Skip to main content
NCBI home page
International Journal of Immunopathology and Pharmacology logoLink to International Journal of Immunopathology and Pharmacology
. 2023 Apr 6;37:03946320231169175. doi: 10.1177/03946320231169175

Experimental study on the effect of luteolin on the proliferation, apoptosis and expression of inflammation-related mediators in lipopolysaccharide-induced keratinocytes

Xinpei Wang 1,*, Yue Yao 1,*, Yexian Li 1, Shujing Guo 1, Yanjia Li 1,✉, Guoqiang Zhang 1,2,✉
PMCID: PMC10087617  PMID: 37024790

Abstract

Objective

This study aimed at exploring the effects of luteolin on psoriasis-like cell model proliferation, apoptosis regulation and the expression of inflammation-related mediators.

Methods

A Cell Counting Kit-8 (CCK-8) assay was used to determine the survival rate of human immortalized keratinocytes (HaCaT cells) and normal human epidermal keratinocytes (NHEK cells) following stimulation with luteolin and lipopolysaccharide (LPS). Western blot and reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analysis were used to detect the protein and mRNA expressions of nuclear factor (NF)-κB p65 and interleukin (IL)-6 after LPS stimulation. Then a luteolin stimulation protocol (10 μmol/L, 24 h) was determined and a reasonable LPS stimulation concentration (20 μg/mL, 24 h) was chosen to establish the psoriasis cell model. Keratinocytes in luteolin pre-treatment and control groups were stimulated with 20 μg/mL LPS for 24 h, and the expressions of NF-κB p65 and IL-6 were detected by western blot and RT-qPCR. The apoptosis of HaCaT cells was detected by flow cytometry, and the enzyme-linked immunosorbent assay (ELISA) was used to detect the expression of psoriasis-related inflammatory factors.

Results

CCK-8 assay indicated that luteolin inhibited the proliferation of keratinocytes. LPS stimulated the proliferation of keratinocytes and upregulated the expression of NF-κB p65 and IL-6 in a concentration-dependent manner, and induced psoriasis-like changes. Furthermore, the protein and mRNA expression levels of NF-κB p65 and IL-6 were decreased in the luteolin pre-stimulation group (p < 0.05). Treatment with luteolin downregulated the expression of the LPS-induced inflammatory mediators in keratinocytes (p < 0.05). The flow cytometry results showed that luteolin induced HaCaT cells apoptosis. Finally, ELISA results demonstrated that luteolin inhibited the release of the IL-17, IL-23 and tumor necrosis factor α (TNF-α) in the pre-stimulation group (p < 0.05).

Conclusion

This study confirmed that luteolin can effectively relieve inflammatory mediators in LPS-induced keratinocyte models of psoriasis, which suggested the potential of luteolin in treating psoriasis.

Keywords: psoriasis, luteolin, keratinocyte, proliferation, apoptosis, mediators of inflammation

Introduction

Psoriasis is a chronic, relapsing, immune-mediated inflammatory disease induced by the combined effects of genetics and environment. An important feature related to the pathophysiology of psoriasis is the accelerated proliferation of keratinocytes in the stratum basale of the epidermis and the infiltration of inflammatory cells in the epidermis and dermis. 1 Psoriasis vulgaris is the most common type of psoriasis, and the clinical features include papules, erythema and plaques, with a thick layer of white scales covered on the surface. Keratinocytes, natural killer T cells (NKT), plasmacytoid dendritic cells (pDC), macrophages and fibroblasts play a key role in the pathogenesis of psoriasis vulgaris. 2 They can secrete specific inflammatory mediators, such as tumor necrosis factor-alpha (TNF-α), interleukin (IL)-1 and IL-6, which stimulate keratinocytes proliferation in turn. These inflammatory mediators activate myeloid dendritic cells (mDC), inducing the secretion of IL-12 and IL-23 from naive T cells, thereby differentiating naive T cells into T helper (Th) 1 and Th17 cells.2,3 Th17 cells can secrete cytokines such as IL-17, TNF-α, IL-21 and IL-22. Among them, IL-21 plays a role as an autocrine factor promoting the expansion of the Th17 lineage. Additionally, the inflammatory mediators secreted by Th1 and Th17 cells, further activate keratinocytes to generate antimicrobial peptides, inflammatory mediators and chemokines. This mechanism promotes the adaptive immune process of keratinocytes. 4 In addition, nuclear factor (NF)-κB is an essential nuclear transcription factor composed of NF-κB1 (p50), NF-κB2 (p52), c-Rel, RelB and RelA (p65), which are upregulated in the psoriatic lesions. 5 It is found that mRNA expressions of NF-κB p50 and p65 were increased in psoriasis patients compared with healthy controls. 6 The subunit of the NF-κB p65 translocates to the nucleus, and then inflammatory signal exerts a positive feedback effect to further activate the NF-κB signaling pathway, forming a circular loop of continuous amplification of inflammation. 7

Luteolin is a type of bioflavonoids. This pure yellow crystal compound exists in plants widely. 8 The known pharmacological effects of luteolin include the inhibition of cell proliferation, the promotion of cell death, anti-inflammation, antioxidant and anti-tumorigenesis. 9 A study showed that luteolin could inhibit macrophage phosphorylation, NF-κB activity and the secretion of TNF-α and IL-6 in LPS-induced macrophages. 10 Another study demonstrated that the inhibition of NF-κB activation via suppressing the phosphorylation of p65, significantly increased insulin resistance in endothelial cells. Insulin resistance protects the integrity of endothelial cells and participates in the inflammatory response. 11 In the treatment and prevention of cancer, luteolin can attenuate tumorigenesis via inhibiting kinases, regulating cell cycle, promoting apoptosis and downregulating the expression of several transcription factors. 12

HaCaT cells are immortalized human keratinocytes and NHEK cells are human epidermal keratinocytes. Both of them are derived from normal adult human skin tissue and have the basic characteristics of normal human keratinocytes. They are often used to construct in vitro models for the study of inflammation-associated skin diseases.13,14 Therefore, HaCaT and NHEK cells have been widely used as good vectors for the study of psoriasis. LPS is a complex molecule in the cell wall of gram-negative bacteria, which can cause abnormal proliferation of different types of cells via mediating the secretion of endogenous mediators in vitro. It has been reported that LPS can stimulate the inflammatory response, thus leading to excessive proliferation of keratinocytes. 15

Based on the pathogenesis of psoriasis and the pharmacological functions of luteolin, our study aimed to investigate whether luteolin could inhibit LPS-induced keratinocyte proliferation and the secretion of psoriasis-related inflammatory factors.

Materials and methods

Main reagents

Luteolin was purchased from Solarbio, Beijing, China. It was dissolved in dimethyl sulfoxide (DMSO) and adjusted to 100 mmol/l (stock solution). LPS (Thermo Fisher, USA) was dissolved in phosphate buffered saline (PBS) at a stock solution concentration of 1 mg/ml. The Cell Counting Kit-8 (cat. no. BS350 B 500T) was obtained from Biosharp Life Sciences, Hefei, China. Antibodies against NF-κB p65 (cat. no. ET1630-12) and IL-6 (cat. no. R1412-2) were purchased from HuaAn Biotechnology, Hangzhou, China. The Annexin A5 FITC/7-AAD kit (cat. no. B60224-AB) was obtained from Beckman Coulter, USA. And the IL-17, IL-23 and TNF-α Human ELISA kits were brought from Fanke Testing Technology, Shanghai, China.

Cell culture

The HaCaT cell line was purchased from Chinese National Infrastructure of Cell Line Resource (Beijing, China) and the NHEK cell line was obtained from American Type Culture Collection (Manassas, USA). HaCaT and NHEK cells were, respectively, maintained in Minimum Essential Medium (Hyclone, USA) and Dulbecco’s Modifed Eagle’s Medium (Gibco, USA) supplemented with 10% fetal bovine serum (FBS) (Hyclone, USA) and 1% penicillin-streptomycin (Gibco, USA), and were cultured at 37°C in a humidified atmosphere of 5% CO2.

Cell grouping

HaCaT and NHEK cells were treated with 0.25% trypsin-ethylene diamine tetraacetic acid (EDTA) solution, and the digestion was terminated by the medium. The cells were seeded at density of 1.5 x 105 cells/well into 6-well plates and incubated for 24 h.

To select the optimal conditions for establishing a psoriasis cell model, cells were divided into five groups treated with various concentrations of LPS (0, 0.1, 1, 10 and 20 μg/ml) for 24 h. Furthermore, to verify the effect of luteolin on suppressing the expression of the psoriasis-related inflammatory mediators, cells were divided into the following four groups: control group, LPS-stimulated group, luteolin-stimulated group and luteolin pre-stimulated LPS-stimulated group. To investigate the effect of luteolin on the induction of HaCaT cell apoptosis, cells were divided into the control and luteolin-stimulated groups.

Cell counting kit-8 (CCK-8) assay

Cells were seeded into 96-well plates at a density of 1 x 104 cells/well. Each group was performed independently for five times. Following incubation for 24 h, cells were treated with different concentrations of luteolin (0, 1, 10, 25, 50 and 100 μmol/l) and were then incubated for 24, 48 and 72 h. In addition, LPS was diluted in various concentrations (0, 0.1, 1, 10 and 20 μg/ml) and was seeded into each well of the other 96-well plates and incubated for 24 h. Subsequently, CCK-8 reagent (10 μL/well) was added into each well and incubated for an additional 4 h. The absorbance at 450 nm was determined in each well using the PerkinElmer EnSpire microplate reader (Promega, USA).

Western blot analysis

The collected cells were lysed by lysis buffer, containing 99% radio immunoprecipitation assay (RIPA) Lysis Buffer and 1% phenylmethanesulfonyl fluoride (Solarbio, Beijing, China). The protein concentration was determined by bicinchoninic acid (BCA) Protein Assay Kit (Biosharp Life Sciences, Hefei, China). Proteins were first separated by 10% SDS-polyacrylamide gel electrophoresis and were then transferred onto polyvinylidene fluoride (PVDF) membranes (Biosharp Life Sciences, Hefei, China). Membranes were blocked with 5% skim milk for 2 h and then washed by 1X TBST three times for 10 min each on a shaking table. Next, membranes were incubated overnight at 4°C with antibodies against NF-κB p65 (dilution,1:2,000), IL-6 (dilution, 1:10,000) and β-actin (dilution, 1:2,000; all from Biosharp Life Sciences, Hefei, China). The next day, the membranes were washed following incubation with a secondary Goat anti-Rabbit IgG (dilution, 1:1,000; Abbkine, Wuhan, China) for 2 h. The images were captured using the Odyssey CLX Infrared Imaging System (LI-COR, USA).

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analysis

Total RNA was extracted from cells using the RNApure reagent (Promega, USA), and it was reverse transcribed into complementary DNA (cDNA) using the 5X ABCScript II RT Mix (Abclonal, Wuhan, China). The resultant cDNA was amplified on the 7500 Fast Real-Time PCR System (Thermo Fisher, USA). The relative expression of mRNA level was calculated using the ∆∆Ct method. The PCR conditions used were as follows: pre-incubation at 95°C for 3 min, followed by 40 cycles for amplification at 95°C for 5 s and 60°C for 34 s. The melting curve was automatically adjusted by the machine. And β-actin was used as the standard reference. The primer sequences are listed in Table 1.

Table 1.

Primer sequence.

Primer Forward Reverse
β-actin CTCCATCCTGGCCTCGCTGT GCTGTCACCTTCACCGTTCC
NF-κB p65 CCACCGGGAACGAAAGAGAA GAGAAGGCAACTGGACCGAA
IL-6 ACTCACCTCTTCAGAACGAATTG CCATCTTTGGAAGGTTCAGGTTG
Open in a new tab

Flow cytometric analysis

The cells were grouped and harvested. Then the cell suspension was washed with PBS and resuspended in ice-cold 1X Binding Buffer after centrifugation at 1000 r/min for 5 min. Following resuspension, cells were supplemented with 10 μl of Annexin A5-FITC solution and 20 μl of 7-AAD Viability Dye. Finally, cells were incubated on ice for 15 min in the dark and then analyzed on the FACScan Flow Cytometer (Becton Dickinson, USA).

Enzyme-linked immunosorbent assay (ELISA) analysis

The treated cells were centrifuged at 1000 r/min for 10 min and the supernatant was collected. The secretion levels of IL-17, IL-23 and TNF-α were measured in the culture medium using the Human IL-17, IL-23 and TNF-α ELISA Kits, respectively. The sensitivity of the kits was 0.7 ng/l for IL-17, 200 ng/l for IL-23, and 20 ng/l for TNF-α. The samples were diluted 5X and the absorbance was measured on a PerkinElmer EnSpire reader (Promega, USA).

Statistical analyses

The results are presented as mean ± standard deviation and each experiment was repeated at least three times. The statistical significance was determined by one-way ANOVA to compare three or more groups or by Student’s t-test for the comparison between two groups. p < 0.05 was considered as statistically significant.

Results

Luteolin inhibits the proliferation of keratinocytes

HaCaT and NHEK cells were treated with various concentrations of luteolin (0, 1, 10, 25, 50 and 100 μmol/l) for 24, 48 and 72 h. Cell viability was measured by CCK-8 method. The results showed that the increasing concentration and stimulation-time of luteolin in HaCaT and NHEK cells exerted different inhibitory effects on cell viability. When cells were treated with 1 and 10 μmol/l luteolin for 24 h, there was no statistic significant in the inhibitory effect of luteolin (p > 0.05) (Figure 1(a) and (b)). Therefore, a concentration of 10 μmol/l luteolin was selected to treat cells for 24 h for the subsequent experiments.

Figure 1.

Figure 1.

Open in a new tab

Luteolin inhibited the proliferation of keratinocytes and LPS-induced psoriatic dermatitis-like changes in HaCaT and NHEK cells. (a–b) Effects of different concentrations of luteolin on the survival rate of HaCaT and NHEK cells at different time-points. (c–d) HaCaT and NHEK cells were treated with different concentrations of LPS for 24 h and its effect on cell proliferation was determined. (e–h) The mRNA expression levels of IL-6 and NF-κB p65 in HaCaT and NHEK cells. (i) The protein expression of the inflammatory mediators, NF-κB p65 and IL-6, was detected by western blot analysis. The relative protein expression levels of (j) IL-6 and (k) NF-κB p65 in total protein extracts. β-actin served as a loading control. Data are expressed as the mean ± standard deviation (SD). n = 3. *p < 0.05, **p < 0.01, ***p < 0.001. LPS, lipopolysaccharide; NF-κB, nuclear factor κB; IL-6, interleukin-6.

LPS induces psoriatic dermatitis-like changes in keratinocytes

Cells were treated with various concentrations of LPS (0, 0.1, 1, 10 and 20 μg/ml) for 24 h. CCK-8 assay demonstrated that LPS had an obvious dose-dependent effect on HaCaT and NHEK cell proliferation (Figure 1(c) and (d)). Western blot and RT-qPCR assays were applied to detect the expression levels of the psoriasis-related inflammatory factors, including NF-κB p65 and IL-6, in cells treated with different concentrations of LPS. With the increase of LPS concentration, the protein and mRNA expression levels of NF-κB p65 and IL-6 increased gradually. The expression of NF-κB p65 and IL-6 reached the highest level when cells were treated with 20 μg/ml LPS (p < 0.01) (Figure 1(e) to (k)).

Luteolin inhibits LPS-induced psoriatic-like dermatitis in human keratinocytes

The protein and mRNA expression levels of NF-κB p65 and IL-6 in human keratinocytes stimulated by LPS were significantly higher than those in the control group (p < 0.01), which demonstrated that the psoriasis cell model was established successfully. In the luteolin-stimulated group, no significant differences were obtained in the expression of the inflammatory mediators compared with the control group (p > 0.05). However, the expression levels of NF-κB p65 and IL-6 protein and mRNA in LPS-induced keratinocytes were significantly lower in luteolin pre-treated cells for 24 h than in no luteolin pre-treated cells (p < 0.05) (Figure 2).

Figure 2.

Figure 2.

Open in a new tab

Luteolin inhibited LPS-induced psoriatic-like dermatitis in HaCaT and NHEK cells. The cells were divided into four groups, namely, the control group, the LPS-stimulated group, the luteolin-stimulated group and the LPS-stimulated luteolin pre-stimulated group. (a) Western blot analysis results showing the protein expression levels of (b) IL-6 and (c) NF-κB p65 in HaCaT cells. (d–g) RT-qPCR results showing the mRNA expression levels of NF-κB p65 and IL-6 in HaCaT and NHEK cells. Data are expressed as the mean ± standard deviation (SD). n = 3. *p < 0.05, **p < 0.01, ***p < 0.001. n.s., non-significant; LPS, lipopolysaccharide; Lut, luteolin; NF-κB, nuclear factor κB; IL-6, interleukin-6.

Luteolin induces HaCaT cell apoptosis

The cell apoptosis was evaluated in HaCaT cells treated with luteolin using flow cytometric assays. Compared with the control group, the percentage of normal cells in the luteolin-treated group was decreased and the early apoptotic cells were increased. In addition, the results showed that luteolin promoted the differentiation of normal cells to early apoptotic cells (p < 0.01). These findings indicated that luteolin could promote apoptosis in HaCaT cells (Figure 3).

Figure 3.

Figure 3.

Open in a new tab

Luteolin promoted HaCaT cell apoptosis. HaCaT cells were treated with luteolin (10 μmol/l) alone for 24 h. The cells were then stained with Annexin V-FITC and 7-AAD followed by flow cytometric analysis. The percentage of each cell population in LL, LR, UR and UL is presented. Data are expressed as the mean ± standard deviation (SD). n = 3. *p < 0.05, **p < 0.01, ***p < 0.001. n.s., non-significant.

Luteolin inhibits the release of psoriasis-related inflammatory mediators in LPS-induced HaCaT cells

ELISA results showed that the levels of IL-17, IL-23 and TNF-α in the collected culture medium of LPS-induced HaCaT cells were remarkably different from those in the control group (p < 0.01). There was no significant difference in the expression of the inflammatory mediators in luteolin-treatment group (p > 0.05). However, following pre-treatment with luteolin, the release of psoriasis-related inflammatory mediators was decreased in LPS-induced HaCaT cells (p < 0.01) (Figure 4).

Figure 4.

Figure 4.

Open in a new tab

Luteolin inhibited the release of psoriasis-related inflammatory mediators in LPS-induced HaCaT cells. The culture medium was collected for enzyme-linked immunosorbent assay following treatment of cells with different inducers. The secretion of the psoriasis-associated inflammatory mediators (A) IL-17, (B) IL-23 and (C) TNF-α in the culture medium. Data are expressed as the mean ± standard deviation (SD). n = 3. *p < 0.05, **p < 0.01, ***p < 0.001. n.s., non-significant; LPS, lipopolysaccharide; Lut, luteolin; IL-17, interleukin-17; TNF-α, tumor necrosis factor-alpha.

Discussion

Psoriasis is a common immune-mediated inflammatory disease characterized by abnormal proliferation of epidermal cells and infiltration of inflammatory cells in the dermis and epidermis. 16 Therefore, inhibiting epidermal cell proliferation, inflammatory cell infiltration and inducing apoptosis are essential for the treatment of psoriasis. Anson et al. 17 demonstrated that luteolin could inhibit the proliferation of glioblastoma cells treated with or without epidermal growth factor (EGF) by measuring cell viability in vitro. Herein, the viability of HaCaT and NHEK cells treated with luteolin was investigated. The results revealed that luteolin could attenuate the proliferation of keratinocytes. Li et al. 13 showed that LPS could induce inflammatory injury in HaCaT cells and mediate abnormal cell proliferation via releasing endogenous mediators in vitro. In order to investigate the effect of LPS on the expression of NF-κB p65 and IL-6, as well as the expression of psoriasis-associated inflammatory mediators, a 20 μg/ml LPS cell model was established.

The present study manifested that luteolin could suppress the expression of psoriasis-related inflammatory factors. Weng et al. 6 showed that pre-stimulation with luteolin significantly downregulated the TNF-α-induced mRNA expression of IL-6, IL-8 and vascular endothelial growth factor (VEGF), and decreased NF-κB mRNA and protein levels. It has been reported that NF-κB in the keratinocytes is involved in the maintenance of skin homeostasis by building mouse models of psoriasis, and the perturbation of canonical NF-κB can cause cell death, immune infiltration and hyperkeratosis. 18 Lv et al. 19 revealed that luteolin could alleviate psoriasis via reversing the action of IFN-γ, inhibiting the expression of heat shock protein 90 (HSP90, a key regulator of inflammation in psoriasis) and regulating the proportion of immune cells.

The apoptotic effect of luteolin has been associated with the activation of c-Jun N-terminal kinase (JNK) and inhibition of NF-κB p65 translocation. Studies have shown that luteolin promotes the cleavage of procaspase-9 and upregulates the expression of caspase-3, JNK and Bcl-2 associated protein X (BAX), thus inducing cytotoxicity via blocking cell cycle progression and inducing apoptosis. 20 It has been also reported that luteolin suppresses JNK activation in macrophages and activates this kinase in cancer cells to suppress NF-κB via attenuating the production of IκB kinase (IKK) during inflammation of epithelial cells and macrophages. 8 Furthermore, luteolin may act as an important role in the treatment of skin tumors and related diseases via activating caspase-14 to induce the terminal differentiation of keratinocytes. 21 There is evidence demonstrated that luteolin has the potential to enhance the activity of caspase-3, inducing the enhanced expression of caspase-3 in HaCaT cells. Meanwhile, the increased expression of caspase-14 may activate the differentiation process leading to apoptosis in vitro. This study also highlights that luteolin, delivered by polyethylene glycol (PEG) liposomes, could effectively promote caspase-3/14-mediated programmed death in human keratinocytes. 22 The effect of luteolin on promoting apoptosis has been confirmed in several cell types. For example, in human colon cancer LoVo cells, luteolin promoted cell cycle arrest in the G2/M phase and inactivated cyclin B1/cell division cycle 2, thus inducing apoptosis. 23

In recent years, several biological agents targeting different inflammatory mediators have been developed to treat severe psoriasis. The number of biological agents targeting IL-23, IL-17 and TNF-α to treat psoriasis has been increasing rapidly, including the TNF-α inhibitors adalimumab and infliximab, the IL-12/IL-23 inhibitor ustekinumab, the IL-17 inhibitors secukinumab, ixekizumab and brodalumab, and the IL-23 inhibitors guselkumab, tildrakizumab and risankizumab.24,25 The inhibitory effect of luteolin on IL-23, IL-17 and TNF-α revealed that luteolin partially mimics the effects of the biological agents, suggesting that this agent could be effective in treating psoriasis.

In this study, we successfully established psoriasis cell model by inducing HaCaT cells with LPS, confirming that luteolin can inhibit the proliferation of keratinocytes, effectively downregulate the expression of LPS-induced inflammatory mediators and induce apoptosis of HaCaT cells (p < 0.05). In addition, luteolin could attenuate the release of the inflammatory mediators TNF-α, IL-17 and IL-23 (p < 0.05). Otherwise, we confirmed our main findings at the mRNA level by RT-qPCR in NHEK cells. These findings confirm the potential of luteolin for psoriasis treatment at the cellular level. There may be some possible limitations in this study. Our findings have only been verified in vitro level and lack evidence in vivo. However, the results are consistent with the in vivo studies by Zhou et al. 26 In future studies, we will investigate the effect and mechanism of luteolin on psoriasis both in vivo and in vitro. There are scarce studies on the application of luteolin in patients with psoriasis. Lotion containing luteolin analogue, tetramethoxyluteolin, was applied to the skin lesions of four psoriasis patients twice a day for a month, and the psoriatic lesions were significantly improved. This ingredient was also successfully tolerated in 25 patients with mastocytosis and mast cell activation syndrome who could not tolerate any cosmetic products. These results suggest that this luteolin analogue has potential as a topical drug for the treatment of psoriasis. 27

Conclusion

Luteolin inhibited the proliferation of keratinocytes, effectively downregulated the expression of LPS-induced inflammatory mediators, including NF-κB p65 and IL-6, and induced apoptosis of human keratinocytes. In addition, luteolin could attenuate the release of the inflammatory mediators TNF-α, IL-17 and IL-23. These findings suggested that luteolin can be used as a potential molecule for further treatment of psoriasis and other inflammatory-related skin diseases.

Footnotes

Authors’ contribution: Guoqiang Zhang and Yanjia Li designed the experiments. Yue Yao and Xinpei Wang obtained the experimental data and wrote the manuscript. Yexian Li and Shujing Guo analyzed the experimental data and composed all figures and tables. All authors read and approved the final manuscript.

The authors declare that there is no conflict of interest.

Funding: This work was supported by the Study on the role and Mechanism of Luteolin in psoriasis, Hebei Provincial Government Funded Clinical Medicine Excellent Talents Project (No. LS202004).

ORCID iD

Guoqiang Zhang https://orcid.org/0000-0002-4132-1690

References

  • 1.Rendon A, Schäkel K. (2019) Psoriasis pathogenesis and treatment. Int J Mol Sci 20(6): 1475. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Wang A, Bai Y. (2020) Dendritic cells: the driver of psoriasis. The Journal of dermatology 47(2): 104–113. [DOI] [PubMed] [Google Scholar]
  • 3.Kim TG, Kim SH, Lee MG. (2017) The origin of skin dendritic cell network and its role in psoriasis. Int J Mol Sci 19(1):42. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Fragoulis GE, Siebert S, McInnes IB. (2016) Therapeutic targeting of IL-17 and IL-23 cytokines in immune-mediated diseases. Annu Rev Med 67(11): 337–353. [DOI] [PubMed] [Google Scholar]
  • 5.Goldminz AM, Au SC, Kim N, et al. (2013) NF-κB: an essential transcription factor in psoriasis. J Dermatol Sci 69(2): 89–94. [DOI] [PubMed] [Google Scholar]
  • 6.Weng Z, Patel AB, Vasiadi M, et al. (2014) Luteolin inhibits human keratinocyte activation and decreases NF-κB induction that is increased in psoriatic skin. PLoS One 9(2): e90739. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Thatikonda S, Pooladanda V, Sigalapalli DK, et al. (2020) Piperlongumine regulates epigenetic modulation and alleviates psoriasis-like skin inflammation via inhibition of hyperproliferation and inflammation. Cell Death Dis 11(1): 21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Ahmed S, Khan H, Fratantonio Det al. (2019) Apoptosis induced by luteolin in breast cancer: mechanistic and therapeutic perspectives. Phytomedicine: International Journal of Phytotherapy and Phytopharmacology 59: 152883. [DOI] [PubMed] [Google Scholar]
  • 9.Aziz N, Kim MY, Cho JY. (2018) Anti-inflammatory effects of luteolin: a review of in vitro, in vivo, and in silico studies. J Ethnopharmacol 225: 342–358. [DOI] [PubMed] [Google Scholar]
  • 10.Choi EY, Jin JY, Choi JI, Choi IS, Kim SJ. (2011) Effects of luteolin on the release of nitric oxide and interleukin-6 by macrophages stimulated with lipopolysaccharide from Prevotella intermedia. J Periodontol 82(10): 1509–1517. [DOI] [PubMed] [Google Scholar]
  • 11.Manzoor MF, Ahmad N, Ahmed Z, Siddique R, Zeng XA, Rahaman A, et al. (2019) Novel extraction techniques and pharmaceutical activities of luteolin and its derivatives. J Food Biochem 43(9): e12974. [DOI] [PubMed] [Google Scholar]
  • 12.Imran M, Rauf A, Abu-Izneid T, et al. (2019) Luteolin, a flavonoid, as an anticancer agent: a review. Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie 112: 108612. [DOI] [PubMed] [Google Scholar]
  • 13.Li C, Xiao L, Jia J, Li F, Wang X, Duan Q, et al. (2019) cornulin is induced in psoriasis lesions and promotes keratinocyte proliferation via phosphoinositide 3-Kinase/Akt pathways. J Invest Dermatol 139(1): 71–80. [DOI] [PubMed] [Google Scholar]
  • 14.Zhang M, Li N, Cai R, Gu J, Xie F, Wei H, et al. (2021) Rosmarinic acid protects mice from imiquimod induced psoriasis-like skin lesions by inhibiting the IL-23/Th17 axis via regulating Jak2/Stat3 signaling pathway. Phytother Res: PT 35(8): 4526–4537. [DOI] [PubMed] [Google Scholar]
  • 15.Yang X, Dang X, Zhang X, Zhao S. (2021) Liquiritin reduces lipopolysaccharide-aroused HaCaT cell inflammation damage via regulation of microRNA-31/MyD88. Int Immunopharm 101(Pt B): 108283. [DOI] [PubMed] [Google Scholar]
  • 16.Nestle FO, Kaplan DH, Barker J. (2009) Psoriasis. N Engl J Med 361(5): 496–509. [DOI] [PubMed] [Google Scholar]
  • 17.Anson DM, Wilcox RM, Huseman ED, Stump TA, Paris RL, Darkwah BO, et al. (2018) Luteolin decreases epidermal growth factor receptor-mediated cell proliferation and induces apoptosis in glioblastoma cell lines. Basic Clin Pharmacol Toxicol 123(6): 678–686. [DOI] [PubMed] [Google Scholar]
  • 18.Grinberg-Bleyer Y, Dainichi T, Oh H, Heise N, Klein U, Schmid RM, et al. Cutting edge: NF-κB p65 and c-Rel control epidermal development and immune homeostasis in the skin. J Immunol 2015;194(6):2472-2476. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Lv J, Zhou D, Wang Y, Sun W, Zhang C, Xu J, et al. (2020) Effects of luteolin on treatment of psoriasis by repressing HSP90. Int Immunopharm 79: 106070. [DOI] [PubMed] [Google Scholar]
  • 20.Cai X, Ye T, Liu C, Lu W, Lu M, Zhang J, et al. (2011) Luteolin induced G2 phase cell cycle arrest and apoptosis on non-small cell lung cancer cells. Toxicol Vitro: An International Journal Published in Association with BIBRA 25(7): 1385–1391. [DOI] [PubMed] [Google Scholar]
  • 21.George VC, Kumar DRN, Suresh PK, Kumar RA. (2015) Luteolin induces caspase-14-mediated terminal differentiation in human epidermal keratinocytes. In vitro cellular & developmental biology. Animal 51(10): 1072–1076. [DOI] [PubMed] [Google Scholar]
  • 22.Sinha APKS. (2019) Enhanced induction of apoptosis in hacat cells by luteolin encapsulated in pegylated liposomes-role of caspase-3/caspase-14. Applied biochemistry and biotechnology 188(1): 147–164. [DOI] [PubMed] [Google Scholar]
  • 23.Chen Z, Zhang B, Gao F, Shi R. (2018) Modulation of G(2)/M cell cycle arrest and apoptosis by luteolin in human colon cancer cells and xenografts. Oncol Lett 15(2): 1559–1565. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Erichsen CY, Jensen P, Kofoed K. (2020) Biologic therapies targeting the interleukin (IL)-23/IL-17 immune axis for the treatment of moderate-to-severe plaque psoriasis: a systematic review and meta-analysis. J Eur Acad Dermatol Venereol: JEADV 34(1): 30–38. [DOI] [PubMed] [Google Scholar]
  • 25.Griffiths CEM, Armstrong AW, Gudjonsson JE, Barker JNWN. (2021). Psoriasis. Lancet (London, England) 397(10281): 1301–1315. [DOI] [PubMed] [Google Scholar]
  • 26.Zhou W, Hu M, Zang X, Liu Q, Du J, Hu J, et al. (2020) Luteolin attenuates imiquimod-induced psoriasis-like skin lesions in BALB/c mice via suppression of inflammation response. Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie 131: 110696. [DOI] [PubMed] [Google Scholar]
  • 27.Theoharides TC, Stewart JM, Tsilioni I. (2017) Tolerability and benefit of a tetramethoxyluteolin-containing skin lotion. Int J Immunopathol Pharmacol 30(2): 146–151. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from International Journal of Immunopathology and Pharmacology are provided here courtesy of SAGE Publications

RESOURCES