Abstract
Listeria contamination in foods of animal origin is one of the most concerning food safety issues. A duplex, SYBR green-based, real-time PCR assay was developed with high-resolution melting analysis-based differentiation of the genus Listeria and Listeria monocytogenes. The primers were designed and tested against other related foodborne pathogens. The assay was optimized for standard parameters in a non-orthogonal fashion and validated following international standards. The LODabs and LOQ of the assay were calculated to be 0.78 and 1.56 ng of the target DNA. The LODrel of the assay was found to be 1% Listeria DNA in background DNA. The assay was evaluated for applicability in artificially spiked samples, providing a 120 CFU/ml detection. The assay was validated with proficiency test samples and also with samples collected for surveillance analysis. This well-established and validated assay can be utilized as a qualitative and quantitative tool for addressing the Listeria contamination in the food safety contexts.
Supplementary Information
The online version contains supplementary material available at 10.1007/s13197-023-05695-2.
Keywords: Genus Listeria, Listeria monocytogenes, Real-time PCR, High resolution melt analysis, Duplex assay
Introduction
Listeria monocytogenes is one of the important foodborne pathogens with significant public health importance. The organism has been implicated in large foodborne outbreaks worldwide, incriminating various food products (Desai et al. 2019). The organism, L. monocytogenes, is regarded as a major, notable foodborne pathogen by the World Health Organization and is associated with high mortality and hospitalization (Kaptchouang Tchatchouang et al. 2020). The organism is a primary concern as it is associated with recalls in the produce supply chain (Desai et al. 2019). Listeriosis plays a crucial role in high-risk groups like elders, infants, and people with compromised immune systems (Barbuddhe et al. 2021).
Listeria contamination has been found to occur palpably in foods of animal origin, including milk, meat, and their products (Maćkiw et al. 2021; Shakuntala et al. 2019). Several aspects of food production and preservation, including the lack of prevention of microbial contamination, serves a significant role in the outbreak of several listeriosis cases (Kaptchouang Tchatchouang et al. 2020). One of the most recent food recalls associated with listeriosis is of chicken products contaminated with L. monocytogenes (CDC 2021). Further epidemiological investigations also identified a total of 18 people from 13 different states infected with L. monocytogenes through the consumption of packed salad (FDA 2021). Since symptoms of listeriosis occur after a delayed amount of time, many methods developed before, lack the potential for early-hand diagnosis.
Currently the genus Listeria consists of 27 species, namely: L. monocytogenes, L. seeligeri, L. ivanovii, L. welshimeri, L. marthii, L. innocua, L. grayi, L. fleischmannii, L. floridensis, L. aquatica, L. newyorkensis, L. cornellensis, L. rocourtiae, L. weihenstephanensis, L. grandensis, L. riparia, L. booriae, L. costaricensis, L. goaensis, L. thailandensis (Barbuddhe et al. 2021), L. valentina (Quereda et al. 2020), L. farberi, L. portnoyi, L. cossartiae, L. rustica, and L. immobilis (Carlin et al. 2021)., and L. ilorinensis (Raufu et al. 2022). The challenge to identify L. monocytogenes occurs with morphological indistinguishability, where differentiation of Listeria species requires sub-typing molecular methods, for which extensive and accurate optimization and validation is required.
Since microbial methods for identification are phenotypic based and can often be affected by sub-varieties and natural variations, molecular methods proffer a significant advantage in terms of precise and sensitive identification (Barbuddhe et al. 2021). The recent advances in the identification of Listeria include the designing of unique, target-specific primers and probes for the detection of individual species of Listeria, especially for L. monocytogenes (Azinheiro et al. 2022). Techniques like PCR technologies (Köppel et al. 2021), whole genome sequencing methods (Pietzka et al. 2019) and isothermal amplification methods (Wachiralurpan et al. 2021) have all been extensively studied for the identification of Listeria. Furthermore, studies using real-time PCR have also been developed, providing both detection and quantitative insights into listeriosis (Amagliani et al. 2021).
High-resolution melt (HRM) analysis, along with real-time PCR, is one of the most critical and emerging techniques in molecular biology (Grazina et al. 2021). HRM method works on analyzing the melt profiles of the amplicons and categorizes them as clusters for easy identification (Grazina et al. 2021). Attributing to the fact that HRM is one of the most prominent methods in single nucleotide polymorphism (SNP) detection, the method can provide precise microbial identification with differentiation of sub-species of closely related genomic profiles (Liu et al. 2017). Studies have been conducted on identifying L. monocytogenes with high-resolution melt analysis, with successful discrimination of different food pathogens (Xiao et al. 2014). Although such methods prevail, scanty studies are available to identify L. monocytogenes precisely, along with an indication of the presence/absence of other species of the Listeria genus (Ledlod et al. 2020; Rodríguez-Lázaro et al. 2004). The objective of the present study was to develop an optimized and well-validated PCR-HRM-based duplex assay in real-time PCR for the simultaneous identification of L. monocytogenes and genus Listeria.
Materials and methods
Place of study
All the experiments in the present study were performed in ISO/IEC 17025: 2017 accredited facility at ICAR - National Meat Research Institute, Hyderabad, India.
Bacterial strain and culture enrichment
Listeria monocytogenes MTCC 1143 (NCTC 11994), obtained from the Institute of Microbial Technology, Chandigarh, India, was used as the reference strain. The traceability of each reference culture was established by bi-directional Sanger sequencing of 16S rRNA barcode gene with Genetic Analyzer 3500 (Applied Biosystems, USA) for the genus-level identification of bacterial pathogens (Vergis et al. 2013) and was compared with reference databases (Suppl. Fig F1). For specificity analysis of the assay, eight closely-related bacterial pathogens other than Listeria spp. were analyzed. The enumeration of Listeria spp. cultures were performed according to the method ISO 11290–2: 2017. A pre-enrichment for 24–26 h at 30 °C in half-Fraser broth was done, followed by selective enrichment in Fraser broth for 24 h at 37 °C. The samples for DNA extraction were taken from the pre-enriched broth. Finally, the Listeria strains were verified by streaking on PALCAM agar (HiMedia, India) and by VITEK 2 bacterial identification system (bioMerieux Inc, USA). Further, for the spike study using artificially contaminated food products, chicken meat sausages were prepared in the Meat Processing Plant of ICAR - National Meat Research Institute, Hyderabad. In all the experiments, cultures at log phase of growth stage have been utilized.
DNA extraction
DNA from the pre-enriched Listeria cultures was extracted using a modified protocol of the thermocold-lysis method (Luo et al. 2019). 2 ml of the enriched, pure culture was centrifuged at 8000 rpm for 5 min at 4 °C (Eppendorf, Germany). The obtained supernatant was discarded, and the pellet was washed thrice with sterile phosphate buffered saline (PBS). The obtained pellet was resuspended in 100 µL of sterile nuclease-free water. Further, it was heated at 85 °C for 10 min and subjected to snap chilling at – 80° C for 10 min. The tube was centrifuged again at 5000 rpm for 5 min, and the obtained DNA was measured for absorbance and concentration using a spectrophotometer (Implen®, USA).
Primer design and in-silico analysis
Species-specific primers for Listeria monocytogenes and genus-specific primers for Listeria genus were designed to use in a dye-based real-time assay. The primers were designed in-house using IDT Primer Quest™ tool, targeting the highly conserved prfA gene (L. monocytogenes) and the prs gene (Listeria genus) (Table 1). The primers were verified for inclusive and exclusive specificity through PrimerBLAST and IDT Primer Quest™ tool. Further, the individual melt temperatures of both primers were verified in silico using IDT Oligo analyzer™ Tool, Oligocalc™ etc. The designed primers were synthesized commercially (Bioserve Biotechnology India Pvt Ltd, Hyderabad, India).
Table 1.
Primer sequences for genus-specific and species-specific pairs utilized for the study
| Primers | Sequences (5′ to 3′) | Reference/Accession |
|---|---|---|
| 1. Listeria genus | (Amplicon size 93 bp) | |
| LG–F | ACAATCACACTTGCTGCTAAAG | Present study |
| LG–R | CATAGCCGGACCTGAAAGAA | |
| 2. Listeria monocytogenes | (Amplicon size 143 bp) | |
| LM–F | CACGAGTATTAGCGAGAACGG | Present study |
| LM–R | GATAACGTATGCGGTAGCCTG |
Standardization of duplex HRM real-time PCR
A SYBR green dye-based real-time PCR assay was standardized in a CFX-96 real-time PCR system (Bio-Rad, USA). The PCR conditions were optimized for primer annealing temperature, combinations of primer concentration and PCR cycle number. The reaction mixture consisted of 5 µL of 2X iTaq Universal SYBR green supermix (Bio-Rad, USA), 0.2 µL of genus-specific primers (forward and reverse; 200 nM), 0.4 µL of species-specific primers (forward and reverse; 400 nM), 2.4 µL of nuclease-free water and 1 µL of DNA template (200 ng per well). The reaction mix was prepared in a 96-well plate and was properly mixed. The plate was sealed using transparent Micro seal® (adhesive seal). The well contents were mixed thoroughly at 300 rpm in Thermomixer™ (Eppendorf, USA) and spun down at 2000 rpm for 5 min (Eppendorf, USA). The PCR reaction was performed using the following conditions: enzyme activation at 95 °C for 5 min, followed by 40 cycles of denaturation at 95 °C for 30 s and annealing/extension at 60 °C for 30 s. A ramp rate of 1.6 °C/s was used in all the experiments. Following this, melt curve analysis was kept at 65 °C to 95 °C at 0.05 s to with an increment of 0.5 °C. The final data were recorded and interpreted with high-resolution melt profiles using Precision™ melt analysis software (Bio-Rad, USA).
Specificity analysis
The specificity of primers was evaluated by in silico analysis as well as by wet-lab experiments. For both the primers, the exclusive specificity was evaluated in silico using 20 closely related species, namely Staphylococcus aureus, Escherichia coli, Salmonella enterica, Staphylococcus haematolyticus, Enterococcus hirae, Serratia plymuthica, Pseudomonas putida, Acinetobacter baumannii, Salmonella typhimurium, Klebsiella pneumoniae, Enterococcus hirae, Clostridium botulinum, Campylobacter jejuni, Vibrio parahaemolyticus, Streptococcus pyogenes, Vibrio cholerae, Shigella, Toxoplasma gondii, Vibrio vulnificus, Coxiella burnetii. Using the other 26 Listeria species, the exclusive specificity of Listeria monocytogenes-specific primers and the inclusive specificity of genus-specific primers were evaluated. The 26 Listeria species namely L. seeligeri, L. ivanovii, L. welshimeri, L. marthii, L. innocua, L. grayi, L. fleischmannii, L. floridensis, L. aquatica, L. newyorkensis, L. cornellensis, L. rocourtiae, L. weihenstephanensis, L. grandensis, L. riparia, L. booriae, L. costaricensis, L. goaensis, L. thailandensis, L. valentina, L. farberi, L. portnoyi, L. cossartiae, L. rustica, L. immobilis and L. ilorinensis were utilized.
Further, the specificity was evaluated using DNA from eight closely related species, including Salmonella abony (ACM 5080), Escherichia coli (ATCC 25922), Salmonella typhimurium (AT 0363), Klebsiella pneumoniae (ATCC 700603), Staphylococcus aureus (ATCC 25923), Clostridium perfringens (ATCC 13124), Campylobacter coli (ATCC 33559) and Campylobacter jejuni (ATCC 0111L). All the species were authenticated through VITEK 2 bacterial identification system before the specificity study (bioMerieux Inc, USA). The DNA was extracted from all the species using thermocold-lysis method. The cross-reactivity of the primers was tested using 100 ng of DNA template from the untargeted species. For inclusive specificity evaluation of the genus-specific primers, DNA isolated from L. innocua (NTCCBAA863), L. seeligeri (NCTC 11856), L. ivanovii (NCTC 11846), L. welshimeri (NCTC 11857), L. grayi (NCTC 10812) & L. goaensis (NTCCBAA350) were tested.
Determination of sensitivity
The sensitivity of the assay in terms of absolute and relative limit of detection (LODabs and LODrel) was established with statistical requirements as per ISO 20395: 2019. The LODabs was evaluated by analyzing a four-fold dilution series of DNA with an initial concentration of 50 ng/µL. The dilutions were as follows: 50, 12.5, 3.125, 0.78, 0.195, 0.048, 0.012 and 0.003 ng/µL. Similarly, LODrel for the duplex assay was evaluated with L. monocytogenes DNA in relative using S. typhimurium DNA as the background species. The DNA mixtures were performed in percentages: 10, 5, 2.5, 1, 0.5%, 0.1, 0.05 and 0.01% of the target DNA in background DNA. The lowest dilution of both absolute and relative series, where a nominal Cq value was obtained along with double inflexion points in HRM analysis, was utilized to calculate LODabs and LODrel with 95% accuracy. Further, regression models were constructed, and the coefficient of correlation and PCR efficiency was calculated by plotting a curve between the log DNA dilution series and the Cq values obtained in the LODabs experiment.
Evaluation of quantification limit
The Limit of Quantification is defined as ‘the lowest quantity of the nucleic acid target sequence per defined volume, that can be quantified with reasonable statistical certainty (with 95% relevance)’. Hence, to cover the lower dynamic range of the assay, 1×, 2×, 3×, and 4× concentrations (in ng of DNA) of the limit of detection (LOD) were evaluated. The coefficient of variation of all the replicates was obtained below 25% with significant statistical certainty.
Spiking of L. monocytogenes in chicken meat sausages
To evaluate the compatibility of the assay, spiking of L. monocytogenes (NCTC 11,994) was performed. The organism was grown aerobically in Brain Heart Infusion broth at 37˚C for 18 h. The culture was adjusted for turbidity to four McFarland Value, which corresponds to 1.2 × 109 CFU/ml. The colony count was performed in ten-fold serial dilutions, and the CFU/ml of the culture was determined.
In order to perform the spike study, plating was done (in duplicates) using ten-fold serial dilutions of the culture and the same dilution series was also utilized for spiking chicken meat sausages (150 mg) prepared in the Meat Processing Plant of ICAR—National Meat Research Institute, Hyderabad. Eight dilution series in ten-fold were utilized for both plating and spiking. DNA was extracted from spiked samples along with non-spiked negative controls. The samples were tested using the developed duplex assay, and the limit of detection in the spiked samples was evaluated and compared against the conventional plating technique.
Validation of the assay using proficiency test samples and retail samples
To evaluate the fitness of the assay, proficiency test samples (2021MF12P1-V2, Envirocare Labs Pvt Ltd, India) were utilized. The assay was also used to test samples submitted for testing to the laboratory (n = 2) and ready-to-eat retail meat samples collected from retail outlets (n = 30). Experiments were performed in duplicates with no-template controls (NTCs), and the results were reported with 95% confidence.
Data acquisition, analysis and statistical considerations
All the data from real-time PCR experiments were analyzed using CFX Maestro™ software (Bio-Rad, USA), followed by high-resolution melt imaging using Precision™ melt analysis software (Bio-Rad, USA). All the experiments were performed in triplicates. Auto-detection of the melt region was done by defining the pre-melt (green slider) and post-melt (red slider) temperature ranges. A default cluster detection value of 50% was set up for clustering according to the melt curve shape, and 0.15 degree was set as the melting temperature (Tm) difference threshold. Statistical analysis were performed using SPSS statistics 22 software (IBM Corp., NY, USA).
Results and discussion
In-silico analysis
To develop and optimize a high-resolution melt (HRM) analysis based on real-time PCR assay for simultaneous detection of L. monocytogenes and Listeria genus, two sets of primers were designed targeting the prfA gene (L. monocytogenes specific—LM primer) and the prs gene (Listeria genus-specific—LG primer). The primers were designed to produce amplicon sizes of 148 bp for LM primer and 93 bp for LG primer. The primers were analyzed in silico for exclusive specificity using PrimerBLAST against 20 species. The analysis indicated that the primers were highly specific to the intended L. monocytogenes and Listeria genus. The genus primers were also tested against 26 Listeria species, which indicated the primer’s high inclusive specificity. The Listeria monocytogenes-specific primers were also tested for exclusive specificity, where the in silico analysis was tested negative against the other Listeria species.
Further, the melt temperature of individual amplicons was evaluated in silico using OligoCalc™ and OligoAnalyzer™ tools (Integrated DNA Technologies, USA), wherein a difference of 3 °C in Tm was shown between the two amplicons. The primers were utilized further for standardizing a duplex real-time assay followed by high-resolution melt analysis.
In-vitro specificity evaluation
The specificity of the primers was also evaluated with laboratory experiments against eight closely related species. The results indicated no amplification of the cross-reacting species and amplification with Listeria, indicating the high specificity of the LG and LM primers (Suppl. Table T1).
Optimization of duplex real-time PCR with high-resolution melt analysis (HRM)
Individual trials for simplex PCR assays were performed before proceeding with duplex PCR-HRM optimization. The results obtained were interpreted using the temperature curve chart as well as the difference curve chart. The charts were normalized initially, and the pre-melt and post-melt regions were fixed. The simplex curve was observed with one inflexion point at 76 °C for LM primer-specific amplicon and 79 °C for LG primer-specific amplicon. Further, the melt curve shape corresponding to both the amplicon was categorized into different clusters, indicating the ability to differentiate the melt temperature in laboratory experiments. Hence, the primers were duplexed, and the real-time assay was optimized for annealing temperature, primer concentration and PCR cycle number.
Our experimental trials were performed with an annealing temperature gradient along with a gradient for LG and LM primer concentration. It was observed that at 60 °C and 200 nM of LG primer and 400 nM of LM primer (Fig. 1), the temperature curve chart provided a double inflexion point (Suppl. Table T2), indicating that the assay optimization was non-orthogonal in design. This asymmetry between concentrations of two primers might be due to the high expressivity of LG primer, which was substantially reduced in concentration to obtain a duplex detection. Further, the duplex assay worked only at 60 °C, since the temperature provided common ground for both the primers to amplify efficiently and express. This can be verified by analyzing the melt temperature profiles of the duplex assay gradient (with 200 nM: 400 nM of LG and LM primers, respectively), where temperatures below 60 °C expressed only the L. monocytogenes-specific primers and temperatures above 60 °C expressed only the genus-specific primers.
Fig. 1.
Temperature curve chart and difference curve chart of gradient annealing temperature experiment, performed with 200 nM of genus-specific primers and 400 nM of species-specific primers. The results portray a double-inflexion point and difference in curve of the pink cluster (single middle curve) at 60.4 °C
Further, 30, 35 and 40 cycle numbers were evaluated, where 35 cycles provided sufficient amplification for rapid and sensitive detection in a duplex fashion. All the trials provided acceptable Cq values and relative fluorescence units.
After optimizing all the parameters, a trial was further conducted with simplex and duplex assays, where the difference in curve of the simplex trial (of LG and LM primers) and duplex trial provided an appreciable difference in clustering, along with auto-assigned colours for easy differentiation.
Sensitivity of the assay
The sensitivity of the assay was determined in terms of LODabs and LODrel. The absolute limit of detection (LODabs) was evaluated for the duplex assay by serially diluting the DNA in four-fold dilutions starting with an initial concentration of 50 ng. The lowest possible LODabs of the duplex assay was 0.78 ng of the target DNA, for both LM and LG primer in the duplex assay (Table 2). This was observed with the high-resolution melt analysis, where the difference in curve was obtained after the fourth dilution with an interpretable colour difference in the clustering from the first four dilutions (Fig. 2). This portrayed the LODabs in duplex as mentioned above, wherein dilutions lesser than LODabs were detected only by the LG primer. This was associated with curve and cluster difference in the difference curve chart below the LODabs, and indicated a shift in the melt curve (loss of one inflexion point, 76 °C). This could also be verified through the temperature curve chart, where dilutions beyond the fourth one (0.78 ng) provided only a single inflexion point belonging to the genus-specific amplicon (LG primer). This might be due to the better specificity and binding efficiency of one primer than the other in the optimized duplex primer concentration and annealing temperature. The obtained LOD was better than the PCR studies reported earlier (Wachiralurpan et al. 2017), proving that the developed assay can be advantageous in detection of microbial pathogens.
Table 2.
Absolute limit of detection (LODabs) of the duplex real-time PCR-HRM assay
| SI. No | DNA Concentration (ng/µl) | Cq values obtained | Duplex detection | Percent confidence |
|---|---|---|---|---|
| 1 | 50 | 17.23 ± 0.15 | + | 98.0 |
| 2 | 12.5 | 19.30 ± 0.33 | + | 98.3 |
| 3 | 3.125 | 21.34 ± 0.15 | + | 98.2 |
| 4 | 0.78 | 22.97 ± 0.37 | + | 99.8 |
| 5 | 0.195 | 24.12 ± 0.31 | − | 100 |
| 6 | 0.048 | 24.68 ± 0.16 | − | 98.5 |
| 7 | 0.012 | 25.50 ± 0.13 | − | 93.5 |
| 8 | 0.003 | 26.14 ± 0.16 | − | 98.5 |
Percent confidence–confidence level of a reaction being assigned to a cluster category
Fig. 2.
Difference in clustering obtained in the curve with high-resolution melt analysis after 1st four dilutions (LODabs experiment) in both temperature curve chart and difference curve chart, indicating the loss of an inflexion point at 76 °C. Red clusters—dual inflexion points; Other clusters—single inflexion point (dilutions beyond limit of detection)
Further, a regression model was constructed between Cq values and log DNA quantity (Suppl. Fig F2), where the coefficient of correlation (R2) was found to be 0.9928. The PCR efficiency was also calculated using the LOD experiment, and the efficiency was found to be 97.63%.
Similarly, the LODrel was also performed with DNA from L. monocytogenes in a background of DNA from S. typhimurium in the percentage of 10% to 0.01% with a total input DNA of 100 ng. The results portrayed a 1% limit in the detection of the duplex assay (Suppl. Table T3), and an RSDR of less than 25% was obtained.
Limit of quantification
The acceptance criteria for limit of quantification was established according to Bustin et al. (2009) and ISO 20395: 2019. Since the LOQ should have a 95% confidence level in all the replicates within the linear dynamic range, covering at least four orders of magnitude, 1×, 2×, 3× and 4× concentrations of DNA (from LOD) were evaluated. The LOQ of the assay was found to be 1.56 ng of target DNA, which corresponds to 2× concentration of the obtained limit of detection. Furthermore, the coefficient of variation of the reported LOQ was found to be 4%, where the values were supported by accurate quantification obtained with 95% confidence.
Spike study comparison
To analyze the applicability of the assay in different ‘ready-to-eat’ meat products, spiking was done using ten-fold dilutions, starting from 1.20 × 109 CFU/ml from the reference culture. The DNA isolated from spiked samples was evaluated. The results from the spike study analysis revealed that the assay could accurately detect 120 CFU/ml, which could be clearly interpreted with the presence of double inflexion points and also with single clustering in the difference curve chart (Suppl. Fig F3). Further, the obtained data were used to plot a graph between the log10CFU estimated, and the Cq values obtained (Fig. 3). The data obtained provided a linear relationship with an R2 value of 0.9651, which was utilized in the quantitative connection of log10 (CFU/ml) of the microbe in the spiked sample to the obtained Cq value. The reported limit was better than certain PCR based pathogen detection in meat (Kawasaki et al. 2005; Singh et al. 2009). Further, the detection limit of this assay was also found to be in par with advanced detection techniques like ddPCR, proving the assay’s superiority among the different PCR techniques utilized for pathogen detection (Cremonesi et al. 2016; Wang et al. 2018). While most of the developed techniques did not perform a spike study analysis (Barbau-Piednoir et al. 2013), this study aimed to emphasize the importance of validating the assay through spike study, mimicking real-world scenarios.
Fig. 3.

Regression model constructed with log10 (CFU/ml) vs Cq values obtained from spike study evaluation. The regression equation and coefficient of correlation (R2) were obtained by plotting the regression line
Validation of the assays
To evaluate the proficiency of the developed assay, on par with internationally acceptable limits, test samples received from the accredited proficiency test provider were tested for the presence/absence of L. monocytogenes. Both the simplex and duplex PCR assays detected L. monocytogenes, with single and double inflexion points in the temperature curve chart for both assays (Suppl. Fig F4). The results were verified with VITEK 2 bacterial identification system and were concordant with the results declared by the proficiency test provider. Previous studies like Lee et al. (2012) have also performed similar studies with proficiency test samples to validate the assay according to available methods, in par with international standards (ISO/IEC 17025: 2017).
Furthermore, to evaluate the applicability of the assay to detect Listeria and its species in field samples, samples received for analysis and ready-to-eat meat products from retail outlets of different places were tested. Out of the 32 samples analyzed, the samples received for testing were found to contain L. monocytogenes. The samples obtained from retail outlets tested negative for Listeria (Table 3). The positive samples were analyzed in high-resolution melt analysis, where double inflexion points in the temperature curve chart and different cluster allocations were observed. The obtained results were also verified through VITEK 2 bacterial identification system and through sequence analysis using the 16S rRNA gene. It is noted that most of the samples tested negative for Listeria contamination, where it was tested positive for Salmonella contamination in one of our unpublished studies. This might be due to the fact that many organisms may not co-exist in the same food matrix, providing a competitive growth of contamination (Watson 2019). The assay was proved to be validated for applicability, similar to earlier studies like Gebretsadik et al. (2011) and Shakuntala et al. (2019), where the presence of L. monocytogenes indicates the risk involved in animal-derived products and the requirement of the developed assay in distinguishing such cases.
Table 3.
Real-world sample evaluation with 30 commercial samples (C–1 to C–30) and 2 regulatory samples (R–1 and R–2). The result from the developed PCR-HRM assay was verified with VITEK 2 Bacterial Identification System (bioMerieux Inc, USA) and sanger sequencing using 16S rRNA barcode gene (Applied Biosystems Genetic analyzer 3500, USA)
| Sample No | Place | Duplex PCR–HRM | VITEK 2 Bacterial Identification System | Sanger sequencing |
|---|---|---|---|---|
| R–1 | Regulatory/Confidential | + | + | + |
| R–2 | Regulatory/Confidential | + | + | + |
| C–1 | Telangana, India | − | − | − |
| C–2 | Telangana, India | − | − | − |
| C–3 | Telangana, India | − | − | − |
| C–4 | Telangana, India | − | − | − |
| C–5 | Telangana, India | − | − | − |
| C–6 | Telangana, India | − | − | − |
| C–7 | Telangana, India | − | − | − |
| C–8 | Telangana, India | − | − | − |
| C–9 | Telangana, India | − | − | − |
| C–10 | Telangana, India | − | − | − |
| C–11 | Tamil Nadu, India | − | − | − |
| C–12 | Tamil Nadu, India | − | − | − |
| C–13 | Tamil Nadu, India | − | − | − |
| C–14 | Tamil Nadu, India | − | − | − |
| C–15 | Tamil Nadu, India | − | − | − |
| C–16 | Tamil Nadu, India | − | − | − |
| C–17 | Tamil Nadu, India | − | − | − |
| C–18 | Tamil Nadu, India | − | − | − |
| C–19 | Tamil Nadu, India | − | − | − |
| C–20 | Tamil Nadu, India | − | − | − |
| C–21 | Karnataka, India | − | − | − |
| C–22 | Karnataka, India | − | − | − |
| C–23 | Karnataka, India | − | − | − |
| C–24 | Karnataka, India | − | − | − |
| C–25 | Karnataka, India | − | − | − |
| C–26 | Karnataka, India | − | − | − |
| C–27 | Karnataka, India | − | − | − |
| C–28 | Karnataka, India | − | − | − |
| C–29 | Karnataka, India | − | − | − |
| C–30 | Karnataka, India | − | − | − |
Conclusion
In conclusion, we have developed a sensitive and robust assay with highly specific primers for detecting the Listeria genus and L. monocytogenes. The assay was optimized for sensitive detection in a duplex fashion and was validated for LOD and LOQ according to major guidelines like Bustin et al. (2009) and ISO 20395: 2019. The assay was also evaluated in comparison with culture methods in spike study analysis. Finally, the assay was validated using samples received for testing and field samples. This validated assay can be utilized in routine regulatory detection of microbial contamination, clinical microbiology, disease diagnosis and food safety applications. While the method can be tested on a more extensive set of samples, the combination of Listeria genus primers and species-specific L. monocytogenes primer in a duplex assay provides a robust and sensitive detection in Listeria contamination, addressing various food safety concerns related to the genus Listeria.
Supplementary Information
Below is the link to the electronic supplementary material.
Acknowledgements
We are grateful to the Director, ICAR - National Meat Research Institute, Hyderabad, India for providing necessary facilities to carry out this experiment.
Author contributions
M.R. Vishnuraj: Conceptualization, Methodology, Investigation, Formal analysis, Visualization, Writing—original draft, Writing—review & editing, Project administration. G Ajay: Methodology, Investigation, Formal analysis, Visualization, writing—original draft, Writing—reviewing & editing. N. Aravind Kumar: Methodology, Investigation, Formal analysis, Visualization, writing—original draft, Writing—reviewing & editing. J Renuka: Methodology, Investigation, Formal analysis. Niveditha Pollumahanti: Methodology, Investigation, Formal analysis. Anusha Chauhan: Methodology, Investigation, Formal analysis. Vaithiyanathan, S: Conceptualization, Formal analysis, Visualization, Resources. Deepak B. Rawool: Conceptualization, Formal analysis, Visualization, Resources S.B. Barbuddhe: Conceptualization, Visualization, Resources, Writing—review & editing.
Funding
Funding Agency: Department of Biotechnology (DBT), Ministry of Science and Technology, India. Award Number: BT/PR39032/ADV/90/285/2020.
Data availability
The datasets generated during the research study are available from the corresponding author upon reasonable request.
Declarations
Conflict of interest
The authors declare that they have no known competing financial interest or personal relationships that could have appeared to influence the work reported in this research article.
Ethics approval
Not applicable.
Consent to participate
Not applicable.
Consent to publication
Not applicable.
Footnotes
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
M. R. Vishnuraj and G. Ajay have contributed equally.
References
- Amagliani G, Blasi G, Scuota S, Duranti A, Fisichella S, Gattuso A, Petruzzelli A, et al. Detection and virulence characterization of listeria monocytogenes strains in ready-to-eat products. Foodborne Pathog Dis. 2021;18:675–682. doi: 10.1089/fpd.2020.2923. [DOI] [PubMed] [Google Scholar]
- Azinheiro S, Ghimire D, Carvalho J, Prado M, Garrido-Maestu A. Next-day detection of viable Listeria monocytogenes by multiplex reverse transcriptase real-time PCR. Food Control. 2022;133:108593. doi: 10.1016/j.foodcont.2021.108593. [DOI] [Google Scholar]
- Barbau-Piednoir E, Botteldoorn N, Yde M, Mahillon J, Roosens NH. Development and validation of qualitative SYBR®Green real-time PCR for detection and discrimination of Listeria spp. and Listeria monocytogenes. Appl Microbiol Biotechnol. 2013;97:4021–4037. doi: 10.1007/s00253-012-4477-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Barbuddhe SB, Hain T, Doijad SP, Trinad C. The Genus Listeria. In: Green LH, Goldman E, editors. Practical Handbook of Microbiology. 4. England: CRC Press; 2021. pp. 411–441. [Google Scholar]
- Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, Mueller R, Nolan T, Pfaffl MW, Shipley GL, Vandesompele J, Wittwer CT. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem. 2009;55:611–622. doi: 10.1373/clinchem.2008.112797. [DOI] [PubMed] [Google Scholar]
- Carlin CR, Liao J, Weller DL, Guo X, Orsi R, Wiedmann M. Listeria cossartiae sp. nov., Listeria farberi sp. nov., Listeria immobilis sp. nov., Listeria portnoyi sp. nov. and Listeria rustica sp. nov., isolated from agricultural water and natural environments. Int J Syst Evol Microbiol. 2021;71:004795. doi: 10.1099/ijsem.0.004795. [DOI] [PMC free article] [PubMed] [Google Scholar]
- CDC (2021) Listeria outbreak linked to fully cooked chicken. https://www.cdc.gov/listeria/outbreaks/precooked-chicken-07-21/index.html
- Cremonesi P, Cortimiglia C, Picozzi C, Minozzi G, Malvisi M, Luini M, Castiglioni B. Development of a droplet digital polymerase chain reaction for rapid and simultaneous identification of common foodborne pathogens in soft cheese. Front Microbiol. 2016;7:1725. doi: 10.3389/fmicb.2016.01725. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Desai AN, Anyoha A, Madoff LC, Lassmann B. Changing epidemiology of Listeria monocytogenes outbreaks, sporadic cases, and recalls globally: A review of ProMED reports from 1996 to 2018. Int J Infect Dis. 2019;84:48–53. doi: 10.1016/j.ijid.2019.04.021. [DOI] [PMC free article] [PubMed] [Google Scholar]
- FDA (2021) Outbreak Investigation of Listeria monocytogenes: Dole Packaged Salad. https://www.fda.gov/food/outbreaks-foodborne-illness/outbreak-investigation-listeria-monocytogenes-dole-packaged-salad-december-2021
- Gebretsadik S, Kassa T, Alemayehu H, Huruy K, Kebede N. Isolation and characterization of Listeria monocytogenes and other Listeria species in foods of animal origin in Addis Ababa. Ethiopia J Infect Public Health. 2011;4:22–29. doi: 10.1016/j.jiph.2010.10.002. [DOI] [PubMed] [Google Scholar]
- Grazina L, Costa J, Amaral JS, Mafra I (2021) High-resolution melting analysis as a tool for plant species authentication. In: Tripodi P (ed) Crop Breeding. Humana, New York, NY, pp 55–73 10.1007/978-1-0716-1201-9_5 [DOI] [PubMed]
- KaptchouangTchatchouang CD, Fri J, De Santi M, Brandi G, Schiavano GF, Amagliani G, Ateba CN. Listeriosis outbreak in South Africa: a comparative analysis with previously reported cases worldwide. Microorganisms. 2020;8:135. doi: 10.3390/microorganisms8010135. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kawasaki S, Horikoshi N, Okada Y, Takeshita K, Sameshima T, Kawamoto S. Multiplex PCR for simultaneous detection of Salmonella spp., Listeria monocytogenes, and Escherichia coli O157:H7 in meat samples. J Food Prot. 2005;68:551–556. doi: 10.4315/0362-028x-68.3.551. [DOI] [PubMed] [Google Scholar]
- Köppel R, Schade J, Peier M. Specific detection of the most prevalent five Listeria strains and unspecific detection of 15 Listeria using multiplex real-time PCR. Eur Food Res Technol. 2021;247:1167–1175. doi: 10.1007/s00217-021-03697-y. [DOI] [Google Scholar]
- Ledlod S, Bunroddith K, Areekit S, Santiwatanakul S, Chansiri K. Development of a duplex lateral flow dipstick test for the detection and differentiation of Listeria spp. and Listeria monocytogenes in meat products based on loop-mediated isothermal amplification. J Chromatogr B Biomed Sci Appl. 2020;1139:121834. doi: 10.1016/j.jchromb.2019.121834. [DOI] [PubMed] [Google Scholar]
- Lee HK, Loh TP, Lee CK, Tang JW, Chiu L, Koay ES. A universal influenza A and B duplex real-time RT-PCR assay. J Med Virol. 2012;84:1646–1651. doi: 10.1002/jmv.23375. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Liu YY, Zhao LS, Song XP, Du PC, Li DM, Chen ZK, Liu QY. Development of fluorogenic probe-based and high-resolution melting-based polymerase chain reaction assays for the detection and differentiation of Bartonella quintana and Bartonella henselae. J Microbiol Methods. 2017;138:30–36. doi: 10.1016/j.mimet.2016.06.014. [DOI] [PubMed] [Google Scholar]
- Luo J, Luo M, Li J, Yu J, Yang H, Yi X, Chen Y, Wei H. Rapid direct drug susceptibility testing of Mycobacterium tuberculosis based on culture droplet digital polymerase chain reaction. Int J Tuberc Lung Dis. 2019;23(2):219–225. doi: 10.5588/ijtld.18.0182. [DOI] [PubMed] [Google Scholar]
- Maćkiw E, Korsak D, Kowalska J, Felix B, Stasiak M, Kucharek K, Postupolski J. Genetic diversity of Listeria monocytogenes isolated from ready-to-eat food products in retail in Poland. Int J Food Microbiol. 2021;358:109397. doi: 10.1016/j.ijfoodmicro.2021.109397. [DOI] [PubMed] [Google Scholar]
- Pietzka A, Allerberger F, Murer A, Lennkh A, Stöger A, Cabal Rosel A, Huhulescu S, Maritschnik S, Springer B, Lepuschitz S, Ruppitsch W, Schmid D. Whole Genome Sequencing Based Surveillance of L. monocytogenes for Early Detection and Investigations of Listeriosis Outbreaks. Front Public Health. 2019;7:139. doi: 10.3389/fpubh.2019.00139. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Quereda JJ, Leclercq A, Moura A, Vales G, Gómez-Martín Á, García-Muñoz Á, Thouvenot P, Tessaud-Rita N, Bracq-Dieye H, Lecuit M. Listeria valentina sp. nov., isolated from a water trough and the faeces of healthy sheep. Int J Syst Evol Microbiol. 2020;70:5868–5879. doi: 10.1099/ijsem.0.004494. [DOI] [PubMed] [Google Scholar]
- Raufu IA, Moura A, Vales G, Ahmed OA, Aremu A, Thouvenot P, Tessaud-Rita N, Bracq-Dieye H, Krishnamurthy R, Leclercq A, Lecuit M. Listeria ilorinensis sp. nov., isolated from cow milk cheese in Nigeria. Int J Syst Evol Microbiol. 2022 doi: 10.1099/ijsem.0.005437. [DOI] [PubMed] [Google Scholar]
- Rodríguez-Lázaro D, Hernández M, Pla M. Simultaneous quantitative detection of Listeria spp. and Listeria monocytogenes using a duplex real-time PCR-based assay. FEMS Microbiol Lett. 2004;233:257–267. doi: 10.1016/j.femsle.2004.02.018. [DOI] [PubMed] [Google Scholar]
- Shakuntala I, Das S, Ghatak S, Milton AAP, Sanjukta R, Puro KU, Sen A. Prevalence, characterization, and genetic diversity of Listeria monocytogenes isolated from foods of animal origin in North East India. Food Biotechnol. 2019;33:237–250. doi: 10.1080/08905436.2019.1617167. [DOI] [Google Scholar]
- Singh J, Batish VK, Grover S. A molecular beacon-based duplex real-time polymerase chain reaction assay for simultaneous detection of Escherichia coli O157: H7 and Listeria monocytogenes in milk and milk products. Foodborne Pathog Dis. 2009;6(10):1195–1201. doi: 10.1089/fpd.2009.0310. [DOI] [PubMed] [Google Scholar]
- Vergis J, Negi M, Poharkar K, Das DP, Malik SV, Kumar A, Doijad SP, Barbuddhe SB, Rawool DB. 16S rRNA PCR followed by restriction endonuclease digestion: a rapid approach for genus level identification of important enteric bacterial pathogens. J Microbiol Methods. 2013;95:353–356. doi: 10.1016/j.mimet.2013.10.001. [DOI] [PubMed] [Google Scholar]
- Wachiralurpan S, Sriyapai T, Areekit S, Sriyapai P, Thongphueak D, Santiwatanakul S, Chansiri K. A one-step rapid screening test of Listeria monocytogenes in food samples using a real-time loop-mediated isothermal amplification turbidity assay. Anal Methods. 2017;9(45):6403–6410. doi: 10.1039/C7AY01750B. [DOI] [Google Scholar]
- Wachiralurpan S, Phung-On I, Chanlek N, Areekit S, Chansiri K, Lieberzeit PA. In-situ monitoring of real-time loop-mediated isothermal amplification with QCM: detecting Listeria monocytogenes. Biosensors. 2021;11:308. doi: 10.3390/bios11090308. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang M, Yang J, Gai Z, Huo S, Zhu J, Li J, Wang R, Xing S, Shi G, Shi F, Zhang L. Comparison between digital PCR and real-time PCR in detection of Salmonella typhimurium in milk. Int J Food Microbiol. 2018;266:251–256. doi: 10.1016/j.ijfoodmicro.2017.12.011. [DOI] [PubMed] [Google Scholar]
- Watson SC (2019) Investigation of the bacterial safety of fermented and dried duck salami. https://etda.libraries.psu.edu/catalog/17024scw186
- Xiao XL, Zhang L, Wu H, Yu YG, Tang YQ, Liu DM, Li XF. Simultaneous detection of Salmonella, Listeria monocytogenes, and Staphylococcus aureus by multiplex real-time PCR assays using high-resolution melting. Food Anal Methods. 2014;7:1960–1972. doi: 10.1007/s12161-014-9875-x. [DOI] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The datasets generated during the research study are available from the corresponding author upon reasonable request.


