excluded from analysis. GraphPad Prism 9 was used for statistical analysis and data visualization. A P-value of < 0.05 was considered significant.

Published: March 16, 2023

Supplemental information

Data S1. Source data used to generate the graphs

Uncropped Western blot images.