A proinflammatory long noncoding RNA Lncenc1 regulates inflammasome activation in macrophage

Abstract

Mammalian genomes encode thousands of long noncoding RNAs (lncRNAs). LncRNAs are extensively expressed in various immune cells. The lncRNAs have been reported to be involved in diverse biological processes, including the regulation of gene expression, dosage compensation, and genomic imprinting. However, very little research has been conducted to explore how they alter innate immune responses during host-pathogen interactions. In this study, we found that a lncRNA, named long noncoding RNA, embryonic stem cells expressed 1 (Lncenc1), was strikingly increased in mouse lungs after gram-negative (G−) bacterial infection or exposure to lipopolysaccharides (LPS). Interestingly, our data indicated that Lncenc1 was upregulated in macrophages but not in primary epithelial cells (PECs) or polymorphonuclear leukocytes (PMN). The upregulation was also observed in human THP-1 and U937 macrophages. Besides, Lncenc1 was highly induced during ATP-induced inflammasome activation. Functionally, Lncenc1 showed proinflammatory effects in macrophages as demonstrated by increased expressions of cytokine and chemokines, as well as enhanced NF-κB promoter activity. Overexpression of Lncenc1 promoted the releases of IL-1β and IL-18, and Caspase-1 activity in macrophages, suggesting a role in inflammasome activation. Consistently, knockdown of Lncenc1 inhibited inflammasome activation in LPS-treated macrophages. Moreover, knockdown of Lncenc1 using antisense oligo (ASO)-loaded exosomes (EXO) attenuated LPS-induced lung inflammation in mice. Similarly, Lncenc1 deficiency protects mice from bacteria-induced lung injury and inflammasome activation. Taken together, our work identified Lncenc1 as a modulator of inflammasome activation in macrophages during bacterial infection. Our study suggested that Lncenc1 could serve as a therapeutic target for lung inflammation and injury.

INTRODUCTION

With the advent of advanced technologies, researchers of this era have uncovered that only a minuscule fraction (<2%) of the human genome encodes proteins, and more than 98% of the human genome is not able to be translated into proteins (1, 2). Previously, the nonprotein-coding fraction in the human genome was considered junk DNA. However, a lot of recent studies have reported that many nonprotein-coding fractions could be transcribed as functional noncoding RNAs (ncRNAs) (3). Long noncoding RNAs (lncRNAs) are more than 200 nucleotides in length (2). Functionally, lncRNAs are involved in the regulation of various crucial cellular events, including cell cycle, proliferation, differentiation, apoptosis, metabolism, and maintenance of pluripotency (4). Therefore, dysregulations of lncRNAs have been identified in several human diseases such as autoimmune diseases, lung injury, coronary artery diseases, and various cancers (5, 6).

Lung inflammation usually comes from infection or exposure to allergens, toxins, and pollutants (7). Among the several risks, lung infections pose a significant burden on public health worldwide as a leading cause of death (8). Gram-negative (G−) bacterial infections have features of particular concern in that it is easy to acquire antibiotic resistance (9). In addition, a bacterial infection often leads to high mortality and morbidity due to tissue damage induced by an unregulated inflammatory response. Macrophages, one of the innate immune cells, provide the first-line defense against pathogens and tissue injury. Subsequently, they critically contribute to inflammation resolution, tissue repair, and homeostasis restoration (10). Inflammasomes are essential mechanisms for the innate immune system against various inflammatory disorders by processing and releasing the cytokine IL-1β (11). Recently, several studies found that lncRNAs regulate the NLRP3 inflammasome by controlling the neighboring inflammatory protein-coding genes, thus contributing to the cell’s inflammatory response (12). For example, lncRNA NEAT1 can enhance inflammasome assembly and subsequent pro-caspase-1 processing (13), whereas lincRNA-Cox2 can promote the inflammasome activation by modulating the expression of inflammasome sensor NLRP3 and adaptor apoptosis-associated speck-like protein containing a caspase recruitment domain (ASC) (14).

In our study, we observed that long noncoding RNA, embryonic stem cells expressed 1 (Lncenc1) was highly induced in murine lungs after the administration of lipopolysaccharides (LPS) or G− bacteria. We further investigated the regulation and function of Lncenc1 using in vitro experiments and confirmed that Lncenc1 was upregulated in macrophages upon infectious stimulation. Functionally, we showed that Lncenc1 has a proinflammatory effect in macrophages and plays a role in inflammasome activation. Finally, these observations were validated by the delivery of antisense oligo (ASO)-loaded exosomes (EXOs) in vivo. Knockdown of Lncenc1 attenuated LPS-induced lung inflammation in mice. Similarly, Lncenc1 deficient mice displayed significantly attenuated lung injury, inflammasome activation, and pulmonary edema during bacterial infection. Our study improves the understanding of Lncenc1 in regulating the activation of inflammasomes during G− bacterial infection and provides a potential therapeutic target in infectious diseases.

MATERIALS AND METHODS

Materials

Paraformaldehyde (Product No. 158127), DAPI (Product No. D9542), Triton X-100 (Product No. T8787), LPS (Product No. L4268), DNase I (Product No. D4527), adenosine 5′-triphosphate disodium salt hydrate (ATP) (Product No. A6419), and phorbol myristate acetate (PMA) (Product No. P8139) were purchased from Sigma-Aldrich. Bacterial strains Klebsiella pneumoniae (K. pneu) (Product No. 43816) and Escherichia coli (E. coli) (Product No. 19138) were purchased from American Type Culture Collection (ATCC). Lipofectamine 2000 Transfection Reagent (Product No. 11668019), Total Exosome Isolation Reagent (Product No. 4478360), Phusion Plus DNA Polymerase (Product No. F630XL), XhoI (Product No. FD0694), EcoRI (Product No. FD0275), BclI (Product No. FD0724), HEPES (Product No. 15630080), Luria-Bertani medium (Product No. 10855001), PBS (Product No. 10010049), heat-inactivated FBS (Product No. 16140071), RPMI 1640 (Product No. 22400105), and DMEM (Product No. 11965118) were purchased from Thermo Fisher Scientific. Isoflurane (Product No. 11695-6776-2) was purchased from Henry Schein Animal Health. Dispase (Product No. 354235) was purchased from Corning. All the DNA oligos were purchased from Integrated DNA Technologies (IDT). MCC950 (Product No. 5479) was purchased from R&D Systems, Inc.

Antibodies

Rat Anti-Mouse CD45 (Product No. 553076) and Rat Anti-Mouse CD16/CD32 (Product No. 553142) were purchased from BD Biosciences. Biotin anti-mouse Ly-6G antibody (Product No. 108404) was purchased from BioLegend.

Bacteria Culture

Cultures of K. pneu or E. coli were grown overnight in Luria-Bertani medium at 37°C in a rotator at 250 rpm. They were then subcultured into fresh medium and grown to the mid-log phase. After culturing, bacteria were pelleted and resuspended in PBS. Bacterial concentrations were assessed by serial dilutions. Bacteria count was estimated by OD600 and was diluted to final colony-forming unit (CFU) as needed for each experiment.

Animal Study

Lncenc1 knockout (Lncenc1^−/−) mice were purchased from the European Mouse Mutant Archive (EMMA ID: 14146) and rederived at Augusta University Genome Editing Core using in Vitro Fertilization service. Genotyping assay was performed according to the provider’s protocol. Age- and sex-matched (8–10 wk) C57BL/6J wild-type (WT) mice (000664, Jackson Laboratory) and Lncenc1^−/− mice were kept in a pathogen-free facility. To induce lung inflammation, mice were anesthetized using 2% isoflurane, and 1 μg LPS or 10⁴ CFU of K. pneu or 10⁶ CFU of E. coli in 50 μL of PBS was given intratracheally (it) per mouse using a nonintensive method (15). Mice were euthanized using 5% isoflurane. After euthanasia, bronchoalveolar lavage (BAL) was collected as previously described (16). Briefly, lung was washed with 1.8 mL (0.6 mL × 3) of PBS. BAL was then cytocentrifuged at 500 g for 5 min to obtain BAL cells. All the protocols involving animals in this study were approved by the institutional animal care and use committee of Augusta University. Animal experiments were conducted following Animal Research: Reporting of In Vivo Experiments (ARRIVE) guidelines.

Primary Cells Isolation and Cell Culture

L929 (Product No. CCL-1), J774A.1 (Product No. TIB-67), and HEK293T (Product No. CRL-3216) cells were purchased from ATCC and cultured in DMEM with 10% FBS. Primary epithelial cells (PECs) were isolated from the WT mice as described previously (17). Briefly, mouse lung tissue was washed with PBS, followed by 2 mL of dispase, and 0.5 mL of 1% agarose. Lung tissue was then dissociated in DMEM with 25 mM HEPES and 200 U/mL DNase I. Isolated cells were plated on CD45- and CD16/32-precoated dishes. After centrifuge, the pellets were resuspended in DMEM containing 10% FBS. Polymorphonuclear leukocytes (PMN) were isolated from the bone marrow of C57BL/6 mice by positive selection for Ly6G using immunomagnetic beads (18). Alveolar macrophages (AMs) were isolated using the method described previously (19). Briefly, after tracheostomy, 2 mL (1 mL × 2) of PBS was used to lavage mouse lungs and bronchoalveolar lavage (BAL) fluid was obtained. BAL cells (>90% of cells are macrophages) were collected after centrifugation at 400 g for 10 min. Bone marrow-derived macrophages (BMDM) were isolated as previously described (19) and cultured with 30% L929 cells conditioned medium in DMEM complete medium for 7 days before any further experimental procedure. Human THP-1 (Product No. TIB-202), U937 (Product No. CRL-1593.2), and mouse MH-S (Product No. CRL-2019) cells were obtained from ATCC and maintained in RPMI-1640 with 10% FBS. THP-1 and U937 cells were differentiated into macrophage-like cells for all the experiments by 150 nM and 10 nM PMA treatment for 24 h, respectively. All the cells were maintained at 37°C in a humidified atmosphere of 5% CO₂-95% air. For LPS treatment, cells were incubated at a final concentration of 100 ng/mL. To activate the inflammasome in macrophages, we primed the cells with 500 ng/mL LPS for 3 h followed by 5 mM ATP for additional 3 h. MCC950 (10 μM) was added to inhibit NLRP3 inflammasome activation.

Cloning and Transfection

To clone the longest transcript variant of mouse Lncenc1, the exon 3 was amplified from murine genomic DNA by PCR using Phusion Plus DNA Polymerase and inserted into XhoI and EcoRI sites of MDH1-PGK-GFP_2.0 (Addgene plasmid No. 11375). DNA fragment (from 1 to 661 bp) that contains exons 1 and 2 was synthesized and subcloned into XhoI and BclI sites to generate the plasmid MDH1-Lncenc1. All the plasmids were purified using endotoxin-free plasmid DNA purification kit (Product No. 12362) from Qiagen. The primer sequences used for cloning are listed as follows. Forward: 5′- CCGCTCGAGAAGCCTGACCAGACTTGGAA-3′ and Reverse: 5′- CCGGAATTCTTGTGTTTCAGAATTATCACA-3′. Phosphorothioate modified (*) scramble (Scr) oligo and ASO for mouse Lncenc1 were ordered from IDT. Scr: 5′-A*C*G*T*C*C* TATTGC*A*C*T*C*G*T-3′; and ASO: 5′-G*T*T*C*T*A* GGACCT*C*T*C*T*C*A-3′. Transfection of ASO was performed using Lipofectamine 2000 Transfection Reagent according to the manufacturer’s instructions. Lipofectamine 2000 was also used for plasmids transfection into HEK293T cells. To transfect plasmids into the MH-S and BMDM, Neon Transfection System from Thermo Fisher Scientific was used. For MH-S, 1,680 voltage; 20 ms; 1 pulse was used. For BMDM, 1,800 voltage; 30 ms; 1 pulse was used.

Preparation and Delivery of ASO-Loaded EXOs

EXOs were purified from normal C57BL/6J mouse serum using Total Exosome Isolation Reagent. Electroporation was used to introduce Scr or ASO into EXOs as described earlier (16, 20). Briefly, 100 pmol Scr or ASO was mixed with 100 μg EXOs (quantified by protein content). The final volume was adjusted to 100 μL using sterile PBS. The mixture was loaded into the 100 μL Neon Tip and electroporated at 500 voltages using a 20-ms pulse five times using the Neon Transfection System. To wash the EXOs, 900 μL of cold PBS was added after electroporation. EXOs were pelleted by centrifugation at 100,000 g for 2 h and resuspended in 50 μL of PBS. Then, Scr or ASO-loaded EXOs were delivered into the lung. The loading efficiency of Scr or ASO was evaluated by real-time PCR based on the absolute quantification method, as described previously (16, 21). To make a standard curve, 1 ng of synthetic Scr or ASO was used for the reaction of stem-loop reverse transcription (22). Standard curves were made using these cDNA with serial dilutions. The absolute amount of Scr or ASO in purified EXOs after electroporation was measured and divided by 1 ng for calculating the loading efficiency. siRNA-specific primers and the universal reverse primer used in the real-time PCR were as follows: Scr RT primer: 5′- CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACGAGTGC-3′; Scr qPCR primer: 5′- ACACTCCAGCTGGGACGTCCTATTGCACTC-3′; ASO RT primer: 5′- CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTGAGAGAG-3′; ASO qPCR primer: 5′- ACACTCCAGCTGGGGTTCTAGGACCTCTCT-3′; Universal primer: 5′- CGAATTCTAGAGCTCGAGGCAGG-3′.

Lung Inflammation, BAL Cell Counting, and Lung Wet/Dry Ratio

To observe histological images of lung sections, we obtained the whole lung sections in the Electron Microscopy & Histology Core Laboratory at Augusta University for immunofluorescence or hematoxylin and eosin (H&E) staining. The histological lung injury score was assessed in the double-blinded condition as previously described (23). Briefly, lung injury was assessed based on the following criteria: 1) the number of neutrophils in the alveolar space, 2) the number of neutrophils in the interstitial space, 3) the number of hyaline membranes, 4) proteinaceous debris filling the airspaces, and 5) alveolar septal thickening.

BAL cells were cytocentrifuged at 300 g for 5 min. Total inflammatory BAL cell counts were determined using a hemocytometer as previously described (21). BAL cells and lung sections were air-dried and stained with PROTOCOL Hema 3 fixative and solutions (23-123869, Fisher Scientific). Images of the stained BAL cells were visualized and captured using a microscope (Zeiss Observer Z1, Carl Zeiss, Oberkochen, Germany).

To measure the weight ratio, we dissected the inferior lobe of the right lung from mice. The wet weight was measured immediately after its excision and dried at 60°C for 24 h and reweighed for dry weight. The wet/dry weight ratio was calculated by dividing the wet by the dry weight.

Fluorescence In Situ Hybridization and Immunofluorescence Staining

For cell staining, two probes targeting Lncenc1 were purchased from IDT. The sequences for probes are listed as follows: Cy3-probe (Cy3-UACUUGUCAGGCCAACAGAA) and Cy5-probe (Cy5-GGUGAAGCCAUGUGUUCAUC). Fluorescence in situ hybridization (FISH) was performed as previously described (24). Briefly, AM was fixed with 4% paraformaldehyde after LPS treatment. Then cells were washed with PBS 0.5% Triton X-100. Hybridization was performed using the probes at 37°C overnight. Nuclei were counterstained with 4′,6-diamidino-2-phenylindole (D1306, Fisher Scientific). For tissue staining, RNA Scope in situ hybridization kit was purchased from Advanced Cell Diagnostics (323100, ACD). Probe hybridization was performed according to the manufacturer’s protocol. Then lung sections were incubated overnight at 4°C with polyclonal anti-CD68 (ab125047, Abcam). After washing, polyclonal anti-rabbit Alexa 488 (A11070, Thermo Fisher Scientific) was applied. Nuclei were counterstained with DAPI. Images of the stained lung sections were visualized using a Zeiss Observer Z1 microscope (Carl Zeiss).

RNA Preparation, Reverse Transcription, qRT-PCR, and LncRNA Array

miRNeasy Mini Kit (217004, QIAGEN) was used for total RNA extraction according to the manufacturer’s protocol. Total RNA of normal human tissues was purchased from Zyagen (San Diego, CA). Single-stranded cDNA was generated according to the manuals of High-Capacity cDNA Reverse Transcription Kit (4368813, Thermo Fisher Scientific). PowerUp SYBR Green Master Mix (A25741, Thermo Fisher Scientific) was used for real-time PCR technique as previously described (25). Tbp was used as a reference housekeeping gene for normalization. The primers are provided in Table 1. LncRNA array was performed using Mouse LncRNA Profiler qPCR Array Kit (RA930A-1, System Biosciences) per the manufacturer’s protocol.

Table 1.

Sequences of primers used for qRT-PCR

Gene	Forward Primer (5′ to 3′)	Reverse Primer (5′ to 3′)
Tbp	TCAAACCCAGAATTGTTCTCC	GGGGTAGATGTTTTCAAATGC
Lncenc1	CCAGCGTCCTGTGGTAAAG	GATTCTCATCCCCTGCCTAT
linc-ENC1	CGGAGACACGTGTCTCTCTAGGA	GGACACATTGCAGGTGCTCAA
Il-1β	GCAACTGTTCCTGAACTCAACT	ATCTTTTGGGGTCCGTCAACT
Il-6	GTGACAACCACGGCCTTCCCTACT	GGTAGCTATGGTACTCCA
Tnf-α	GACGTGGAACTGGCAGAAGAG	TTGGTGGTTTGTGAGTGTGAG
Ccl2	TTAAAAACCTGGATCGGAACCAA	GCATTAGCTTCAGATTTACGGGT
Cxcl1	CTGGGATTCACCTCAAGAACATC	CAGGGTCAAGGCAAGCCTC
Cxcl2	CCAACCACCAGGCTACAGG	GCGTCACACTCAAGCTCTG
Il-18	GACTCTTGCGTCAACTTCAAGG	CAGGCTGTCTTTTGTCAACGA

Lncenc1, long noncoding RNA, embryonic stem cells expressed 1.

ELISA, Caspase-1 Activity, and NF-κB Reporter Activity

DuoSet ELISA Kits for mouse IL-6 (Product No. DY406), TNF-α (Product No. DY410), chemokine (C-X-C motif) ligand 1 (CXCL1; Product No. DY453), CXCL2 (Product No. DY452), IL-1 beta (Product No. DY401), and IL-18 (Product No. DY7625) were purchased from R&D Systems. Experiments were performed according to the manufacturer’s protocol. Caspase-1 activity was measured using the Caspase-Glo 1 Inflammasome Assay Kit (G9951, Promega Corporation). NF-κB reporter assay was performed using NanoLuc Reporter Vector with NF-κB Response Element (N1111, Promega Corporation). NanoLuc luciferase activity was measured using Nano-Glo Luciferase Assay System (N1130, Promega Corporation) 24 h after transfection.

Statistical Analysis

All the data from multiple independent experiments were averaged before normalization. All data are shown as means ± SD. Comparisons between two groups were performed using a two-tailed unpaired Student’s t test. Multiple groups were compared using a one-way ANOVA with Tukey’s method. P < 0.05 was considered statistically significant. For in vivo experiments, no sex-specific differences were observed for any of the reported data. The number of male and female mice was indicated in each figure. For in vitro experiments, three to four independent experiments were performed as indicated in each panel.

RESULTS

Bacterial Infection/LPS Regulates lncRNA Expression in Mouse Lung Tissues

To determine the effects of LPS and G− bacteria on lncRNAs, we used a commercial panel to analyze lncRNA expression in mouse lungs after intratracheal instillation of LPS (1 μg per mouse), K. pneu (1 × 10⁴ CFU/mouse) and E. coli (1 × 10⁶ CFU/mouse). Of the 84 lncRNA species analyzed, 11 were significantly overexpressed compared with the control group (Fig. 1A). Among the overexpressed lncRNAs, Lncenc1 (also known as Lincenc1) exhibited the greatest induction in expression among treated groups, reaching ∼21-fold of increase compared with controls after exposure to K. pneu, more than 16-fold of increase after exposure to E. coli and 26-fold after LPS administration respectively (Fig. 1B). We, therefore, selected Lncenc1 for further investigation.

Figure 1.

Long noncoding RNA (lncRNA) profile in murine ALI models induced by gram-negative (G−) bacteria or lipopolysaccharides (LPS). A and B: mice received 50 μL PBS or 50 μL PBS containing Klebsiella pneumoniae (K. pneu), Escherichia coli (E. coli), or LPS via intrathecal. After 1 day, the lncRNA expression in murine lungs was analyzed using LncRNA Profiler qPCR Array Kit. The heat map was generated using hierarchical cluster analysis to show distinct lncRNA expression patterns in lung tissues between Control, K. pneu, E. coli, and LPS-treated mice (pooled, n = 8 for each group; male = 4 and female = 4/group). The intensity values were Log10 transformed, centered by the mean of individual genes across all four groups. The color bar was extracted to show the color contrast level of the heat map. Red and green indicate high expression levels and low expression levels, respectively (A). LncRNAs with a fourfold or greater increase induced by instilled LPS were listed (B).

Genomic Location and Tissue Distribution of Lncenc1

Most lncRNAs do not show the same pattern of high interspecies conservation as protein-coding genes (26). Of note, the similar genomic structure of human linc-ENC1 (also called LINC01157, NCBI Gene ID: 105379037), mouse Lncenc1 (NCBI Gene ID: 100039691), and rat LOC102550768 (NCBI Gene ID: 102550768) are shown in Fig. 2A, suggesting a conserved biological function. To determine the tissue distribution of Lncenc1, we analyzed the relative expression of Lncenc1 in various tissues using qRT-PCR. Our data indicate that Lncenc1 is abundant in murine lung, intestine, and spleen (Fig. 2B).

Figure 2.

Genomic location and tissue distribution of long noncoding RNA, embryonic stem cells expressed 1 (Lncenc1). A: genomic structures of human LINC01157, mouse Lncenc1, and rat LOC102550768. B: qRT-PCR analysis of Lncenc1 in normal murine tissues (n = 3; male = 1 and female = 2).

LPS Induces Lncenc1 Expression in Macrophages

We confirmed the expression of Lncenc1 in lungs using qPCR after intratracheal instillation of LPS (Fig. 3A). In addition to the whole lung tissues, we also observed that Lncenc1 was upregulated in BAL cells at both 6 and 24 h after LPS treatment (Fig. 3B). As is well known, the lung is composed of at least 40 distinct cell types (27). To fully understand the regulation of Lncenc1, it is critical to analyze its expression at the cellular level. Next, we tested the expression of Lncenc1 in three types of cells, including epithelial cells, macrophages, and PMN, in response to LPS in vitro. Interestingly, Lncenc1 was robustly upregulated in macrophages, including primary AM, BMDM, J774A.1, MH-S cells, and RAW264.7, but not in primary epithelial cells or PMN (Fig. 3C). To attempt to visualize the location of Lncenc1 in murine lungs, we used RNA scope in situ hybridization and observed the colocalization of Lncenc1 probe (red) and CD68 (green, a marker of macrophages) (Fig. 3D). We further detected the subcellular localization of Lncenc1, which is primarily located in the cytoplasm and upregulated after LPS stimulation as detected using confocal microscopy (Fig. 3E), suggesting that Lncenc1 exerts its biological function in the cytoplasm. The presence of Lncenc1 in the cytoplasm raised the possibility that it might bind with the protein complex of cell organelles to trigger an innate immune response. The inflammasome is known to play a critical role in regulating innate immune responses after bacterial infection (28). Thus, we hypothesize that regulation of Lncenc1 is associated with inflammasome activation. To activate the inflammasome in BMDM, we primed the cells with LPS (500 ng/mL) for 3 h followed by ATP (5 mM) for additional 3 h. The secretions of IL-1β and IL-18 were strikingly induced upon inflammasome activation (Fig. 3, F and G). Enhanced Caspase-1 activity was also observed (Fig. 3H). In agreement with this hypothesis, in comparison with LPS treatment alone, Lncenc1 is highly increased during ATP-induced inflammasome activation (Fig. 3I). We further validated the regulation by adding MCC950, a selective inhibitor of NLRP3 inflammasome (29). We found that MCC950 treatment not only inhibits the release of mature IL-1β and IL-18 (Fig. 3, F and G) but also reduces the expression of Lncenc1 (Fig. 3I).

Figure 3.

Lipopolysaccharides (LPS) upregulates long noncoding RNA, embryonic stem cells expressed 1 (Lncenc1) in macrophages. A and B: mice (n = 3–7 mice/group; male = 1–4 and female = 2 or 3/group) received 50 μL of PBS or 50 μL of PBS containing 1 μg of LPS via intrathecal. At 6 and 24 h after treatment, Lncenc1 expressions in whole lung tissues (A) or bronchoalveolar lavage (BAL) cells (B) were detected using qRT-PCR. C: cultured cells were treated with 100 ng/µL of LPS for 6 h. Lncenc1 expressions were detected using qRT-PCR analysis. D: mice (n = 5/group; male = 3 and female = 2/group) received 50 μL of PBS or 50 μL of PBS containing 1 μg LPS via intrathecal. Mice were euthanized 24 h after LPS treatment. RNA scope and immunofluorescence staining were performed in lung sections using a probe detecting Lncenc1 and an antibody against CD68. Scale bar = 50 μm. E: primary murine alveolar macrophage (AM) was left untreated or incubated with LPS (100 ng/mL) for 6 h. RNA fluorescence in situ hybridization (FISH) was performed using two probes against Lncenc1. Scale bar = 5 μm. F–I: bone marrow-derived macrophages (BMDM) were primed with LPS (500 ng/mL) for 3 h followed by ATP (5 mM) for additional 3 h and/or with MCC950 as indicated. Nontreated or LPS treated alone serves as a control group. IL-1β release (F), IL-18 release (G), and Caspase-1 activity (H) were measured. Lncenc1 expressions in BMDM were detected using qRT-PCR (I). Comparisons between two groups were performed using a two-tailed unpaired Student’s t test. Multiple groups were compared using a one-way ANOVA with Tukey’s method. All these results presented as means ± SD are from 3 or 4 independent experiments. ns, P > 0.05; *P < 0.05; **P < 0.01 vs. their corresponding control.

G− Bacteria Induces Lncenc1 Expression

Besides the LPS treatment, we next determined the alteration of Lncenc1 in response to the bacterial infection. We observed that levels of Lncenc1 were induced in the murine lungs 24 h after K. pneu or E. coli infection (Fig. 4A). In vitro, we found that K. pneu increased the expression of Lncenc1 in BMDM (Fig. 4B) and primary AM (Fig. 4C). Furthermore, the upregulation of linc-ENC1 in response to K. pneu was confirmed in two human macrophages, U937 and THP-1 (Fig. 4, D and E).

Figure 4.

Gram-negative (G−) bacteria induces long noncoding RNA, embryonic stem cells expressed 1 (Lncenc1) expression. A: mice (n = 4/group; male = 2 and female = 2/group) received 50 μL of PBS, Klebsiella pneumoniae (K. pneu) or Escherichia coli (E. coli) via intrathecal. One day after infection, Lncenc1 expressions in whole lung tissues were detected using qRT-PCR. B–E: macrophages were cultured with or without K. pneu treatment [10⁷ colony-forming unit (CFU) bacteria/10⁵ macrophages, 1-h incubation]. Lncenc1 expressions were measured in bone marrow-derived macrophages (BMDM) 24 h after infection (B), primary alveolar macrophage (AM) 6 h after infection (C), or human macrophages U937 (D) and THP-1 (E) at indicated time points. Comparisons between two groups were performed using a two-tailed unpaired Student’s t test. Multiple groups were compared using a one-way ANOVA with Tukey’s method. All these results presented as means ± SD are from 3 or 4 independent experiments. *P < 0.05; **P < 0.01 vs. their corresponding control.

Overexpression of Lncenc1 Promotes Inflammasome Activation

Currently, the function of Lncenc1 in the innate immune response is unknown. To address this knowledge gap, we overexpressed Lncenc1 in LPS-treated MH-S cells using plasmid MDH1-Lncenc1 (Fig. 5A). Next, after overexpression of Lncenc1, we detected the expressions of cytokines and chemokines in LPS-treated MH-S cells and found most of them were increased compared with the MDH1 transfected group (Fig. 5, B and C). It is known that the NF-κB signaling pathway is essential for inflammatory responses (30). To validate the proinflammatory effect of Lncenc1, we performed an NF-κB reporter assay and observed that Lncenc1 overexpression activated the NF-κB promoter activity (Fig. 5D). To be noted, transfection of MDH1 vector alone did not trigger more cytokine/chemokine expressions in MH-S macrophages or activate NF-B reporters compared with untransfected group (Fig. 5, B–D). In our previous study, we found that Lncenc1 was upregulated during the activation of the inflammasome. We next assessed if Lncenc1 could modulate the inflammasome activity in macrophages. Interestingly, our data showed that Lncenc1 overexpression promoted the secretion of IL-1β (Fig. 5E) and IL-18 (Fig. 5F) from BMDM, as well as the Caspase-1 activity (Fig. 5G).

Figure 5.

Overexpression of long noncoding RNA, embryonic stem cells expressed 1 (Lncenc1) promotes inflammation and inflammasome activation. A–C: MH-S cells were transfected with MDH1 or MDH1-Lncenc1 and treated with lipopolysaccharides (LPS) for 6 h. Untransfected MH-S cells were used as an additional control group. The gene expressions of Lncenc1 (A), cytokines including Il-1β, Il-6, Tnf-α, Il-18 (B), and chemokines including Ccl2, Cxcl1, Cxcl2 (C) were measured using qRT-PCR. D: pNL3.2.NF-κB-RE transfected HEK293T cells were co-transfected with or without MDH1 or MDH1-Lncenc1. NanoLuc luciferase activity was measured 24 h after transfection. E–G: bone marrow-derived macrophages (BMDM) were transfected with MDH1 or MDH1-Lncenc1. Then cells were incubated with or without LPS for 24 h. IL-1β release (E), IL-18 release (F), and Caspase-1 activity (G) were measured. Comparisons between two groups were performed using a two-tailed unpaired Student’s t test. Multiple groups were compared using a one-way ANOVA with Tukey’s method. All these results presented as means ± SD are from 3 or 4 independent experiments. ns, P > 0.05; *P < 0.05; **P < 0.01 vs. their corresponding control.

Knockdown of Lncenc1 Inhibits Inflammasome Activation

In addition to the gain-of-function analysis, we performed further experiments using specific ASO to knock down the Lncenc1 in macrophages. As shown in Fig. 6A, transfection of ASO reduced the level of Lncenc1 in LPS-treated MH-S. Knockdown of Lncenc1 significantly attenuated LPS-induced cytokine and chemokine expressions (Fig. 6, B and C). The release of inflammatory mediators, including IL-1β, IL-6, TNF-α, and CXCL1 were also decreased after ASO transfection (Fig. 6, D–G). Furthermore, we tested the role of Lncenc1 in inflammasome activity by transfecting ASO into BMDM. In agreement with gain-of-function data, knockdown of Lncenc1 repressed the Caspase-1 activity (Fig. 6H) and the secretion of IL-1β (Fig. 6I) and IL-18 (Fig. 6J).

Figure 6.

Knockdown of long noncoding RNA, embryonic stem cells expressed 1 (Lncenc1) inhibits inflammation and inflammasome activation. A–C: MH-S cells were transfected with Scr or antisense oligo (ASO) following lipopolysaccharides (LPS) treatment for 6 h. The gene expressions of Lncenc1 (A), cytokines including Il-1β, Il-6, Tnf-α (B), and chemokines including Ccl2, Cxcl1, Cxcl2 (C) were measured using qRT-PCR. D–G: MH-S cells were transfected with Scr or ASO following LPS treatment for 1 day. The secretion of IL-1β (D), IL-6 (E), TNF-α (F), and CXCL1 (G) were measured using ELISA. H–J: bone marrow-derived macrophages (BMDM) were transfected with Scr or ASO. Then cells were incubated with or without LPS for 24 h. Caspase-1 activity (H), IL-1β release (I), and IL-18 release (J) were measured. Data were analyzed using a two-tailed unpaired Student’s t test. All these results presented as means ± SD are from 3 or 4 independent experiments. ns, P > 0.05; *P < 0.05; **P < 0.01 vs. their corresponding control.

Knockdown of Lncenc1 Attenuates LPS-Induced Lung Injury

To examine the in vivo relevance of the aforementioned findings, we knocked down Lncenc1 expression in murine lungs using ASO. Our previous studies have demonstrated that small RNA-loaded EXOs can efficiently inhibit gene expression in lung macrophages (16, 21). Scr or ASO was loaded into EXO derived from serum and delivered as described in materials and methods. Electroporation provided a similar loading efficiency for both Scr and ASO (Fig. 7A). One day after the delivery of ASO, mice were given LPS via intrathecal to induce lung inflammation. We revealed that administration of ASO downregulated Lncenc1 in the lungs (Fig. 7B). Knockdown of Lncenc1 decreased the lung wet-to-dry weight ratio compared with the group received EXO-Scr (Fig. 7C). On histological examination using hematoxylin-eosin staining, we observed that the instilled EXO-ASO reduced the severity of lung injury and infiltration of neutrophil in LPS-treated lungs (Fig. 7, D–H). Multiple BAL inflammatory cytokines and chemokines were reduced, including IL-1β, TNF-α, IL-6, CXCL1, CXCL2, and IL-18 (Fig. 7, I–N).

Figure 7.

Knockdown of long noncoding RNA, embryonic stem cells expressed 1 (Lncenc1) attenuates lipopolysaccharides (LPS)-induced lung injury. A: the loading efficiency was evaluated by real-time PCR based on the absolute quantification method. B–N: mice (n = 6–9/group; male = 3–5 and female = 3–5/group) received PBS, exosomes (EXO), EXO-Scr or EXO-antisense oligo (ASO) via intrathecal. One day later, 1 µg LPS was given to all the groups. The mice were kept for an additional 24 h before examination. The expressions of Lncenc1 in lung tissue were measured using qRT-PCR (B). The lung wet-to-dry (W/D) weight ratio was calculated (C). Hematoxylin and eosin (H&E) staining was performed using lung sections (D) and the lung injury score was evaluated (E). Bronchoalveolar lavage (BAL) cells were stained (F). The number of macrophages (G) or neutrophils collected from BAL was counted (H). Scale bars = 100 μm. Released IL-1β (I), Tnf-α (J), IL-6 (K), CXCL-1 (L), CXCL-2 (M), and IL-18 (N) in BAL fluid were measured by ELISA. Comparisons between two groups were performed using a two-tailed unpaired Student’s t test. Multiple groups were compared using a one-way ANOVA with Tukey’s method. Results represent means ± SD; ns, P > 0.05; *P < 0.05; **P < 0.01.

Lncenc1 Deficiency Protects Mice against Bacteria-Induced Lung Injury

Recently, we bred Lncenc1 mutant mice (Fig. 8A) and homozygous mutant animals (Fig. 8B). We infected the WT mice and Lncenc1^−/− mice with K. pneu. and found that the ratio of wet-to-dry weight, a parameter of lung edema, was significantly lower in Lncenc1^−/− mice than those in WT mice 24-h postinfection (Fig. 8C). Lung injury was subsequently assessed by HE staining. Lncenc1^−/− mice showed lower levels of immune cell infiltration (Fig. 8D) and lung damage (Fig. 8E) compared with those in WT mice. Lncenc1^−/− mice also have reduced Caspase-1 activity, IL-1β, and IL-18 levels in BAL (Fig. 8, F–H), suggesting repressed inflammasome activity after Lncenc1 deletion. In line with ASO transfection, deficiency of Lncenc1 decreases the secretion of IL-1β (Fig. 8I) and IL-18 (Fig. 8J) from BMDM in response to LPS stimulation.

Figure 8.

Long noncoding RNA, embryonic stem cells expressed 1 (Lncenc1) deficiency protects mice against bacteria-induced lung injury. A: strategy to generate Lncenc1 mutant mice by homologous recombination. B: genotyping results from wild type (WT) (+/+), heterozygous (+/−), or homozygous knockout (−/−) mice. C–F: WT and Lncenc1^−/− mice (n = 4–6/group; male = 2 or 3 and female = 2 or 3/group) were infected with Klebsiella pneumoniae (K. pneu) [10⁴ colony-forming unit (CFU) per mouse] via intrathecal. The lung tissues were harvested 24 h after infection. Calculated lung wet/dry ratio from the uninfected or infected WT and Lncenc1^−/− (C). Hematoxylin and eosin (H&E) staining of the lung sections (D). Scale bar = 100 µm. The lung injury score is quantified (E). Bronchoalveolar lavage (BAL) Caspase-1 activity from the infected WT and Lncenc1^−/− (F). BAL IL-1β (G) and IL-18 (H) levels from the infected WT and Lncenc1^−/− were measured using ELISA. I and J: the secretion of IL-1β and IL-18 protein from WT and Lncenc1^−/− bone marrow-derived macrophages (BMDM) is quantified using ELISA. Comparisons between two groups were performed using a two-tailed unpaired Student’s t test. Multiple groups were compared using a one-way ANOVA with Tukey’s method. Results represent means ± SD; ns, P > 0.05; *P < 0.05; **P < 0.01.

DISCUSSION

Advanced sequencing technology and computational analysis have recently uncovered a tremendous amount of lncRNAs almost existing in all living organisms (2). Although many lncRNA transcripts probably result from transcriptional noise, emerging biological functions of lncRNAs have been reported (31). LncRNAs are emerging as important players in various biological processes, including cell differentiation (32), tumorigenesis (33), and pluripotency (34). Based on the localization and interaction of lncRNAs with DNA, RNA, and proteins, lncRNAs interfere with signaling pathways by controlling nuclear architecture and transcription as well as modulating stability and translation of cytoplasmic mRNAs (4). However, much less is known about the lncRNAs as regulators in innate immune responses in lung inflammation and infection pathogenesis. In this study, we aimed to characterize unexplored lncRNAs that regulate macrophage activation in bacterial-induced lung infection and inflammation.

This study delineated a novel function of Lncenc1, which was increased the most after G− bacterial infection in mouse lungs. Previously, Sauvageau et al. (35) examined the gene-expression patterns of several lincRNAs using various adult tissues and cell types. They suggested that several lincRNAs presented more restricted expression patterns, suggesting Lncenc1 showed specificity to mouse embryonic stem cells (ESC) (35). Their work was largely focused on expressions of Lncenc1 without functional study. Sun et al. reported the role of Lncenc1 in the energy metabolism in mouse ESC. Deletion of Lncenc1 in mouse ESC significantly reduced the glycolytic activity via PTBP1 and HNRNPK, which are key transcriptional factors that regulate the transcription of glycolytic genes (36). On the other hand, the expression of Lncenc1 in the developing and postnatal brain has been explored. For example, aging decreased expression levels of Lncenc1 in the cerebrum and mesencephalon of mice (37, 38); thus, those studies suggested that Lncenc1 has important roles in brain development and maintenance. In addition to these findings, Carelli et al. (39) observed the alteration of Lncenc1 levels during stem cell differentiation. Currently, most studies on Lncenc1 focus on its regulation in ESCs or during brain development.

Our study has several merits. First, we identified Lncenc1 as a novel lncRNA that responds to the G− bacterial infection. Our experiment elucidated that the expression level of Lncenc1 in the lungs was increased after infection of bacteria or LPS both in vivo and in vitro. Lncenc1 was validated as an LPS-inducible lncRNA in a time-dependent manner in macrophages rather than lung epithelial cells or PMN. Furthermore, Lncenc1 enhanced the classical activation of macrophages. The inflammatory cytokine genes (Il-1β, Il-6, and Tnf-α) and chemokine genes (Ccl2, Cxcl1, and Cxcl2) were upregulated in Lncenc1 overexpressed macrophages. Besides, the data from the reporter assay suggest that Lncenc1 may activate the NF-κB signaling pathway. Collectively, our study potentially provided initial insight into the role of Lncenc1 in the innate immune response.

Another insight of this study is that knockdown of Lncenc1 can reduce LPS-induced lung inflammation. ASO is a synthetic single-stranded nucleic acid polymer with 18–30 nucleotides, and it is commonly used to knock down the function of lncRNAs (40). The notable point here is that serum-derived EXO was used to deliver ASO using the method established in our laboratory (20). Although ASO is considered one of the stable systems to block lncRNA expression, achieving effective delivery to target tissues and cells remains a major challenge (41). The large size of ASO (4–10 kDa) did not allow ASO to cross the cellular membrane readily (42). To solve the issue, researchers tried to load ASO into EXO (43). In this study, we delivered loaded ASO-loaded EXO and successfully blocked Lncenc1 expression in murine lungs. Thus, we can reveal that inhibition of Lncenc1 attenuated inflammatory response after exposure to LPS.

In addition to the ASO delivery, we validated the loss-of-function data using Lncenc1 deficient mice and BMDM (Fig. 8). Lncenc1 deletion protects murine lungs from severe injury at the early stage of K. pneu infection. However, the long-term effects of Lncenc1 deficiency need to be evaluated in future studies. In addition, the Lncenc1 deficient mice used in our study are a conventional, not conditional knockout. The protective effect may be contributed not only by its deletion in macrophages but also in other types of cells. For example, stem cells (35, 36, 39).

Even though lncRNAs are poorly conserved across species and show little sequence constraints, studies have identified hundreds of lncRNAs with functionality conserved despite limited sequence conservation between mice and humans (44). Our study is an initial investigation of human linc-ENC1 (also called LINC01157). Human linc-ENC1 and mouse Lncenc1 share a similar genomic structure (Fig. 2A). Our study also showed that human linc-ENC1 (Fig. 4, C and D) and mouse Lncenc1 (Fig. 3C and Fig. 4B) could be upregulated in macrophages exposed to LPS or G− bacteria, suggesting both have the same gene regulation pattern. Although all the evidence indicates that linc-ENC1 is more likely to have a similar function observed in mice, further studies are needed to validate the role of human linc-ENC1 in inflammasome activation during bacterial infection.

Lncenc1 enhanced the activity of Caspase-1 and the secretions of IL-1β and IL-18 from macrophages, which indicates its role in inflammasome activation. Interestingly, we observed that Lncenc1 is upregulated upon inflammasome activation, which is rescued by NLRP3 inhibitor, suggesting the potential existence of a positive feedback loop between Lncenc1 and inflammasome activation. We hypothesize that cytoplasmic Lncenc1 might facilitate inflammasome assembly. However, the mechanistic insight between Lncenc1 and inflammasome is not fully explored in the current study. Therefore, further investigation is needed to uncover the detailed mechanism by which Lncenc1 regulates the activation of the inflammasome.

DATA AVAILABILITY

Data will be made available upon reasonable request.

GRANTS

This work was supported by the National Institutes of Health (NIH) grants NIH/National Heart, Lung, and Blood Institute (NHLBI) R00 HL141685, NIH/National Institute of Allergy and Infectious Diseases (NIAID) R03 AI152003 (to D. Zhang), and NIH/NIAID R03 AI169063 (to X. Wang).

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the authors.

AUTHOR CONTRIBUTIONS

D.Z. conceived and designed research; Y.H., Y.Z., S.D., and D.Z. performed experiments; Y.H., Y.Z., S.A., X.W., and D.Z. analyzed data; Y.H., Y.Z., S.A., X.W., and D.Z. interpreted results of experiments; Y.H., Y.Z., and D.Z. prepared figures; Y.H., Y.Z., and D.Z. drafted manuscript; D.Z. edited and revised manuscript; Y.H., Y.Z., S.D., S.A., X.W., and D.Z. approved final version of manuscript.