Skip to main content
International Wound Journal logoLink to International Wound Journal
. 2022 Dec 21;20(5):1667–1677. doi: 10.1111/iwj.14028

CCN1 secreted by human adipose‐derived stem cells enhances wound healing and promotes angiogenesis through activating the AKT signalling pathway

Yi Yang 1,2, Shiyi Li 1,2, Xuer Sun 1,2, Lixia Zhang 1,2, Minliang Chen 1,, Huijuan Fu 1
PMCID: PMC10088821  PMID: 36541685

Abstract

The study aimed to explore the role of cellular communication network factor 1 (CCN1) an extracellular matrix protein in hADSC‐treated wound healing. Immunofluorescence and enzyme‐linked immunosorbent assays (ELISA) were used to demonstrate the secretion of CCN1 by hADSCs, isolated from human fat tissue. We investigated the role of CCN1 in wound healing by knockdown of CCN1 expression in hADSCs using CCN1 siRNA. Conditioned medium of hADSCs or hADSCs with CCN1 knocked down (hADSC‐CMCCN1↓) was collected. After treatment with plain DMEM/F12, hADSC‐CM, hADSC‐CMCCN1↓, or recombinant human CCN1 (rhCCN1), the wound healing abilities of human umbilical vascular endothelial cells (HUVECs) were assayed, and the AKT, also known as protein kinase B (PKB), signalling pathway was detected using western blotting. Next, we created full‐thickness skin wounds on the backs of the mice and different treatments were applied to the wound surface. Wound size was measured using a digital camera on days 0–10, and evaluated. H&E and immunohistochemical staining were performed, and laser Doppler perfusion imaging was used to evaluate blood perfusion. The wound model and wound‐healing assay showed that the hADSCs‐CM and rhCCN1 groups had enhanced wound healing compared to the hADSCs‐CMCCN1↓ group. Further, CCN1 and hADSCs‐CM promoted the proliferation and migration of HUVECs through the AKT signalling pathway. We concluded that CCN1 secreted by hADSCs enhances wound healing and promotes angiogenesis by activating the AKT signalling pathway. CCN1 plays a vital role in the regulation of hADSCs‐CM during wound healing.

Keywords: angiogenesis, CCN1, conditioned medium, hADSCs, wound healing

1. INTRODUCTION

Wound healing is a global public health concern. 1 Surgical incisions, thermal burns, accidental injuries, and chronic ulcers are all factors that may cause acute or refractory wounds. Failure to treat wounds can lead to a variety of complications, such as hypertrophic scars and disabilities, and cause a significant mental and financial burden on patients and their families. Cutaneous wound healing goes through four overlapping stages: haemostasis, inflammation, proliferation, and tissue remodelling. 2 , 3 New strategies, therapies, and techniques for different stages are being developed. Emerging evidence indicates that the application of stem cells can promote wound healing and tissue regeneration. Many researches have demonstrated that this effect is mainly mediated by paracrine. 4 , 5 Therefore, investigating and studying the proteins secreted by stem cells is crucial for understanding the molecular mechanisms by which stem cells regulate wound healing processes.

cellular communication network factor 1(CCN1), one of the CCN family of secreted proteins, is also known as cyr61. It is a cysteine‐rich, heparin‐binding protein. 6 The CCN family in mammals comprises six members that affect many physiological and pathological processes. 7 The CCN family was first described in the 1990s. 8 It exhibits proangiogenic activity, manifested by promoting endothelial migration, proliferation and tubule formation. 9 CCN1 are synthesised by many cell types which are associated with angiogenesis during wound healing. Previous researches have demonstrated that CCN1 affects the wound‐repairing process, and the application of rhCCN1 to wounds enhances repair. 10 , 11 To date, studies on CCN1 expression and regulation have been limited to bone marrow‐and tonsil‐derived mesenchymal stem cells. 12 , 13 Little data are available regarding the role of CCN1 in the healing of wounds treated with hADSCs.

Angiogenesis is an important process in wound healing. Many studies have shown that one of the mechanisms by which stem cells promote wound healing is by enhancing vascularization. The formation of new capillaries is the key to wound healing and tissue repair. New blood vessels can effectively increase blood perfusion in wounds, provide sufficient oxygen and nutrients for wound healing, and remove local metabolites to accelerate the tissue repair process. After healing, the wound undergoes angiogenesis, which involves proliferation, migration, and tube formation by endothelial cells. The AKT, also known as protein kinase B (PKB) signalling pathway is an important molecular pathway involved in vascularization. AKT signalling pathway also has an important role in the regulation of protein synthesis, cell proliferation, angiogenesis, and metabolism. The aim of our research was to explore whether CCN1 can be secreted by hADSCs and the role of CCN1 secreted by hADSCs in enhancing wound healing and explore the relevant molecular mechanisms.

2. MATERIALS AND METHODS

2.1. Cells and reagents

Fat tissues in our research were obtained from patients receiving liposuction at the Senior Department of Burns and Plastic Surgery of the Fourth Medical Center of PLA General Hospital. In accordance with the principles of the Declaration of Helsinki, each patient signed a written informed consent before participating in the study. The procedure for the isolation and culture of hADSCs was performed according to a previously described protocol. 14 The hADSCs at passages (P) 4–6 were used for experiments. Human umbilical vein endothelial cells (HUVECs) were obtained from The American Type Culture Collection (ATCC) and cultured in Dulbecco's modified Eagle medium (DMEM, Gibco) containing 10% FBS and 1% penicillin/streptomycin. The following antibodies were used: CCN1 (Proteintech, cat#26689‐1‐AP); phospho‐AKT (Ser473) antibody (Cell Signalling Technology, cat#9271), and AKT antibody (ell Signalling Technology, cat#9272).

2.2. Cell‐surface marker screening of hADSCs by flow cytometric analysis

P4 hADSCs were analysed by flow cytometry. Briefly, adherent cells were harvested by trypsinization, centrifuged at 1000 rpm for 5 minutes, washed with sterile phosphate‐buffered saline, and resuspended. The isolated cells were characterised by morphological and immunophenotypic analyses including the evaluation of the expression of surface markers CD105, CD73, CD29, CD34, CD45, and CD14 (OriCell Bioscience, HUXMX‐09011) by flow cytometry. An irrelevant antibody of the same isotype was used as the negative control. Specific experimental procedures are referred to in the manufacturer's instructions. We used FlowJo software (TreeStar, Inc., Ashland, USA) to analyse data.

2.3. Reverse transcription‐polymerase chain reaction (RT‐PCR)

Total RNA was extracted from each sample using TRIzol reagent (Invitrogen, USA). Prime Script RT Reagent Kit (Takara, China) was used to reverse‐transcribe RNA (1 μg) into cDNA. RT‐PCR assays were performed using SYBR Premix Ex Taq II (Takara, China) in a Real‐Time PCR System (Thermo Fisher Scientific) with the following primers: CCN1 sense, 5′‐CCAAGCAGCTCAACGAGGA‐3′ and CCN1 anti‐sense, 5′‐TGATGTTTACAGTTGGGCTGGAA‐3′; glyceraldehyde 3‐phosphate dehydrogenase (GAPDH) sense, 5′‐GCACCGTCAAGGCTGAGAAC‐3′ and GAPDH anti‐sense, 5′‐TGGTGAAGACGCCAGTGGA‐3′; actin sense, 5′‐CCTCGCCTTTGCCGATCC‐3′ and actin anti‐sense, 5′‐GGATCTTCATGAGGTAGTCAGTC‐3′. GAPDH or actin was used as the internal reference. Values are expressed for triplicate experiments as mean ± SEM. The PCR condition used was one cycle at 95°C for 30 seconds, followed by 40 cycles at 95°C for 5 seconds, 60°C for 30 seconds, 60°C for 30 seconds, and 95°C for 15 seconds. All PCR assays were performed in triplicate using 10 ng of cDNA.

2.4. Immunofluorescence assay

We used fluorescence microscopy to detect the intracellular localization of CCN1 in hADSCs. hADSCs were seeded onto glass slides in a petri dish and exposed to an anti‐CCN1 antibody (1:100; Proteintech, Wuhan, China) for over 10 h. Then they were incubated with the corresponding secondary antibody. Finally, DAPI (Beyotime Technology) was used to stain nuclei. The cells were photographed using an Olympus BX51 fluorescence microscope (Olympus, New Hyde Park, NY, USA).

2.5. ELISA

Isolated hADSCs were cultured, detached at 80% confluence, and passaged at a 1:3 ratio. hADSCs were transferred to plain Dulbecco's modified Eagle medium/nutrient mixture F‐12 (DMEM/F12, Gibco) and incubated for 48 hours. The culture medium was collected and cells and cellular debris were removed. The concentrations of CCN1 in the culture were determined by quantitative ELISA using a sandwich ELISA kit (MLBIO Biotechnology Co. Ltd, Shanghai, China).

2.6. Western blot analysis

After treatment, HUVEC were lysed in radioimmunoprecipitation assay buffer (Beyotime, China), and cell lysates were prepared. Samples containing 30 μg of protein were loaded on an SDS‐polyacrylamide gel and separated by electrophoresis. Then they were transferred onto a polyvinylidene difluoride membrane. Membranes were blocked with NcmBlot blocking buffer (NCM Biotechnology, Suzhou, China) and then exposed to primary antibodies directed against CCN1, AKT, p‐AKT, and GAPDH (1:1000 dilution). Horseradish peroxidase‐conjugated goat anti‐mouse/rabbit antibodies (Solarbio, China) were used as the secondary antibodies. Finally, proteins were visualised using enhanced chemiluminescence reagents (Applygen, Beijing, China).

2.7. Preparation of CCN1 siRNA and CCN1 knockdown

CCN1 siRNA and negative control were obtained from Tsingke Biotechnology Co. Ltd. (Beijing, China). The sequences of the siRNAs targeting the human CCN1 gene are listed in Table 1. The resultant siRNA was suspended in DEPC water at a concentration of 20 μM; 5 μL siRNA for CCN1 was combined with a 4 μL transfection reagent called TSnanofect (Tsingke Biotechnology) (with a concentration of TSnanofect at 40 nM) for 20 minutes before adding to the Petri dish. After 6 hours of co‐culture, the medium was replaced with DMEM/F12. CCN1 expression levels were investigated using quantitative RT‐PCR, western blotting, and ELISA. RNA was collected 24 hours after transfection, whereas proteins were collected 48 or 72 hours after transfection. The siCCN1‐1 construct showed the best results and was used in subsequent experiments.

TABLE 1.

The siRNA gene sequence targets of human CCN1 gene

Sense (5′–3′) Antisense (5′–3′)
siCCN1‐1 GGUAUCUCCACACGAGUUATT UAACUCGUGUGGAGAUACCTT
siCCN1‐2 GGCUGUUCAAUGACAUUCATT UGAAUGUCAUUGAACAGCCTT
siCCN1‐3 GUGACGAGGAUAGUAUCAATT UUGAUACUAUCCUCGUCACTT

Abbreviation: CCN1, cellular communication network factor 1.

2.8. Collection of conditioned medium (CM) of hADSCs

hADSCs were seeded in 100‐mm Petri dishes with DMEM/F12 medium containing 10% fetal bovine serum and 100 U/mL penicillin/streptomycin. The medium was changed to a 5 mL serum‐free DMEM/F12 medium when the cells reached 80% confluence. Conditioned medium was collected after 48 or 72 h and centrifuged at 3000 rpm for 10 minutes to remove cells and cellular debris. Before application, CM was filtered with a 0.22‐μm Millex‐GP syringe filter (Millipore, USA).

2.9. In vitro cell proliferation assay

The proliferating cells were identified using the BeyoClick™ EdU Cell Proliferation Kit with Alexa Fluor 488 (Beyotime Biotechnology, China). After treatment, EdU (50 μmol/L) was immediately added to the culture medium and incubated for 2 h. The cells were then fixed with 4% paraformaldehyde for 15 minutes. The nuclei were stained blue using Hoechst 33258. The proliferation rate was equal to the number of EdU‐positive cells/total cells.

2.10. In vitro migration assay

4 × 105 HUVECs per well were seeded in 6‐well dishes. A linear defect was created with a 1000‐μL pipette tip when the cells reached 90%–100% confluency. Then the dishes were gently washed with warm PBS to remove the medium serum and cell debris. Subsequently, the cells were cultured with DMEM/F12, hADSCs‐CM, hADSCs‐CMCCN1↓, DMEM/F12 containing 0.1 μg/mL rhCCN1, and DMEM/F12 containing 0.2 μg/mL rhCCN1 at 37°C in 5% CO2 for 48 h. Defects were photographed at 0, 24, and 48 h time points and the residual defect area was measured using Image J software.

2.11. In vitro tube formation assay

50 μL per well of Matrigel Basement Membrane Matrix (BD Biosciences, CA, USA) was added to pre‐cooling 96‐well plates and placed at 37°C for 1 h. Then, 2.0 × 104 HUVECs per well were seeded and treated with DMEM/F12, hADSCs‐CM, hADSCs‐CMCCN1↓, DMEM/F12 containing 0.1 μg/mL rhCCN1, and DMEM/F12 containing 0.2 μg/mL rhCCN1 (three replicates per group). After incubation at 37°C and 5% CO2, the tube formation was photographed using a microscope (Olympus, Tokyo, Japan) at 3, 6, and 9 hours.

2.12. Wound‐healing assay in a mouse model

To evaluate the therapeutic potential of hADSC‐CMs for wound healing, we established a wound model of a mouse. In the animal study, male C57BL/6 mice, weighing 24–26 g, were used. There were 5 mice in each group and the experiment was repeated three times. The detailed protocol for performing animal anaesthesia was described previously. 15 All animal experiments performed followed the National Research Council's Guide for the Care and Use of Laboratory Animals. After anaesthesia, we used a waterproof marker to draw a circle, with a diameter of 1 cm, on the dorsal skin of mice and used sterile scissors to cut full‐thickness skin along the circle to create a round excisional wound. Then we divided the mice randomly into the following five treatment groups: blank, negative control (DMEM/F12), CM‐treated (CM), CMCCN1↓‐treated (CMD), and 2 μg/mL rhCCN1‐treated. In the blank group, no treatment was administered to the wound. In the other groups, we equally injected a total volume of 200 μL plain DMEM/F12, hADSCs‐CM, hADSCs‐CMCCN1↓, or DMEM/F12 containing 2 μg/mL rhCCN1 into four sites in the wound edge and bed of each animal. These treatments were repeated on days 0, 3, 6, and 9. The wound size was measured and recorded using a digital camera on days 0–10. Ten days after the operation, the entire wound bed of each mouse was excised for subsequent analyses. Tissues were fixed in 4% paraformaldehyde. After alcohol dehydration and paraffin embedding, the samples were sectioned into 5‐μm thick sections perpendicularly before haematoxylin and eosin (HE) and immunohistochemical staining. The re‐epithelialization was evaluated by HE staining. Immunohistochemical staining for CD31 (1:100, GB12064, Servicebio) was performed to detect angiogenesis in wound beds.

2.13. Blood perfusion evaluation

Laser speckle contrast imaging (LSCI) was employed to investigate wound perfusion 10 days post‐operation. We used a blood perfusion imager (PeriCam PSI‐HR, PERIMED Ltd, Sweden) to visualise the tissue blood perfusion of each wound in real‐time. One unit of blood perfusion was obtained using a near‐infrared laser (785 nm). Images were taken at a fixed site with the same distance and angle from the wound surface. 16

2.14. Statistical analysis

All experimental data are presented as mean ± SD. Results were analysed using t‐tests (two groups) or one‐way ANOVA (≥3 groups). GraphPad Prism software 8.0 (GraphPad Software, Inc) was used to analyse data. Statistical significance was set at P < 0.05.

3. RESULTS

3.1. Identification and Characterisation of hADSCs

We observed that most of the adherent cells isolated and cultured were in spindle‐shaped, fibroblast‐like shape (Figure 1A). In our study, flow cytometry analysis was performed to measure the relevant biomarkers. These data demonstrated that CD105, CD73, and CD29 were highly expressed in hADSCs, while CD34, CD45, or CD14 were lowly expressed (Figure 1B). The results are consistent with the criteria for the characterisation of hADSCs.

FIGURE 1.

FIGURE 1

Identification of hADSCs. A, Representative photomicrograph of adherent spindle‐shaped hADSCs on a cell culture dish. B, Flow cytometry analysis showing CD105+, CD73+, CD29+, CD34, CD45 and CD14 hADSCs

3.2. CCN1 is present in hADSCs‐CM

The expression of CCN1 in hADSCs was validated using quantitative RT‐PCR, immunofluorescence, ELISA, and western blotting (Figure 2). Quantitative RT‐PCR revealed CCN1 expression in hADSCs (Figure 2A). Immunofluorescence microscopic analysis confirmed that CCN1 polypeptides were abundantly expressed in the cytosol of hADSCs (Figure 2B). Therefore, ELISA was used to examine its presence in hADSC‐CMs (Figure 2C). CCN1 polypeptides were detected in hADSCs lysates and siRNA CCN1‐knockdown hADSCs (hADSCsCCN1↓) (Figure 2C,D). These data indicate that CCN1 polypeptides are present in both cells, and hADSCs‐CM and CCN1 expression was decreased in hADSCsCCN1↓. Besides, there is no significant difference in CCN1 expression of hADSCs transfected for 48 and 72 hours. hADSCs‐CM collected 48 hours after transfection were used in subsequent experiments.

FIGURE 2.

FIGURE 2

Identification of CCN1 secreted by hADSCs. A, Quantitative RT‐PCR showing the expression of the CCN1 gene in hADSCs. CT is the number of cycles that the fluorescence signal in each reaction tube goes through when it reaches the set threshold. B, Immunofluorescent microscopic analysis showing abundant expression of CCN1 polypeptides in the cytosol of hADSCs. C, ELISA results show the presence of CCN1 polypeptides in hADSCs‐CM and siRNA CCN1‐knockdown hADSCs (hADSCsCCN1↓). CCN1, cellular communication network factor 1; D, CCN1 polypeptides were detected in hADSCs lysates and hADSCs.CCN1↓

3.3. Depletion of CCN1 reduces the proliferation, migration, and in vitro tube formation capability of hADSCs‐CM

The proliferation of HUVECs was observed using EdU fluorescence staining (Figure 3A). HUVECs in the proliferating phase exhibited green fluorescence under a fluorescence microscope. The percentage of nuclei with green fluorescence showed that hADSCs‐CM and rhCCN1 improved the proliferation of HUVECs compared with the other treatments. Similarly, 0.1 and 0.2 μg/mL rhCCN1 had a proliferation‐promoting capacity. The migration capacity of each group was evaluated by measuring the residual scratch wound area. No significant migration difference was found in the DMEM/F12 and hADSC‐CMCCN1↓ treated groups at either time point. As shown in Figure 3B, the wound area in the hADSCs‐CM or rhCCN1‐treated groups was remarkably lower than that in other groups at 24 and 48 hours, indicating higher migration capacity. The HUVECs treated with 0.2 μg/mL rhCCN1 also exhibited a higher migration capacity than those treated with 0.1 μg/mL rhCCN1, albeit insignificant. The results of the tubule formation experiment complemented those of proliferation and migration assays. hADSCs‐CM‐ and rhCCN1‐stimulated HUVECs formed more capillary‐like tubes on Matrigel compared to DMEM/F12 and hADSCs‐CMCCN1↓ ‐stimulated HUVECs at 3, 6, and 9 hours (Figure 3C). Besides, we also found that the stimulatory effects of hADSCs‐CM on proliferation, migration, and tube formation in HUVEC were impaired with the knockdown of CCN1 expression in hADSCs.

FIGURE 3.

FIGURE 3

CCN1 secreted by hADSCs promotes proliferation, migration, and tube formation of HUVEC. A, EdU staining and quantitative analysis of HUVECs treated with DMEM/F12(control), hADSCs‐CM (CM), hADSCs‐CMCCN1↓ (CMD), DMEM/F12 containing 0.1 μg/mL rhCCN1 and DMEM/F12 containing 0.2 μg/mL rhCCN1. B, Comparison of HUVEC migration and quantitative analysis of the treatment groups. Images were taken at 0, 24, and 48 hours. C, CCN1 promotes tube formation of HUVECs in vitro. HUVECs (2.0 × 104 per well) were seeded and treated with DMEM/F12(control), hADSC‐CM (CM), hADSCs‐CMCCN1↓ (CMD), DMEM/F12 containing 0.1 μg/mL rhCCN1, and DMEM/F12 containing 0.2 μg/mL rhCCN1. Tube formation was detected under a microscope at 3, 6, and 9 hours. CCN1, cellular communication network factor 1

3.4. hADSCs‐CM and CCN1 promote proliferation and migration of HUVECs through the AKT signalling pathway

Since we found that hADSCs‐CM and rhCCN1 promoted proliferation, migration, and tube formation in HUVEC, we further investigated their mechanism of action. Since the AKT signalling pathway is important in cell survival, apoptosis, and skin development, we hypothesised that AKT might be involved in the biological effects of hADSCs‐CM and rhCCN1 on HUVECs. AKT is activated by phosphorylation. The levels of phospho‐AKT and phospho‐AKT/AKT reflect the activation of this pathway. In our study, the levels of phospho‐AKT were low in DMEM/F12‐treated HUVEC, whereas levels of phospho‐AKT were increased in hADSCs‐CM and rhCCN1‐treated HUVEC (Figure 4A,B). To determine whether the AKT signalling pathway is necessary for hADSC‐CM‐mediated angiogenesis, we treated HUVECs with hADSCs‐CM or hADSCs‐CMCCN1↓. We found that hADSCs‐CMCCN1↓ treatment reduced the level of phospho‐AKT, whereas treatment with rhCCN1 had the opposite effect. These results indicated that hADSCs‐CM and CCN1 activate the AKT signalling pathway in HUVECs.

FIGURE 4.

FIGURE 4

Western blot assay for protein expression. The phospho‐AKT (also known as protein kinase B [PKB]) and total AKT in HUVEC with different treatments were determined by western blot analysis. A, CCN1 secreted by hADSCs promoted angiogenesis by activating AKT signalling. B, AKT signalling pathway is necessary for the hADSC‐CM mediated angiogenesis. CCN1, cellular communication network factor 1

3.5. hADSCs‐CM and CCN1 promote wound healing and increase angiogenesis in a mouse model

A full‐thickness skin wound model in C57BL/6 mice was established to evaluate the effect of hADSCs‐CM on wound healing. Figure 5 presents the wound model used in this study, in which different therapies were performed on those round skin wounds (1 cm in diameter). The five treatment groups included: a no‐treatment control group (blank), DMEM/F12 group (control), hADSCs‐CM group (CM), hADSCs‐CMCCN1↓ group (CMD) and 2 μg/mL rhCCN1. The results showed that the healed wound size varied in each treatment group. The wounds of mice models in the hADSCs‐CM and 2 μg/mL rhCCN1‐treated group healed faster, and H&E staining revealed a continuous epidermal layer was observed on day 10 (Figure 5A,B).

FIGURE 5.

FIGURE 5

A wound model and a wound‐healing assay of HUVECs treated with DMEM/F12(control), hADSCs‐CM, hADSCs‐CMCCN1↓, DMEM/F12 containing 2 μg/mL rhCCN1. A, Representative images of the wounds on days 0, 3, 5, 7, and 10 from mice in each group (n = 5) and histological assessment of the wound tissue on day 10. B, Statistical analysis of the wound area (n = 3). C, Blood flow at the wound sections of different groups on day 10 was evaluated by Doppler perfusion imaging of wounds. Slides containing wound tissue were stained with CD31 on day 10. CCN1, cellular communication network factor 1

To further estimate the capability of hADSCs‐CM and CCN1 to promote healing, immunohistochemical staining for CD31 and blood perfusion evaluation were used to analyse the tissue sections of the wound bed on day 10. In the wound areas, we found increased blood perfusion and endothelial cell marker CD31 expression in the hADSCs‐CM and 2 μg/mL rhCCN1‐treated groups compared with the control group (Figure 5C).

4. DISCUSSION

Wound healing remains a difficult problem owing to its complex underlying pathology. Many comorbidities, such as infection, diabetes, or general malnutrition complicate wound healing. There is an increase in new research and technology focused on promoting wound healing. Stem cells have been known to have beneficial effects on wound repair and tissue regeneration. 1 Fat tissue, usually a medical waste produced after liposuction, contains large amounts of stem cells, namely ADSC. In the present study, we isolated hADSCs from the donor's fat tissue and observed a spindle‐shaped and fibroblast‐like morphology. hADSCs express many mesenchymal stem cell‐specific surface markers. 17 Our results showed that the isolated stem cells have high CD105, CD73, and CD29 expressions and low CD34, CD45, and CD14 expressions, meeting the classification criteria for mesenchymal stem cells. 18

hADSCs promote wound repair and tissue regeneration by secreting various growth factors. Here, we found that treatment with hADSCs‐CM considerably increased HUVEC proliferation, migration, and tube formation relative to the control group and hADSCs‐CMCCN1↓‐treated groups, suggesting that hADSCs‐CM contains some factor(s) responsible for HUVEC angiogenesis. Vascular endothelial growth factor, keratinocyte growth factor, and platelet‐derived growth factor AA, which are secreted by hADSCs, are key angiogenesis regulators during wound healing. CCN1 has been reported to be an angiogenic factor. 19 In the present study, we found that CCN1 is enriched in hADSC‐CMs. Angiogenesis is an important process for wound healing. Little data are available on whether CCN1 secreted by hADSCs plays a vital role in promoting angiogenesis. We investigated CCN1 secreted by hADSCs and its ability to enhance angiogenesis and wound healing. CCN1 secreted by hADSCs, in vitro, facilitated proliferation, migration, and tube formation in HUVECs, and these effects were distinctly reduced when CCN1 levels decreased. Therefore, CCN1 was essential in stimulating HUVEC proliferation, migration, and tube formation by hADSCs‐CM. We also explored potential underlying mechanisms, including signalling in HUVECs. Previous reports have shown that overexpression of CCN1 promotes tumour growth by activating the AKT signalling pathway. 20 Active AKT affects many cellular functions, including protein synthesis, survival, proliferation, and metabolism. In our study, we obtained similar results using HUVEC. The level of phospho‐AKT/AKT increased in HUVEC treated with hADSCs‐CM and rhCCN1 compared to those treated with plain DMEM/F12. When treated with hADSCs‐CM with low levels of CCN1 (hADSCs‐CMCCN1↓), the level of phospho‐AKT/AKT decreased compared to that in hADSCs‐CM. Therefore, the AKT signalling pathway was activated by CCN1 in hADSCs‐CM‐treated HUVECs. Using siRNA technology and recombinant proteins, we confirmed that CCN1 plays a crucial role in the regulatory effects of hADSCs‐CM on wound healing.

We confirmed this finding in mice, which are commonly used animal models for wound healing. First, we used a splint wound model. In practice, splints easily come off, and it is difficult to control the shedding time of the splint. This eventually leads to significant inter‐ and intra‐group differences, which hinders the evaluation of experimental results. Finally, we selected an unsplinted wound model. In addition, we used sterile scissors to cut full‐thickness skin along the circle to make a round excisional wound, which enabled us to accurately create wounds of the same size.

Cutaneous wound healing and tissue repair is a complicated process that involves a large number of cell types, tissues, cytokines, and chemokines. Many cells such as fibroblasts, keratinocytes, and endothelial cells are involved in the wound‐healing process. 16 According to previous studies, ADSCs promote wound healing by affecting these cells. Kim et al. previously found that ADSCs could enhance skin wound healing by improving fibroblast proliferation, collagen synthesis, and migration. 21 Du et al. demonstrated that CCN1 promotes keratinocyte migration and proliferation, thereby accelerating re‐epithelialization during cutaneous wound healing. 10 CCN1 also regulates inflammation and wound repair, triggers efferocytosis, and induces fibroblast senescence during wound healing. To our knowledge, this is the first study to report that CCN1 secreted by hADSCs plays a vital role in promoting angiogenesis and accelerating wound closure both in vitro and in vivo.

5. CONCLUSION

In this study, we found that CCN1 was enriched in hADSC‐CMs and played a vital role in wound healing following hADSC‐CM treatment. Further, we demonstrated that hADSCs‐CM and rhCCN1 promote angiogenesis and accelerate wound healing. Our study provides important new insights and evidence in understanding the molecular mechanisms involved in the mechanism of CCN1 in enhancing wound healing. We surmise that CCN1 activates AKT signalling pathway and promotes angiogenesis, ultimately leading to wound healing.

AUTHOR CONTRIBUTIONS

Yi Yang: Data curation, Writing—Original draft preparation, Methodology. Shiyi Li: Conceptualization, Software. Xuer Sun: Visualisation, Investigation. Lixia Zhang: Supervision. Minliang Chen: Conceptualization, Writing—Review and Editing. Huijuan Fu: Revision.

FUNDING INFORMATION

This research did not receive any specific grants from funding agencies in the public, commercial, or not‐for‐profit sectors.

CONFLICT OF INTEREST

The authors declare no conflict of interest.

ETHICAL STATEMENT

The authors obtained informed consent from the patients.

ACKNOWLEDGEMENTS

The authors would like to express gratitude to Mr Wenjun Xie, who gave kind encouragement throughout the writing of the article.

Yang Y, Li S, Sun X, Zhang L, Chen M, Fu H. CCN1 secreted by human adipose‐derived stem cells enhances wound healing and promotes angiogenesis through activating the AKT signalling pathway. Int Wound J. 2023;20(5):1667‐1677. doi: 10.1111/iwj.14028

DATA AVAILABILITY STATEMENT

The data that support the findings of this study are available on request from the corresponding author. The data are not publicly available due to privacy or ethical restrictions.

REFERENCES

  • 1. Li J‐Y, Ren K‐K, Zhang W‐J, et al. Human amniotic mesenchymal stem cells and their paracrine factors promote wound healing by inhibiting heat stress‐induced skin cell apoptosis and enhancing their proliferation through activating PI3K/AKT signaling pathway. Stem Cell Res Ther. 2019;10(1):247. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Adib Y, Bensussan A, Michel L. Cutaneous wound healing: a review about innate immune response and current therapeutic applications. Mediators Inflamm. 2022;2022:5344085‐5344016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Wu L‐W, Chen W‐L, Huang S‐M, Chan JY‐H. Platelet‐derived growth factor‐AA is a substantial factor in the ability of adipose‐derived stem cells and endothelial progenitor cells to enhance wound healing. FASEB J. 2019;33(2):2388‐2395. [DOI] [PubMed] [Google Scholar]
  • 4. Liang X, Ding Y, Zhang Y, Tse H‐F, Lian Q. Paracrine mechanisms of mesenchymal stem cell‐based therapy: current status and perspectives. Cell Transplant. 2014;23(9):1045‐1059. [DOI] [PubMed] [Google Scholar]
  • 5. Aboulhoda BE, Abd El Fattah S. Bone marrow‐derived versus adipose‐derived stem cells in wound healing: value and route of administration. Cell Tissue Res. 2018;374(2):285‐302. [DOI] [PubMed] [Google Scholar]
  • 6. Babic AM, Kireeva ML, Kolesnikova TV, Lau LF. CYR61, a product of a growth factor‐inducible immediate early gene, promotes angiogenesis and tumor growth. Proc Natl Acad Sci USA. 1998;95(11):6355‐6360. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Brigstock DR. The CCN family: a new stimulus package. J Endocrinol. 2003;178(2):169‐175. [DOI] [PubMed] [Google Scholar]
  • 8. O'Brien TP, Yang GP, Sanders L, Lau LF. Expression of cyr61, a growth factor‐inducible immediate‐early gene. Mol Cell Biol. 1990;10(7):3569‐3577. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Di Y, Zhang Y, Yang H, Wang A, Chen X. The mechanism of CCN1‐enhanced retinal neovascularization in oxygen‐induced retinopathy through PI3K/Akt‐VEGF signaling pathway. Drug Des Devel Ther. 2015;9:2463‐2473. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Du H, Zhou Y, Suo Y, et al. CCN1 accelerates re‐epithelialization by promoting keratinocyte migration and proliferation during cutaneous wound healing. Biochem Biophys Res Commun. 2018;505(4):966‐972. [DOI] [PubMed] [Google Scholar]
  • 11. Chen CC, Mo FE, Lau LF. The angiogenic factor Cyr61 activates a genetic program for wound healing in human skin fibroblasts. J Biol Chem. 2001;276(50):47329‐47337. [DOI] [PubMed] [Google Scholar]
  • 12. Estrada R, Li N, Sarojini H, An J, Lee M‐J, Wang E. Secretome from mesenchymal stem cells induces angiogenesis via Cyr61. J Cell Physiol. 2009;219(3):563‐571. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Park YS, Hwang S, Jin YM, et al. CCN1 secreted by tonsil‐derived mesenchymal stem cells promotes endothelial cell angiogenesis via integrin αv β3 and AMPK. J Cell Physiol. 2015;230(1):140‐149. [DOI] [PubMed] [Google Scholar]
  • 14. Zuk PA, Zhu M, Mizuno H, et al. Multilineage cells from human adipose tissue: implications for cell‐based therapies. Tissue Eng. 2001;7(2):211‐228. [DOI] [PubMed] [Google Scholar]
  • 15. Chen L, Mirza R, Kwon Y, DiPietro LA, Koh TJ. The murine excisional wound model: contraction revisited. Wound Repair Regen. 2015;23(6):874‐877. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Wei Q, Wang Y, Ma K, et al. Extracellular vesicles from human umbilical cord mesenchymal stem cells facilitate diabetic wound healing through MiR‐17‐5p‐mediated enhancement of angiogenesis. Stem Cell Rev Rep. 2022;18(3):1025‐1040. [DOI] [PubMed] [Google Scholar]
  • 17. Lv F‐J, Tuan RS, Cheung KMC, Leung VYL. Concise review: the surface markers and identity of human mesenchymal stem cells. Stem Cells. 2014;32(6):1408‐1419. [DOI] [PubMed] [Google Scholar]
  • 18. Bailey AM, Kapur S, Katz AJ. Characterization of adipose‐derived stem cells: an update. Curr Stem Cell Res Ther. 2010;5(2):95‐102. [DOI] [PubMed] [Google Scholar]
  • 19. Kireeva ML, Mo FE, Yang GP, Lau LF. Cyr61, a product of a growth factor‐inducible immediate‐early gene, promotes cell proliferation, migration, and adhesion. Mol Cell Biol. 1996;16(4):1326‐1334. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Goodwin CR, Lal B, Zhou X, et al. Cyr61 mediates hepatocyte growth factor‐dependent tumor cell growth, migration, and Akt activation. Cancer Res. 2010;70(7):2932‐2941. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Kim W‐S, Park B‐S, Sung J‐H, et al. Wound healing effect of adipose‐derived stem cells: a critical role of secretory factors on human dermal fibroblasts. J Dermatol Sci. 2007;48(1):15‐24. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The data that support the findings of this study are available on request from the corresponding author. The data are not publicly available due to privacy or ethical restrictions.


Articles from International Wound Journal are provided here courtesy of Wiley

RESOURCES